FUNCTIONAL AND GENETIC ANALYSIS OF PLANT TRANSCRIPTION
FACTORS INVOLVED IN THE PLANT GROWTH UNDER VARIOUS
ENVIRONMENTAL CONDITIONS
Except where reference is made to the work of others, the work described in this
dissertation is my own or was done in collaboration with my advisory committee.
This dissertation does not include proprietary or classified information
Kun Yuan
Certificate of Approval:
Joanna Wysocka-Diller, Co-Chair
Associate Professor
Biological Sciences
Narendra K. Singh, Co-Chair
Professor
Biological Sciences
Fenny Dane
Professor
Horticulture
Omar A. Oyarzabal
Assistant Professor
Poultry Science
George T. Flowers
Interim Dean
Graduate School
FUNCTIONAL AND GENETIC ANALYSIS OF PLANT TRANSCRIPTION
FACTORS INVOLVED IN THE PLANT GROWTH UNDER VARIOUS
ENVIRONMENTAL CONDITIONS
Kun Yuan
A Dissertation
Submitted to
the Graduate Faculty of
Auburn University
in Partial Fulfillment of the
Requirements for the
Degree of
Doctor of Philosophy
Auburn, Alabama
May 10, 2008
iii
FUNCTIONAL AND GENETIC ANALYSIS OF PLANT TRANSCRIPTION
FACTORS INVOLVED IN THE PLANT GROWTH UNDER VARIOUS
ENVIRONMENTAL CONDITIONS
Kun Yuan
Permission is granted to Auburn University to make copies of this dissertation at its
discretion, upon request of individuals of institutions and at their expense. The author
reserves all publication rights.
Signature of Author
Date of Graduation
iv
VITA
Kun Yuan, daughter of Shiquan Yuan and Huafang Guo, was born on July 10,
1975, in Changsha, China. She attended Hunan Medical School, Changsha, China, for
seven years, and graduated with a Medical Doctor Degree in July 2000. After graduation,
she worked in People?s Hospital of Guangdong Province, Guangzhou, China, from July,
2000 to July, 2001. She began graduate studies at Auburn University, Alabama, USA in
Aug 2001, where she worked as a graduate research and teaching assistant. She married
Guangbing Wu, son of Zhenxi Wu and Honglian Xue, at Auburn, Alabama, USA in 2003.
She has two daughters, Linda Wu, two years old and Karissa Wu, one year old.
v
DISSERTATION ABSTRACT
FUNCTIONAL AND GENETIC ANALYSIS OF PLANT TRANSCRIPTION
FACTORS INVOLVED IN THE PLANT GROWTH UNDER VARIOUS
ENVIRONMENTAL CONDITIONS
Kun Yuan
Doctor of Philosophy, May 10, 2008
(M.S., Auburn University, 2005)
(MD, Xiangya Medical School, Central South University, China, 2000)
157 Typed Pages
Directed by Joanna Wysocka-Diller and Narendra K. Singh
Arabidopsis serves as a model system for the plant molecular biology. Many
biotic and abiotic factors affect plant growth from seed germination to mature plant
growth. External factors studied in our research include nutrients and salinity.
Phytohormone pathways interact with glucose and salt stress signaling pathways to affect
plant growth. Abscisic acid (ABA) and gibberellic acid (GA) are two important
phytohormones that impact the plant development. Exogenous glucose and salt stress
delay seed germination in Arabidopsis thaliana not only in wild type (WT) but also in a
number of mutants in hormone signaling pathways. Our study demonstrates that the ABA
vi
Insensitive 3 (ABI3) gene in the ABA signaling pathway and the RGA-like 2
(RGL2) genes in the GA signaling pathways playing important roles in the glucose-
induced delay and salt inhibition of seed germination. Transcription of the ABI3 and
RGL2 genes is up-regulated by glucose and salt. The study also demonstrates that several
genes in ABA and GA signaling pathways have essential functions during early and later
seedling development. This study suggests that different genes in ABA and GA signaling
pathways are involved at different developmental stages under stress condition and
glucose treatment. The possible crosstalk between different hormone signaling pathways
exists under salt and osmotic stress conditions. Three genes in the GRAS family,
SCARECROW (SCR), SHORT ROOT (SHR) and SCARECROW-LIKE 3 (SCL3) are
involved in the salt-induced inhibition of seedling development. Transcription of the SCR
and SHR genes is up-regulated by salt. There are differences in stress tolerance between
genotypes or differences in stress tolerance at different developmental stages within a
single genotype. This study also demonstrated the interaction among GRAS family genes
(SCR, SHR and SCL3) and components (SOS1, SOS2 and SOS3) in Salt overly sensitive
(SOS) signaling pathway. The result indicated that SCR and SHR may play important
roles in the salt-induced inhibition of seedling development via regulating transcription
levels of SOS1, 2 and 3 in SOS signaling pathway.
vii
ACKNOWLEDGMENTS
The author would like to thank her major advisor Dr. Joanna Wysocka-Diller for
her guidance throughout this entire project. The author would like to thank other faculty,
Dr. Narendra K. Singh, Dr. Fenny Dane and Dr. Omar A. Oyarzabal, for their advice.
The author would also like to thank AU-CMB for my fellowship and AU VPR for the
biogrant that funded this research.
The author would like to thank her husband Guangbing Wu for his support and
endless love. Thanks are also due to her father Shiquan Yuan and other family members
for their moral supports during the course of this investigation.
viii
Style manual or journal used: Journal of Experimental Botany
Computer software used: WordPerfect, version 10, Quattro Pro, version 10, SAS, version,
8.2.
ix
TABLE OF CONTENTS
LIST OF TABLES............................................................................................................. xi
LIST OF FIGURES .......................................................................................................... xii
CHAPTER I. INTRODUCTION.........................................................................................1
CHAPTER II. RESEARCH OBJECTIVES .....................................................................25
CHAPTER III. PHYTOHORMONE SIGNALING PATHWAY INTERACT WITH
SUGARS DURING SEED GERMINATION AND SEEDLING DEVELOPMENT .....26
Abstract.............................................................................................26
Introduction.......................................................................................28
Results...............................................................................................31
Discussion.........................................................................................37
Materials and methods ......................................................................41
Acknowledgements...........................................................................45
References.........................................................................................46
CHAPTER IV. PHYTOHORMONE SIGNALING PATHWAYS INTERACT WITH
SODIUM CHLORIDE DURING SEED GERMINATION AND SEEDLING
DEVELOPMENT..............................................................................................................66
Abstract.............................................................................................66
Introduction.......................................................................................68
x
Results...............................................................................................69
Discussion.........................................................................................76
Materials and methods ......................................................................80
Acknowledgements...........................................................................83
References.........................................................................................84
CHAPTER V. GENES IN GRAS FAMILY AND PHYTOHORMONE PATHWAYS
ARE INVOLVED IN THE SALT EFFECT ON SEED GERMINATION AND LATER
SEEDLING DEVELOPMENT IN ARABIDOPSIS.......................................................101
Abstract...........................................................................................101
Introduction.....................................................................................102
Results.............................................................................................106
Discussion.......................................................................................114
Materials and methods ....................................................................117
Acknowledgements.........................................................................122
References.......................................................................................123
CHAPTER VI. CONCLUSIONS ....................................................................................140
xi
LIST OF TABLES
CHAPTER III
Table 1. Relative mRNA Levels Comparison in Mutant or WT Seeds in H2O or with
Glucose/ABA Treatment ...................................................................................................49
CHAPTER IV
Table 1. Relative mRNA Levels Comparison in Mutant or WT Seeds in H2O or with
Salt Treatment....................................................................................................................87
xii
LIST OF FIGURES
CHAPTER III
Figure 1A. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination on 0.5MS.
............................................................................................................................................50
Figure 1B. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination 0.5MS
containing 2.5% glucose ....................................................................................................51
Figure 1C. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination on 0.5MS
containing 2.5% glucose ....................................................................................................52
Figure 2. Effects of mannose on seed germination. Percent germination of WT and
mutants, 10 days after transfer to a growth chamber, on 0.5MS containing different
concentrations of mannose.................................................................................................53
Figure 3A. Percent germination of WT and mutants, on 0.5MS containing: 1 ?M ABA.54
Figure 3B. Percent germination of WT and mutants, on 0.5MS containing: 3?M ABA ..55
Figure 3C. Percent germination of WT and mutants, on 0.5MS containing: 10-5 M PAC 56
Figure 3D. Percent germination of WT and mutants, on 0.5MS containing: 10-4 M PAC57
Figure 4A. Representative WT rosettes grown on various concentrations of glucose,
sorbitol and glucose plus sorbitol ......................................................................................59
Figure 4B. Root length of WT grown on various concentrations of glucose, sorbitol and
glucose plus sorbitol ..........................................................................................................60
xiii
Figure 4C. Shoot weight of WT grown on various concentrations of glucose, sorbitol and
glucose plus sorbitol ..........................................................................................................61
Figure 4D. WT and GA signaling mutant rosettes grown on various concentrations of
glucose ...............................................................................................................................62
Figure 4E. Root length of WT and GA signaling mutant grown on various concentrations
of glucose...........................................................................................................................63
Figure 4F. Shoot weight of WT and GA signaling mutant grown on various
concentrations of glucose...................................................................................................64
Figure 5. Proposed model for interactions between glucose, ABA and GA signaling
pathways during seed germination and later stages of seedling development...................65
CHAPTER IV
Figure 1A. Percentage of WT and mutant germination on 0.5MS containing different
concentrations of sodium chloride.....................................................................................89
Figure 1B. Time course of abi3-1, abi5-1, rgl2-1, and WT (Ler and Ws) seed germination
on 250mM sodium chloride...............................................................................................90
Figure 1C. WT and mutant seed germination percentages on plates containing mannitol91
Figure 1D. Time course of abi3-1, rgl2-1, and WT (Ler) seed germination on 400mM
mannitol .............................................................................................................................92
Figure 2A. Completion of germination under salt stress. ..................................................93
Figure 2B. Percentage of WT and mutant seedling survival .............................................94
Figure 2C. Root length of WT and mutant seedlings, on 0.5MS without salt...................95
xiv
Figure 2D. Root length of WT and mutants seedlings, on 0.5MS containing 50mM
NaCl? ...............................................................................................................................96
Figure 2E. Root length of WT and mutants seedlings on 0.5MS containing 75mM NaCl97
Figure 3A. Completion of germination under osmotic stress............................................98
Figure 3B. WT and mutant germinated seedling survival on various concentrations of
mannitol .............................................................................................................................99
Figure 4. Proposed model for interactions between salt, ABA and GA signaling pathways
during seed germination...................................................................................................100
CHAPTER V
Figure 1A. Three root phenotypes of seedlings from heterozygous scl3-1 .....................127
Figure 1B. The root growth of two potentially heterozygous scl3-1 lines ......................128
Figure 1C. Comparison of representative WT, scl3-2 and scl3-3 mutant 12-day seedlings
on control and 120mM NaCl plates.................................................................................129
Figure 2A. Schematic representation of SCL3 locus.......................................................130
Figure 2B. PCR diagnostic tests for the presence of T-DNA in scl3-1 line ....................131
Figure 2C. Truncated protein translated from scl3-1 mutant? ? ? ? ? ? ? .? ? ? ..132
Figure 2D. PCR diagnostic tests for scl3-2 and scl3-3 plants..........................................133
Figure 3A. Induction of gene expression by salt .............................................................134
Figure 3B. Real time PCR. mRNA levels in 10 day mutant roots/ mRNA levels in 10 day
WT roots imbibed in H2O at 4oC for 12 hours.................................................................135
Figure 3C. mRNA levels in 10 day mutant roots/ mRNA levels in 10 day WT roots
imbibed in 200mM NaCl at 4oC for 12 hours..................................................................136
xv
Figure 4A. Time course of WT and scl3 mutant seed germination on 0.5MS or 0.5MS
containing 200mM NaCl..................................................................................................137
Figure 4B. Percentage of WT and mutants seeds germination on 0.5MS or 0.5MS
containing 200mM NaCl..................................................................................................138
Figure 5. Proposed model for interactions between SOS signaling pathway and
transcriptional regulators in GRAS family under salt stress............................................139
1
I. INTRODUCTION
Biotechnical significance of Arabidopsis
In recent years much progress has been made in the field of plant biology by
using Arabidopsis thaliana as a model system. Arabidopsis has one of the smallest plant
genomes, 120 Mb, that has been sequenced in its entirety. Its genome contains about
26,000 predicted genes, most of their functions are unknown. Conservation of basic
mechanisms within the plant kingdom has been well documented (Peng et al., 1999).
Isolation of mutants defective in various aspects of embryonic/postembryonic
development, and various growth responses to plant hormones or to environmental
abiotic "factors" has led to the identification of some key genes involved in these
processes. Identification and understanding of the key pathways and interactions of all
the molecular components involved will allow for generation and testing of crops to solve
the world hunger problem.
The effect of sugars on plants
Complex regulatory networks have been used by different organisms to sense
nutrient signals and regulate gene expression in order to adapt to environmental and
metabolic cues (Wang et al., 2003). Plants are extremely sensitive and responsive to their
surroundings because they are immobile and have few options for survival. Plant and
microbial genes have similar responses to carbohydrate depletion but differ as well.
2
Sugar concentrations vary over a wide range in plant tissues. This range typically
exceeds that found in more homeostatic systems (such as the mammalian blood stream)
and provides plants a greater chance to adjust according to the environmental changes for
survival. Microarray analysis suggested that expression levels of a very large number of
genes respond to changes in glucose concentration (Price et al., 2004). Sugar regulates a
broad range of gene types, ranging from stress responses and cellular metabolism to those
involved in signaling/gene regulation. Sugar-regulated genes are important for plants to
adjust to environmental changes. Genes for sucrose metabolism can be up-regulated in
photosynthetic tissues following manipulations that cause sugars to accumulate. High
sugar levels can strongly affect genes for sucrose metabolism. For example, those
encoding ADPG-pyrophosphorylase (AGPase), a key step in starch biosynthesis, are
markedly responsive to sugar in potato (Krapp et al., 1993). Not only genes encoding
enzymes but also a large number of transcription factors (TFs) were found to be glucose-
regulated. Many of them are up-regulated and others are down-regulated (Price et al.,
2004).
The levels of glucose and other sugars have effect on seed germination and early
seedling development. Different concentrations of sugars may exert varying effects. Both
low and high concentrations of glucose delay seed germination but even 0.33M glucose
cannot totally inhibit seed germination (Ullah et al., 2002; Price et al., 2003; Dekkers et
al., 2004). A glucose analog, 3-O-methylglucose, which is a very poor substrate for
hexokinase was also shown to delay seed germination at similar concentrations as
glucose (Dekkers et al., 2004). It indicated that the delay of seed germination by
3
relatively low concentrations of exogenous glucose and 3-O-methylglucose may occur
via a hexokinase-independent mechanism. In contrast, a better substrate for hexokinase,
mannose, was found to completely inhibit seed germination at concentrations as low as
5?10 mM. Neither glucose nor 3-O-methylglucose has a significant effect on seed
germination at such low concentrations (Cortes et al., 2003). Mannose inhibition of seed
germination may be via a hexokinase-dependent pathway whereas glucose induced
germination delay appears to be independent of hexokinase (Pego et al., 1999).
Besides mediating early developmental events, soluble sugars also affect the
formation of more adult structures, such as leaves, nodules, pollen, tubers and roots. The
formation of extra organs, such as extra tubers and adventitious roots can be induced by
sugar application (Xu et al., 1998). Under- and over expression of hexokinases 1 and 2
fail to alter tuber yield, suggesting that hexokinases do not play a major role in the
regulation of tuber formation (Veramendi et al., 1999). Glucose and fructose increase the
formation of adventitious roots but mannose and sorbitol do not. It indicates that the
effect is not due to alterations in the osmotic potential of the media and that only
metabolizable sugars are effective in indication of adventitious root formation. The
effects of sugars on the formation of adventitious roots are dependent on sugar
concentrations (Druege et al., 2004).
The effect of salt stress on plants
Soil salinity is one of the most significant abiotic stresses limiting plant growth.
High salinity causes both hyperionic and hyper osmotic stress and can lead to plant death.
Salt stress essentially results in a water deficit condition in the plant and takes the form of
4
a physiological drought. Excess salts adversely affect all major metabolic activities in
plants including cell wall damage, accumulation of electron-dense proteinaceous particles,
plasmolysis, cytoplasmic lysis and damage to ER, and overall decline in germination and
seedling growth (Garcia et al., 1997; Khan et al., 1997; Sivakumar et al., 1998). The
major ions involved in salt stress signaling, include Na+, K+, H+ and Ca2+. It is the
interplay of these ions, which brings homeostasis in the cell. Although Na+ is a plant
micronutrient, excess Na+ levels are toxic for plant growth. Influx of Na+ dissipates the
membrane potential and facilitates the uptake of Cl- down the chemical gradient. Na+ is
toxic to cell metabolism and has deleterious effect on the functioning of some of the
enzymes (Niu et al., 1995). High concentrations of Na+ causes osmotic imbalance,
membrane disorganization, reduction in growth, inhibition of cell division and expansion.
High Na+ levels also lead to reduction in photosynthesis and production of reactive
oxygen species (Yeo, 1998). Ca2+ has role in providing salt tolerance to plant. Externally
supplied Ca2+ reduces the toxic effects of NaCl, presumably by facilitating higher K+/Na+
selectivity (Liu and Zhu, 1998). High salinity results in increased cytosolic Ca2+ that is
transported from the apoplast as well as the intracellular compartments. This transient
increase in cytosolic Ca2+ initiates the stress signal transduction leading to salt adaptation.
The adaptation of plant cells to stress conditions involves triggering a network of
signaling events. Little was known about the salt stress signaling pathways until the SOS
(salt overly sensitive) genes in SOS pathway in Arabidopsis were identified. SOS genes
were identified through positional cloning. Sos1 (Salt Overly Sensitive 1), 2 and 3
mutants were identified by using a root-bending assay on NaCl containing agar plates
5
(Wu et al., 1996; Liu et al., 1997; Zhu et al., 1998). SOS1 gene encodes the plasma
membrane Na+/H+ exchanger (antiporter) (Shi et al., 2000). SOS2 gene encodes a
serine/threonine type protein kinase which activity is required for salt tolerance (Liu et al.,
2000). The N-terminal kinase catalytic domain of SOS2 is similar to that of the yeast Suc
nonfermenting1 (SNF1) and AMP-activated (AMPK) kinases (Hardie, 1999). The N-
terminal catalytic domain and the C-terminal regulatory domain of SOS2 are essential for
SOS2 normal function. SOS3 encodes a protein that acts as a Ca2+ sensor in the plant. The
sequence of SOS3 has a significant similarity with that of the calcineurin B subunit from
yeast and neuronal calcium sensors from animals (Liu and Zhu, 1998). SOS3 and SOS2
interaction has been shown in the yeast two-hybrid assay and the analysis of double
mutant sos3/sos2 suggested that SOS2 and SOS3 work in the same pathway (Halfter et al.,
2000). SOS2 and SOS3 genes not only interact together but also regulate SOS1 gene
expression. SOS1 gene expression level is low in wild-type (WT) in the condition without
salt but is up regulated by salt stress. SOS2 and SOS3 partially control SOS1 gene
expression level during salt stress (Shi et al., 2000). SOS2 and SOS3 are also required for
the activation of SOS1 Na+/H+ exchanger (Shi et al., 2000). Quintero et al (2002)
reconstituted the SOS system in yeast cells and found that the SOS2/SOS3 kinase
complex promoted the phosphorylation of SOS1 and activated the expression of SOS1 in
yeast. The coexpression of SOS1, 2 and 3 enhanced the salt tolerance of a yeast mutant
without Na+ transporters. SOS2 protein activity partially phosphorylated SOS1
independently of SOS3, but single SOS2 protein was not as efficient as the SOS2/SOS3
kinase complex for activation of SOS1 in vivo (Quintero, 2002). In addition, the
6
increased salt tolerance in plants may be induced by the co-over expression of SOS1, 2
and 3 (Guo et al., 2004). These results suggested that SOSs function in the same signaling
pathway. SOS1 and SOS2 expression can be detected under the normal conditions in the
root. SOS1 and SOS2 expression in the root is up-regulated by salt stress (Liu et al., 2000;
Shi et al., 2000).
Phytohormones and external factors, sugars and salt stress, effects on seed
germination
The effects of sugars on seed germination and early seedling development are
complicated and may involve several phytohormone-response pathways. ABA has a
crucial role in seed dormancy and GA is required for seed germination (Debeaujon I et al.,
2000). ABA plays essential roles in many physiological processes, such as
embryogenesis, seed dormancy, leaf transpiration, and stress tolerance (Koornneef et al.,
1998; Leung and Giraudat 1998). Many lines of evidence indicate that there are multiple
ABA perception and signaling mechanisms. Seed germination-based genetic screens have
identified mutants affected in ABA biosynthesis or sensitivity. The latter include ABA-
insensitive mutants (abi) and ABA-hypersensitive mutants. ABI1 is a negative regulator
of ABA signaling, as indicated by the enhanced sensitivity of the recessive mutants to
ABA in seeds and in vegetative tissues (Gosti et al., 1999). ABI1 and ABI2 genes have
overlapping functions during seed development, seed dormancy, and leaf transpiration
(Leung and Giraudat 1998). ABI3, ABI4, and ABI5, all encode transcription factors
(Giraudat et al., 1992; Finkelstein and Lynch 2000). ABI3, ABI4, and ABI5 act in a
combinatorial network, rather than a regulatory hierarchy to control seed development
7
and ABA response (Soderman et al., 2000). ABI4 may down-regulate ABI3 gene or act in
a parallel pathway at later stage (Soderman et al., 2000). Mutations in ABI3, ABI4, and
ABI5 have their greatest impact on gene expression during seed maturation because they
are only expressed to a limited degree in vegetative tissues (Finkelstein et al., 1998;
Finkelstein and Lynch, 2000). In vegetative tissues, ABA and various abiotic stresses
activate the expression of a large number of genes, which may play important roles in
stress adaptation (Zhu et al., 1998). During germination, ABI5 is a sensor for osmotic
status and a part of a growth repression mechanism during germination when the seeds
imbibe under unfavorable conditions (Carles et al., 2002). ABI5 gene expression
increases during germination in the presence of ABA and/or salt (Lopez-Molina et al.,
2001).
Plant hormone, ABA, seems to play a role in sugar signal transduction pathways
that affect seed germination and other aspects of plant growth processes (Finkelstein and
Lynch, 2000; Gazzarrini and McCourt, 2001; Gibson et al., 2001; Pourtau et al., 2004).
The possible mechanism of glucose-induced delay of seed germination may be related to
the slower decline of endogenous ABA in the presence of exogenous sugar (Price et al.,
2003). Many of the Glc-insensitive and Suc-insensitive mutants turned out to involve
genes related to ABA biosynthesis or ABA signaling pathways (Arenas-Huertero et al.,
2000). However, the tests of exogenous glucose supply effect on the seed germination
rates of different ABA-metabolic and ABA-response mutants have suggested that glucose
delay of seed germination does not involve any of the expected ABA-response pathway
components such as ABI1, ABI2, ABI4 or ABI5 (Brocard-Gifford et al., 2003; Dekkers
8
et al., 2004). At least, abi8 and abi4 are resistant to both ABA inhibition of seed
germination and glucose inhibition of early seedling development (Brocard-Gifford et al.,
2004). This indicates that some of the genes in ABA signaling pathway are involved in
the glucose effect on plant growth/development but it appears that different ABA
signaling pathways may interact with sugar signaling in a stage and tissue dependent
manner.
ABA plays a crucial role in the response of plants to abiotic and biotic stresses.
Stress-responsive genes are regulated by both ABA-dependent and ABA-independent
signaling pathways (Zhu, 2002). ABA biosynthesis is up-regulated by the osmotic stress.
The genetic studies on the ABA-deficient mutants los5/aba3 and los6/aba1 of
Arabidopsis indicated that ABA plays a crucial role in osmotic stress-regulated gene
expression (Xiong et al., 2001; Xiong et al., 2002).
GA is another hormone that plays essential role in plant growth and seed
germination. Most of the genes encoding enzymes for GA biosynthesis and catabolism
have been identified (Olszewski et al., 2002). Genes encoding several GA-signaling
components have also been identified (Yang et al., 2004). Recent work in Arabidopsis
has identified several putative transcription factors belonging to GRAS family to be
involved in the GA signal transduction pathway. GRAS (GAI/RGA/SCR) family of plant
specific putative transcription factors, which includes 33 Arabidopsis sequences with
some of them corresponding to genes with known functions (Pysh et al., 1999; Bolle,
2004). These include five closely related sequences containing DELLA motif, GAI (GA
insensitive), RGA (repressor of ga1-3) and RGL1-3 (RGA-like) (Bolle, 2004). Four of
9
these genes encode negative regulators of GA response, the function of the fifth one,
RGL3, is unknown (Wen and Chang 2002; Tyler et al., 2004). Other GRAS proteins
regulate several different aspects of plant growth and development including root
development, lateral branch development, and phytochrome A signal transduction (Bolle
C, 2004). The GRAS-like sequences of unknown function have been referred to as SCLs
(SCR-LIKE sequences; Pysh et al., 1999). The predicted protein sequences of all the
family members share well-conserved C-termini (Pysh et al., 1999). Based on the
homology over the entire protein, including quite variable N-termini, the family can be
further subdivided into several subfamilies each consisting of two to five closely related
members (Bolle, 2004).
Unlike other members of the GRAS family, the five proteins in the RGA
subfamily have a well-conserved N-terminal domain called DELLA after an amino acid
motif contained therein (Peng et al., 1997; Silverstone. et al., 1998). This DELLA
domain has been implicated in GA signaling (Wen and Chang, 2002). In Arabidopsis,
there are five DELLA proteins, namely GAI, RGA and RGL1, RGL2 and RGL3.Two
members, RGA and GAI interact synergistically to repress a set of GA-induced growth
processes. Phenotypes affected by rga and gai null mutations include leaf expansion,
stem elongation, juvenile-to-adult phase change in leaf development, vegetative-to-
reproductive transition, and apical dominance. GAI and RGA, are partially redundant
negative regulators in GA signaling pathway (King et al., 2001). The presence of the
amino acid sequence in the DELLA motif has an essential role for GA inducible RGA
10
protein disappearance (Dill et al., 2001). GA can induce the degradation of four DELLA
proteins in Arabidopsis, namely GAI, RGL1, RGL2 and RGL3 (Hussain et al., 2007).
The DELLA subfamily of GRAS family not only contains RGA and GAI but also
RGL1, RGL2 and RGL3 (Dill and Sun 2001). In addition to overall homology between
DELLA proteins they all contain two highly conserved N-terminal regions, I and II,
which are critical for GA signaling (Peng et al., 1999; Richards et al., 201; Dill and Sun
2001). The high similarity of N-termina regions (I and II) among RGA, GAI, RGL1,
RGL2 and RGL3 suggest that RGLs (RGL1, RGL2 and RGL3) may also act as negative
regulators of GA signaling pathways. Based on the analysis of RGL1 overexpressors it
was proposed that RGL1 acts as a negative regulator of GA signaling for seed
germination (Wen and Chang, 2002). Other findings based on the rgl1 mutant analysis,
however, do not support this conclusion (Lee et al., 2002).
Analysis of loss-of-function mutations in GAI, RGA, RGL2 and RGL1 revealed
that rgl2 alleles conferred strong resistance to PAC inhibitory effect on germination,
whereas rgl1-1, gai-t6 and rga-t2 did not (Lee et al., 2002). Lee et al. also showed that
RGL2 transcription levels raise rapidly following seed imbibitions and then decline
rapidly as germination proceeds, implying that the expression of wild type RGL2 is
induced by imbibitions and it is dynamic. RGL2 loss-of-function mutations did not
suppress the dwarf phenotype of ga1-3 (GA-deficient mutant). These observations
indicate that RGL2 is a negative regulator of GA-responses that control seed germination
specifically rather than stem elongation. The transition of a seed from dormancy to
germination is controlled by both external environmental cues (including light quality,
11
moisture, and transient exposure to cold) and by the internal growth hormone regulators
positively by GA and negatively by ABA.
The Arabidopsis gene SPY (SPINDLY) encodes an O-linked N-acetylglucosamine
(O-GlcNAc) transferase. SPY is a repressor of GA responses that regulates various
developmental processes, including seed germination, shoot elongation, flower initiation
and flower development (Izhaki et al., 2001). Previous study showed that SPY, which
does not belong to GRAS family, plays an important role in regulating GA signaling
pathway (Jacobsen et al., 1996). SPY gene product affects both GA and cytokinin
responses indicating that SPY is important for crosstalk between phytohormone pathways
(Greenboim-Wainberg et al., 2005). SPY gene is expressed throughout the plant organs
(Swain et al., 2002). Mutations at the SPY locus partially restore the phenotypes of
mutant ga1, including failure to germinate, short stem growth, delayed flowering and
male sterility (Jacobsen et al., 1996). All the spy alleles tested partially suppress the
phenotypes of ga1-1. In addition, spy alleles suppress the nongerminating phenotype
conferred by ga1-2 (an allele of ga1) as tested by that spy/ga1-2 double-mutant seeds that
germinate in the absence of exogenous GA (Jacobsen and Olszewski, 1993). It indicates
that SPY is an important regulator of the GA-mediated control of both stem elongation
and seed germination. The function of SPY as a negative regulator has been suggested to
be related to activation or stabilization of DELLA genes, or by leading them to localize to
the site where they exert their regulatory action (Shimada et al., 2006).
The SPY gene has been cloned from Arabidopsis (Jacobsen et al., 1996) and
barley (HvSPY, Robertson et al., 1998) and found to have significant similarity to animal
12
tetratricopeptide repeat (TPR)-containing serine and threonine-O-linked N-
acetylglucoseamine (O-GlcNAc) transferase (OGT). An actively repressive complex was
created by the interaction between TPRs of SPY and other proteins (Tseng et al., 2001).
The hypothesis was set up that SPY plays a role in plant development not only through its
role in GA signaling but also through other ways. Except its role in GA response,
Alteration of the cellular distribution of bioactive GAs caused by various environmental
factors such as light and temperature control seed germination (Yamauchi et al., 2004).
Both hormone and sugar levels modulate ?-amylase production in barley embryos
(Perata et al., 1997), suggesting potential interaction between sugar and GA on plant
developmental processes. Whether GA biosynthesis or signaling pathway plays a role in
sugar induced signal transduction is unknown. Further study is needed to clarify the
relationship between GA and sugar signaling pathways since both of them play pivotal
roles in plant growth and seed germination. Also, there is not much known about
potential relationship between GA and salt signaling pathways.
SCR and SHR in Arabidopsis
Several key components essential for hormone regulated growth processes
(Richards et al., 2001) and for radial patterning of plant organs (Helariutta et al., 2000;
Wysocka-Diller et al., 2000) have been identified through mutational analysis. Some of
these key developmental genes have been shown to function in the development of
different organs throughout both embryonic and postembryonic development. Two such
genes, SCARECROW (SCR) and SHORTROOT (SHR), are involved in both the root and
shoot development patterning by controlling some key cell divisions (Fukaki et al., 1998;
13
Wysocka-Diller et al., 2000). In the stems they are also essential for correct specification
of endodermis, the site of gravity perception in Arabidopsis shoots (Fukaki et al., 1998).
SCR has been cloned and sequence suggested a role as a transcriptional regulator
(Di Laurenzio et al., 1996; Pysh et al., 1999). The SCR gene product is one of the
founding members of the GRAS (GAI/RGA/SCR) family of plant specific putative
transcription factors (Pysh et al., 1999; Bolle, 2004). SCR was the first GRAS gene
(functionally) identified and used as the defining sequence for the family (Di Laurenzio
et al., 1996; Pysh et al., 1999). Mutations in either SCR or SHR (alsp a member of GRAS
family) lead to cell layer deletions resulting from an absence of some key cell divisions.
The scr roots have only a single cell layer in place of the two present in the WT (Scheres
et al., 1995; Di Laurenzio et al., 1996). This single remaining cell layer in scr mutant
roots expresses differentiated characteristics of both the cortex and the endodermis (Di
Laurenzio et al., 1996, Wysocka-Diller et al., 2000). The endodermis may not function
normally in scr mutant. In shr roots the single ground tissue layer differentiates into
cortex resulting in the complete deletion of root endodermis (Benfey et al., 1993;
Helariutta et al., 2000). One of SCARECROW-LIKE (SCL) genes in GRAS family, SCL3,
showed a tissue-specific expression pattern in the root similar to SCR (Pysh et al., 1999).
It suggested that SCL3 may play a role in endodermal specification by regulating SCR
expression or by being regulated by SCR. In addition to the morphological phenotypes
both scr and shr are shoot agravitropic (Fukaki et al., 1998) and have reduced salt
tolerance (J. W-D unpublished data). SHR and SCR play similar essential roles in a
number of developmental processes. However, their functions, unlike the GAI/RGA
14
situation, don't seem to be redundant. The cloning of SHR revealed that these two genes,
SCR and SHR, not only function in the same processes but also are molecularly related.
Thus, both SCR and SHR are the members of the GRAS family. However, neither of
these two genes falls into any of the subfamilies. Nor are they more closely related to
each other than to any other sequence in the family. This may partially explain the lack of
functional redundancy.
15
References:
Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J. and Leon, P. 2000. Analysis of
Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant
hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev 14,
2085-96.
Benfey PN, Linstead P.1993. Root development in Arabidopsis: four mutants with
dramatically altered root morphogenesis. Development 119(1), 57-70.
Bolle C. 2004. The role of GRAS proteins in plant signal transduction and development.
Planta 218(5),683-92.
Brocard-Gifford, I. M., Lynch, T. J. and Finkelstein, R. R. 2003. Regulatory
Networks in Seeds Integrating Developmental, Abscisic Acid, Sugar, and Light Signaling.
Plant Physiol. 131, 78-92.
Carles C, Bies-Etheve N, Aspart L, Leon-Kloosterziel KM, Koornneef M,
Echeverria M, Delseny M. 2002 Regulation of Arabidopsis thaliana Em genes: role of
ABI5. Plant J 30(3), 373-83.
Cortes, S., Gromova, M., Evrard, A., Roby, C., Heyraud, A., Rolin, D. B., Raymond,
P. and Brouquisse, R. M. 2003. In Plants, 3-O-Methylglucose Is Phosphorylated by
Hexokinase But Not Perceived as a Sugar. Plant Physiol. 131, 824-837.
16
Debeaujon I, Koornneef M. 2000. Gibberellin requirement for Arabidopsis seed
germination is determined both by testa characteristics and embryonic abscisic acid.
Plant Physiol 122(2), 415-24.
Dekkers, B. J., Schuurmans, J. A. and Smeekens, S. C. 2004. Glucose delays seed
germination in Arabidopsis thaliana. Planta 218, 579-88.
Di Laurenzio L., Wysocka-Diller J.W., Malamy J.E., Pysh L., Helariutta Y.,
Freshour G., Hahn M.G., Feldmann K.A., and Benfey P.N. 1996. The SCARECROW
gene regulates an asymmetric cell division that is essential for generating the radial
organization of the Arabidopsis root. Cell 86, 423-433
Dill A, Jung HS, Sun TP. 2001. The DELLA motif is essential for gibberellin-induced
degradation of RGA. PNAS 98(24),14162-7.
Dill A. and Sun T. 2001. Synergistic Derepression of Gibberellin Signaling bu removing
RGA and GAI Function in Arabidopsis thaliana. Genetics 159,777-785
Druege U, Zerche S, Kadner R 2004. Nitrogen- and storage-affected carbohydrate
partitioning in high-light-adapted Pelargonium cuttings in relation to survival and
adventitious root formation under low light. Ann Bot (Lond) 94(6),831-42.
Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM. 1998. The
Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein.
Plant Cell 10(6),1043-54.
Finkelstein, R. R. and Lynch, T. J. 2000. Abscisic acid inhibition of radicle emergence
but not seedling growth is suppressed by sugars. Plant Physiol 122, 1179-86.
17
Fukaki H., Wysocka-Diller J., Kato T., Fujisawa H., Benfey P.N., and Tasaka M.
1998. Genetic evidence that the endodermis is essential for shoot gravitropism in
Arabidopsis thaliana. Plant J. 14, 425-430
Garcia MJ, Rios G, Ali R, Belles JM, Serrano R. 1997. Comparative physiology of
salt tolerance in Candida tropicalis and Saccharomyces cerevisiae. Microbiology 143 ( Pt
4),1125-31.
Gazzarrini, S. and McCourt, P. 2001. Genetic interactions between ABA, ethylene and
sugar signaling pathways. Curr Opin Plant Biol 4, 387-91.
Gibson, S. I., Laby, R. J. and Kim, D. 2001. The sugar-insensitive1 (sis1) mutant of
Arabidopsis is allelic to ctr1. Biochem Biophys Res Commun 280, 196-203.
Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM. 1992. Isolation
of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4(10),1251-61.
Gosti F, Beaudoin N, Serizet C, Webb AA, Vartanian N, Giraudat J. 1999. ABI1
protein phosphatase 2C is a negative regulator of abscisic acid signaling. Plant Cell
11(10),1897-910.
Greenboim-Wainberg, Y., Maymon, I., Borochov, R., Alvarez, J., Olszewski, N., Ori,
N., Eshed, Y. and Weiss, D. 2005. Cross Talk between Gibberellin and Cytokinin: The
Arabidopsis GA Response Inhibitor SPINDLY Plays a Positive Role in Cytokinin
Signaling. Plant Cell 17, 92-102.
Guo Y, Qiu QS, Quintero FJ, Pardo JM, Ohta M, Zhang C, Schumaker KS, Zhu JK
2004. Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical
18
requirement for its kinase activity and C-terminal regulatory domain for salt tolerance in
Arabidopsis thaliana. Plant Cell 16(2), 435-49.
Hardie DG 1999. Roles of the AMP-activated/SNF1 protein kinase family in the
response to cellular stress.Biochem Soc Symp 64,13-27.
Halfter U, Ishitani M, Zhu JK. 2000. The Arabidopsis SOS2 protein kinase physically
interacts with and is activated by the calcium-binding protein SOS3. PNAS 97(7), 3735-
40.
Helariutta Y., Fukaki H., Wysocka-Diller J., Nakajima K., Jung J., Sena G., Hauser
M-T., and Benfey P.N. 2000. The SHORT-ROOT Gene Controls Radial Patterning of
the Arabidopsis Root through Radial Signaling. Cell 101, 555-567.
Hussain A, Cao D, Peng J. 2007. Identification of conserved tyrosine residues important
for gibberellin sensitivity of Arabidopsis RGL2 protein. Planta 226(2),475-83.
Izhaki, A., Swain, S. M., Tseng, T. S., Borochov, A., Olszewski, N. E. and Weiss, D.
2001. The role of SPY and its TPR domain in the regulation of gibberellin action
throughout the life cycle of Petunia hybrida plants. Plant J 28, 181-90.
Jacobsen SE, Olszewski NE. 1993. Mutations at the SPINDLY locus of Arabidopsis
alter gibberellin signal transduction. Plant Cell 5(8),887-96.
Jacobsen SE, Binkowski KA, Olszewski NE. 1996. SPINDLY, a tetratricopeptide
repeat protein involved in gibberellin signal transduction in Arabidopsis. PNAS 93(17),
9292-6.
19
Jian-Kang Zhu, Jiping Liu, and Liming Xiong 1998. Genetic Analysis of Salt
Tolerance in Arabidopsis: Evidence for a Critical Role of Potassium Nutrition. Plant Cell
10, 1181-1192.
Khan KA, Yeung M, Shuaib A. 1997. Comparative study of 18 gauge and 20 gauge
intravenous catheters during transcranial Doppler ultrasonography with saline solution
contrast. J Ultrasound Med 16(5),341-4.
King KE, Moritz T, Harberd NP. 2001. Gibberellins are not required for normal stem
growth in Arabidopsis thaliana in the absence of GAI and RGA. Genetic 159(2), 767-76.
Koornneef M, Alonso-Blanco C, Blankestijn-de Vries H, Hanhart CJ, Peeters AJ.
1998. Genetic interactions among late-flowering mutants of Arabidopsis. Genetics 148(2),
885-92.
Krapp, A., Hofmann, B., Schafer, C. and Stitt, M. 1993. Regulation of the expression
of rbc S and other photosynthetic genes by carbohydrates: a mechanism for the 'sink
regulation' of photosynthesis? Plant J 3, 817-828.
Lee, S., Cheng, H., King, K. E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N. P.
and Peng, J. 2002. Gibberellin regulates Arabidopsis seed germination via RGL2, a
GAI/RGA-like gene whose expression is up-regulated following imbibitions. Genes Dev
16, 646-658.
Leung J, Giraudat J. 1998.Cloning genes of Arabidopsis thaliana by chromosome
walking. Methods Mol Biol 82,277-303.
Liu J, Zhu JK. 1997. An arabidopsis mutant that requires increased calcium for
potassium nutrition and salt tolerance. PNAS 94(26), 14960-4.
20
Liu, J. and Zhu, J.-K. 1998. A Calcium Sensor Homolog Required for Plant Salt
Tolerance. Science 280, 1943-1945.
Liu, J., Ishitani, M., Halfter, U., Kim, C.-S. and Zhu, J.-K. 2000. The Arabidopsis
thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. PNAS 97,
3730-3734.
Lopez-Molina L, Mongrand S, Chua NH. 2001. A postgermination developmental
arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor
in Arabidopsis. PNAS 98(8), 4782-7.
Niu, X., Bressan, R. A., Hasegawa, P. M. and Pardo, J. M. 1995. Ion Homeostasis in
NaCl Stress Environments. Plant Physiol 109, 735-742.
Olszewski, N., Sun, T. P. and Gubler, F. 2002. Gibberellin signaling: biosynthesis,
catabolism, and response pathways. Plant Cell 14 Suppl, S61-80.
Pego, J. V., Weisbeek, P. J. and Smeekens, S. C. 1999. Mannose inhibits Arabidopsis
germination via a hexokinase-mediated step. Plant Physiol 119, 1017-23.
Peng J, Harberd NP. 1997. Gibberellin deficiency and response mutations suppress the
stem elongation phenotype of phytochrome-deficient mutants of Arabidopsis. Plant
Physiol 113(4),1051-8.
Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, Beales J,
Fish LJ, Worland AJ, Pelica F, Sudhakar D, Christou P, Snape JW, Gale MD,
Harberd NP. 1999. 'Green revolution' genes encode mutant gibberellin response
modulators. Nature 400(6741),256-61.
21
Perata, P., Matsukura, C., Vernieri, P. and Yamaguchi, J. 1997. Sugar Repression of
a Gibberellin-Dependent Signaling Pathway in Barley Embryos. Plant Cell 9, 2197-2208.
Pourtau, N., Mares, M., Purdy, S., Quentin, N., Ruel, A. and Wingler, A. 2004.
Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence.
Planta 219, 765-72.
Price, J., Laxmi, A., St Martin, S. K. and Jang, J. C. 2004. Global transcription
profiling reveals multiple sugar signal transduction mechanisms in Arabidopsis. Plant
Cell 16, 2128-50.
Price, J., Li, T. C., Kang, S. G., Na, J. K. and Jang, J. C. 2003. Mechanisms of
glucose signaling during germination of Arabidopsis. Plant Physiol 132, 1424-38.
Pysh LD, Wysocka-Diller JW, Camilleri C, Bouchez D, Benfey PN. 1999. The GRAS
gene family in Arabidopsis: sequence characterization and basic expression analysis of
the SCARECROW-LIKE genes. Plant J 18(1),111-9.
Quintero FJ, Ohta M, Shi H, Zhu JK, Pardo JM. 2002. Reconstitution in yeast of the
Arabidopsis SOS signaling pathway for Na+ homeostasis. PNAS 99(13), 9061-6.
Richards DE, King KE, Ait-Ali T, Harberd NP. 2001. HOW GIBBERELLIN
REGULATES PLANT GROWTH AND DEVELOPMENT: A Molecular Genetic
Analysis of Gibberellin Signaling. Annu Rev Plant Physiol Plant Mol Biol 52, 67-88.
Robertson M, Swain SM, Chandler PM, Olszewski NE. 1998. Identification of a
negative regulator of gibberellin action, HvSPY, in barley. Plant Cell 10(6),995-1007.
Shi H, Ishitani M, Kim C, Zhu JK. 2000 The Arabidopsis thaliana salt tolerance gene
SOS1 encodes a putative Na+/H+ antiporter. PNAS 97(12), 6896-901
22
Shimada A, Ueguchi-Tanaka M, Sakamoto T, Fujioka S, Takatsuto S, Yoshida S,
Sazuka T, Ashikari M, Matsuoka M. 2006 The rice SPINDLY gene functions as a
negative regulator of gibberellin signaling by controlling the suppressive function of the
DELLA protein, SLR1, and modulating brassinosteroid synthesis. Plant J 48(3), 390-402.
Silverstone AL, Ciampaglio CN, Sun T. 1998. The Arabidopsis RGA gene encodes a
transcriptional regulator repressing the gibberellin signal transduction pathway. Plant
Cell 10(2), 155-69.
Sivakumar P, Sharmila P, Saradhi PP. 1998. Proline suppresses Rubisco activity in
higher plants. Biochem Biophys Res Commun 252(2), 428-32.
Soderman EM, Brocard IM, Lynch TJ, Finkelstein RR. 2000. Regulation and
function of the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response
signaling networks. Plant Physio. 124(4),1752-65.
Swain SM, Tseng TS, Thornton TM, Gopalraj M, Olszewski NE. 2002. SPINDLY is
a nuclear-localized repressor of gibberellin signal transduction expressed throughout the
plant. Plant Physiol 129(2), 605-15.
Tseng TS, Swain SM, Olszewski NE. 2001. Ectopic expression of the tetratricopeptide
repeat domain of SPINDLY causes defects in gibberellin response. Plant Physiol
126(3),1250-8.
Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP. 2004 Della
proteins and gibberellin-regulated seed germination and floral development in
Arabidopsis. Plant Physiol 135(2),1008-19.
23
Ullah, H., Chen, J. G., Wang, S. and Jones, A. M. 2002. Role of a heterotrimeric G
protein in regulation of Arabidopsis seed germination. Plant Physiol 129, 897-907.
Van den Berg C, Willemsen V, Hage W, Weisbeek P, Scheres B. 1995. Cell fate in the
Arabidopsis root meristem determined by directional signaling. Nature 378(6552),16.
Veramendi, J., Roessner, U., Renz, A., Willmitzer, L. and Trethewey, R. N. 1999.
Antisense Repression of Hexokinase 1 Leads to an Overaccumulation of Starch in Leaves
of Transgenic Potato Plants But Not to Significant Changes in Tuber Carbohydrate
Metabolism. Plant Physiol 121, 123-134.
Wang, R., Okamoto, M., Xing, X. and Crawford, N. M. 2003. Microarray Analysis of
the Nitrate Response in Arabidopsis Roots and Shoots Reveals over 1,000 Rapidly
Responding Genes and New Linkages to Glucose, Trehalose-6-Phosphate, Iron, and
Sulfate Metabolism. Plant Physiol. 132, 556-567.
Wen CK, Chang C. 2002. Arabidopsis RGL1 encodes a negative regulator of
gibberellin responses. Plant Cell 14(1), 87-100.
Wu SJ, Ding L, Zhu JK. 1996. SOS1, a Genetic Locus Essential for Salt Tolerance and
Potassium Acquisition. Plant Cell 8(4), 617-627
Wysocka-Diller J.W., Helariutta Y., Fukaki H., Malamy J.E., and Benfey P.N. 2000.
Molecular analysis of SCARECROW function reveals a radial patterning mechanism
common to root and shoot. Development 127, 595-603
Xiong L, Ishitani M, Lee H, Zhu JK. 2001. The Arabidopsis LOS5/ABA3 locus
encodes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-
responsive gene expression. Plant Cell 13(9), 2063-83.
24
Xiong L, Zhu JK. 2002. Molecular and genetic aspects of plant responses to osmotic
stress. Plant Cell Environ. 25(2),131-139.
Xu, X., van Lammeren, A. A., Vermeer, E. and Vreugdenhil, D. 1998. The role of
gibberellin, abscisic acid, and sucrose in the regulation of potato tuber formation in vitro.
Plant Physiol 117, 575-84.
Yamauchi, Y., Ogawa, M., Kuwahara, A., Hanada, A., Kamiya, Y. and Yamaguchi,
S. 2004. Activation of gibberellin biosynthesis and response pathways by low
temperature during imbibition of Arabidopsis thaliana seeds. Plant Cell 16, 367-78.
Yang, G. X., Jan, A., Shen, S. H., Yazaki, J., Ishikawa, M., Shimatani, Z., Kishimoto,
N., Kikuchi, S., Matsumoto, H. and Komatsu, S. 2004. Microarray analysis of
brassinosteroids- and gibberellin-regulated gene expression in rice seedlings. Mol Genet
Genomics 271, 468-78.
Yeo, A. 1998. Review article. Molecular biology of salt tolerance in the context of
whole-plant physiology. J. Exp. Bot. 49, 915-929.
Zhu JK, Liu J, Xiong L. 1998. Genetic analysis of salt tolerance in arabidopsis.
Evidence for a critical role of potassium nutrition.Plant Cell 10(7), 1181-91.
Zhu JK. 2002. Salt and drought stress signal transduction in plants.
Annu Rev Plant Biol 53,247-73.
25
II. RESEARCH OBJECTIVES
My dissertation was focused on the following objectives:
1. Sugar effect on seed germination and early seedling development
a. Identify phytohormone signaling pathway components involved in sugar-
mediated delay of germination.
b. Whether any of these genes acting in the same pathway or not.
c. Sugar effect on the early seedling development and phytohormone
signaling pathway components involved in this process.
2. Salt and osmotic stress effect on seed germination and early seedling development
a. Identify phytohormone signaling pathway components involved in salt and
osmotic stress effect on seed germination and early seedling development.
b. The interaction and crosstalk among these genes and pathway involved in
this process.
3. Identify the function of GRAS family genes under the stress condition
a. Investigate the phenotypes of several gene mutants in GRAS family, scl3,
scr and shr under salt stress.
b. The interaction and crosstalk between several signaling pathways involved
in plant response to salt stress.
c. Identify the genes in phytohormone pathways to response to salt stress
during the later seedling development.
26
III. PHYTOHORMONE SIGNALING PATHWAYS INTERACT WITH SUGARS
DURING SEED GERMINATION AND SEEDLING DEVELOPMENT
Abstract
Exogenous glucose delays seed germination in Arabidopsis thaliana not only in
wild type (WT) but also in a number of mutants in hormone signaling pathways. Our
study demonstrates that the ABA Insensitive 3 (ABI3) gene in the ABA signaling pathway
and the RGA-like 2 (RGL2) and SPINDLY (SPY) genes in the GA signaling pathways all
play important roles in the glucose-induced delay of seed germination. Transcription of
the ABI3 and RGL2 genes is up regulated by glucose. This study also supports the idea
that different sugars such as the hexose stereoisomers, glucose and mannose, delay or
inhibit seed germination via different branches of hormone signaling pathways. Analysis
of post-germination seedling development of wild type plants indicates that exogenous
glucose supplied after germination may have a concentration dependent stimulatory
effect on root and shoot growth. Comparison of WT and spy seedling growth on different
glucose concentrations suggests that the stimulatory effect of glucose is partially exerted
via the GA or cytokinin signaling pathways. The effects of glucose on plant growth and
development may be stimulatory or inhibitory depending on the developmental stage.
The inhibitory effect on seed germination seems to be accomplished via activation of
ABA signaling pathway, through ABI3, and inactivation of the GA signaling pathway
27
through RGL2 and SPY. On the other hand, the stimulatory effect of glucose on seedling
growth may involve GA and/or cytokinin signaling pathways.
Key words: Abscisic acid, Arabidopsis, Germination, Gibberellic acid, Glucose
signaling
28
Introduction
Seed germination is a critical step in the plant life cycle, and is regulated by many
biotic and abiotic factors. In Arabidopsis thaliana seeds, the transition from dormancy to
germination is controlled by external environmental factors such as light quality,
moisture, and transient exposure to cold as well as several internal growth regulators
(reviewed by Koornneef et al., 2002). Among the photohormones that play a role in
Arabidopsis seed germination, gibberellin (GA) and abscisic acid (ABA) have the most
pronounced effects (Koornneef et al., 2002). ABA establishes and maintains dormancy of
seeds, whereas GA has the opposite effect, breaking dormancy and inducing seed
germination (Steber et al., 1998). It appears that there are multiple ABA detection and
signaling mechanisms (Himmelbach et al., 2003). Seed germination-based genetic
screens have identified mutants affected in ABA biosynthesis or sensitivity. The latter
include ABA-insensitive mutants and ABA-hypersensitive mutants (reviewed by
Finkelstein et al., 2002). Many genes encoding enzymes involved in GA biosynthesis and
catabolism have also been identified (Olszewski et al., 2002). Several genes encoding
GA-signaling components involved in seed germination are also known (Swain et al.,
2002; Tyler et al., 2004). RGL2 negatively regulates GA responses that primarily control
seed germination (Lee et al., 2002). The Arabidopsis gene SPY is also a negative
regulator of GA signaling. However, unlike RGL2 it also regulates all other
developmental processes involving GA (Izhaki et al., 2001). In addition, SPY is an
activator of cytokinin signaling pathway (Greenboim-Wainberg et al., 2005).
29
Sugars also act as regulatory molecules and play a pivotal role in the plant life
cycle. Exogenous glucose application has been shown to delay seed germination and
inhibit seedling development (reviewed by Gibson, 2005). Different levels of sugar
supply have different effects on various stages of plant development, which may be
related to endogenous ABA levels (Gibson, 2005). A delay in Arabidopsis seed
germination was observed at glucose concentration as low as 0.5% with the delay
increasing with increasing glucose concentrations (Price et al., 2003; Dekkers et al.,
2004). While intermediate glucose concentrations (1.5-3%) dramatically delay WT seed
germination, similar concentrations of sorbitol or mannitol have very little effect,
indicating that the effect of glucose is not simply osmotic (Price et al., 2003; Dekkers et
al., 2004). Because ABA and GA are key internal regulators of Arabidopsis seed
germination, it seems likely that glucose and other sugars exert their inhibitory effects via
the biosynthesis, degradation or signaling pathways for these hormones. Based on
experiments with exogenous application of hormones, hormone precursors and hormone
synthesis inhibitors, Dekkers et al. (2004) concluded that glucose is not acting via
biosynthesis of ABA, GA or ethylene. Price et al. (2003) suggested that glucose at
intermediate and high concentrations may delay germination by slowing the decline of
endogenous ABA concentration. Although these results suggest that glucose at higher
concentrations may at least partially act via ABA, the components of the ABA response
pathway involved in seed germination delay have not been identified (Price et al., 2003).
It has been suggested that the glucose-induced delay of seed germination involves neither
increasing ABA biosynthesis nor activation of ABA signal transduction via ABI1, ABI2,
30
ABI4 or ABI5 gene products (Dekkers et al., 2004). Dekkers et al. (2004) also reported
that spy-5 is sensitive to glucose for the timing of germination and suggested that glucose
does not act via GA signaling.
High concentrations of glucose increased the accumulation of ABA in seedlings
(Arenas-Huertero et al., 2000) and many of the sugar insensitive mutants for post-
germination seedling developmental abnormalities have been found to be allelic to genes
involved in ABA biosynthesis or ABA signaling pathways (Gibson, 2005). For example,
the Arabidopsis sucrose uncoupled-6 gene was found to be identical to one of the ABA-
insensitive genes, ABI4 (Huijser et al., 2000). In addition, mannose induced inhibition of
germination has been demonstrated to also involve ABI4 gene which has no function in
glucose pathway in seeds (Pego et al., 1999; Dekkers et al., 2004).
In this study we address the possible mechanism of glucose-induced delay of seed
germination via the stimulation of ABA signal transduction and/or inhibition of the GA
signaling pathway. We analyzed seed germination and seedling development of several
mutants of ABA and GA signaling pathways during glucose treatment. Our results
indicate that ABA signal transduction is involved in glucose-induced delay of seed
germination via ABI3 gene. The GA signaling pathway is also involved in glucose
effects on seed germination via RGL2 and SPY genes. Our data also suggest that there
may be crosstalk between the ABA, GA, and glucose-signaling pathways that involves
ABI3 and RGL2 during seed germination.
31
Results
Components of both ABA and GA signaling pathways are involved in seed germination
delay caused by exogenous glucose
We investigated the seed germination kinetics of several mutants involved in the
ABA and GA signaling on plates containing intermediate concentrations of glucose.
High glucose concentrations were not used here because under those conditions the delay
of germination is partially caused by osmotic effects (Price et al., 2003). We tested
mutants in ABA and GA signaling pathways, abi3-1 and rgl2-1 that are known to be
involved in germination but have not been included in previous studies. We also retested
and used as a control spy5 that was previously found to be glucose sensitive, or even
hypersensitive for the germination delay (Dekkers et al., 2004).
Germination of Ler (wild type control), abi3, rgl2 and spy seeds in the sugar-free
control plates approached 90-100% after 42 hours. Moderate concentrations (1.5% and
2.5%) of glucose delayed seed germination at 42 hours of all the lines tested as shown in
Figure 1. However, the mutants were affected less severely than the wild type (WT). The
mutant seeds of rgl2, spy and abi3, all have a significantly higher germination rate than
WT for both glucose concentrations used (Fig. 1). The dramatic increase of germination
frequency of abi3 begins at 36 hours and approaches 100% at 72 hours on 1.5% glucose
plates. The germination frequency of WT on 1.5% glucose begins to increase at 48 hours
and only approaches 40% at 72 hours. The germination frequency of abi3 begins to
increase dramatically at 42 hours and approaches 100% at 96 hours on 2.5% glucose. The
32
germination of WT increases very slowly on 2.5% glucose and reaches only 31% at 120
hours.
The germination kinetics of rgl2 mutant seeds is similar to abi3 seeds (Fig. 1).
Dekkers et al. (2004) also reported that the spy mutant was as sensitive as or even more
sensitive than WT to glucose. However, our results indicate that spy is partially resistant
to glucose during germination. The germination of spy seeds was above 90% at 120 hours
on 1.5% glucose plates and about 80% at 120 hours with 2.5% glucose treatment (Fig.1B
and C). Our data suggest that both the ABA signaling pathway via ABI3 and GA
signaling pathway via RGL2 and SPY are involved in glucose delay of seed germination.
Mannose affects germination via ABI3 but not via RGL2 or SPY
Arabidopsis seed germination is inhibited by mannose in a concentration-
dependent manner starting at concentrations much lower than other sugars (Pego et al.,
1999). We tested whether mutants in GA and ABA signaling pathways, abi3-1, rgl2-1
and spy that were shown here to be resistant to glucose are also resistant to mannose
inhibition of seed germination. The effect of mannose on spy and rgl2 germination has
not been reported and the reported results for abi3-1 have been conflicting. Laby et al.
(2000) found that abi3-1 is as sensitive as WT to 1.7 mM mannose while Huijser et al.
(2000) reported that abi3-1 shows partial resistance to 5 mM mannose. We tested WT
and mutant seeds on three concentrations of mannose. Germination of mutant seeds was
assayed at the 8th and 10th days after transfer to the growth chamber. A comparison of
germination on mannose-free plates and three concentrations (5 mM, 7.5 mM and 10 mM)
33
of mannose is shown in Fig. 2. The germination frequency of abi3 seeds on 5 mM
mannose plates approached 40% while those of WT, rgl2 and spy were all below 10% on
day 10 (Fig. 2). The germination frequency of abi3 seeds on higher concentrations of
mannose, 7.5mM and 10mM, was only about 10% but no seeds of WT, rgl2 and spy
germinated under these conditions (Fig. 2). These results indicate that mannose
repression of Arabidopsis seed germination does not involve GA signaling pathways
through RGL2 or SPY gene products but that ABA signaling pathway is involved in this
process via ABI3 in addition to the previously reported effect of ABI4 (Pego et al., 1999).
Effects of ABA and GA on rgl2, abi3 and spy seed germination
To determine if there might be an interaction between the ABA and GA signaling
pathways during glucose-induced delay of germination we tested glucose insensitive
alleles used in our study for resistance to PAC, an inhibitor of GA biosynthesis, and to
ABA during seed germination. Spy-3 has been shown to be partially ABA insensitive and
abi3-1 is known to germinate in the presence of GA biosynthesis inhibitors (Nambara et
al., 1991; Steber et al., 1998). We found that spy-5 shows WT sensitivity to ABA. While
the germination of spy-5 and WT seeds is inhibited by ABA application (Fig. 3A and 3B)
the germination of rgl2-1 seeds is greater than that of WT with both 1?M and 3?M ABA
treatment (Fig. 3A and 3B). These data demonstrate that the rgl2-1 mutant is at least
partially resistant to ABA in a concentration dependent manner. As shown in Figure 3c
and 3d, abi3-1 seed germination reached a high percentage (>90%) on day 6 on both 10-5
M and 10-4 M PAC plates. The germination of abi3 seeds is similar to that of rgl2 and spy
34
but the germination of abi3 seeds is slightly delayed on the higher concentration of PAC
(Fig. 3C and D). All three mutants, abi3, rgl2 and spy were highly resistant to PAC
inhibition of seed germination. These results suggest that ABI3 may inhibit seed
germination via negative regulation of GA signaling pathway. ABI3 is a transcription
factor, and could therefore exert its influence on the GA signaling pathway via
transcriptional activation of negative regulators such as RGL2 or SPY.
Transcription of genes involved in glucose-induced delay of seed germination
We analyzed the RGL2 transcription levels in abi3 and WT seeds imbibed in H2O
at 4oC in dark for 7 days. The relative RGL2 mRNA levels in abi3 mutant seeds
decreased three fold relative to WT seeds (Table 1). This result suggests that ABI3
positively controls the RGL2 gene expression. Since the rgl2 mutant is slightly resistant
to ABA inhibition of seed germination and RGL2 belongs to the GRAS family of
putative transcriptional regulators (Pysh et al., 1999), we also compared the ABI3
transcription levels in rgl2 and WT seeds. ABI3 mRNA levels in rgl2 mutant seeds
decreased by seven fold compared to those in WT seeds (Table 1). This suggests that
RGL2 may be involved in activation of ABI3 expression. There was no significant
difference in SPY expression in either rgl2 or abi3 backgrounds (Table 1). Our data
suggest that both ABI3 and RGL2 may be involved in the crosstalk between the ABA
and GA signaling pathways and that it may be accomplished by reciprocal transcriptional
activation.
35
Because the ABI3 and ABI4 genes both encode transcription factors and seem to
be involved in the mannose-induced inhibition of seed germination we wanted to
determine whether these genes act in the same pathway by controlling each others
expression. We compared the ABI3 transcript levels in abi4 and WT (Col) as well as the
ABI4 transcript accumulation in abi3 and WT (Ler) seeds. The expression of these genes
is the same in WT and mutant backgrounds (data not shown) suggesting that ABI3 and
ABI4 do not control each other?s transcription.
To further investigate the effect of ABI3 and RGL2 on seed germination delay by
glucose, we compared ABI3 and RGL2 mRNA levels in WT seeds imbibed in 2.5%
glucose to seeds imbibed in H2O alone. ABI3 mRNA level in seeds imbibed in glucose is
more than 2500 times higher than that of H2O treated seeds (Table 1). This indicates that
glucose dramatically induces ABI3 gene expression on a transcriptional level. The RGL2
mRNA level in seeds treated with glucose is more than 42 times higher than that of H2O
treated seeds (Table 1). These data suggest that glucose delays seed germination via
transcriptional induction of both RGL2 and ABI3 genes.
Glucose has a stimulatory effect on seedling growth in a concentration dependent
manner.
High glucose concentrations, 6% and above, have been shown to have an
inhibitory effect on seedling growth and development (Gibson, 2005). This inhibitory
effect is restricted to a very narrow time window of about 48 hours from the start of seed
imbibition (Gibson et al., 2001). All the mutants used in this study show WT sensitivity
36
to this inhibitory effect of glucose (not shown). We investigated the effects of different
concentrations of glucose on later stages of seedling development. To avoid the effects of
glucose on the timing of germination and on early seedling development, all seeds were
first germinated on sugar-free plates and then similar-sized seedlings were transferred on
day four to plates containing different concentrations of glucose (1.5%, 2.5%, 5% and 7%
glucose). WT seedlings on all glucose concentrations proceeded to develop true leaves
(Fig. 4A). The effects of different concentrations of exogenous glucose application on
seedling growth are evident several days after transfer from glucose-free media (not
shown). Figure 4A shows representative WT shoots, on day 18, from glucose-free plate
and four different glucose concentrations. Seedling growth on sugar-free plates is stunted
(Fig. 4). Primary roots are very short, and true leaves are not visible on day 10 (not
shown). Seedlings from plates containing increasing concentrations of sorbitol alone are
indistinguishable from seedlings from sugar-free plates on day 18 (Fig. 4A-C). In
contrast, seedlings from plates containing glucose have much longer roots and larger
shoots (Fig. 4A-C). Seedlings from intermediate glucose concentrations, 1.5% and 2.5%,
have the longest roots and the largest leaves (Fig. 4A-C). Root length and shoot weight
increased with intermediate levels of glucose and decreased at high glucose
concentrations. Rosette development of WT on 7% glucose plates is better than that on
1.5% glucose plus 5.5% sorbitol plates (Fig. 4A). The above results indicate that glucose
has a stimulatory effect on WT seedling development and that the inhibitory effect of
very high levels of glucose is osmotic. Application of 1.5-5% glucose resulted in a
significant growth stimulation. WT roots were on average at least nine times longer (Fig.
37
4B) and rosettes attained at least five times larger mass (Fig. 4C). There were no
significant differences between root and shoot growth of the rgl2 mutant and WT at day
18 (Fig. 4D-F). In contrast, spy grows considerably better than WT without glucose and
similarly to WT seedlings with glucose (Fig. 4D-F). The roots of the spy mutant are much
longer, at least 5 times, than those of WT on glucose-free plates (Fig. 4E). The rosettes of
spy, on glucose-free plates, appear at least twice the size of WT on day 18 (Fig. 4D) and
attain three times higher mass (Fig. 4F). These results indicate that glucose has a
stimulatory effect on both root and shoot growth in WT seedlings and that spy is less
dependent on glucose supply for seedling growth.
Discussion
Glucose levels as low as 0.5% considerably delay Arabidopsis seed germination
(Price et al., 2003). This delay is not due to osmotic stress because concentrations below
6% of sorbitol have no effect on the timing of seed germination. Glucose at intermediate
and high concentrations may affect germination by slowing the decline of endogenous
ABA concentration (Price et al., 2003). However, the components of the ABA signaling
pathway such as ABI1, ABI2, ABI4 and ABI5 are not involved in this process (Price et
al., 2003; Dekkers et al., 2004).
There have been at least three different glucose-signaling pathways proposed, two
of which appear to be hexokinase-dependent (Moore et al., 2003). Because the glucose
analog, 3-O-methylglucose has very similar effect on the timing of germination as
glucose and because it is not a good substrate for hexokinase (HXK) it was suggested that
38
glucose delays seed germination via an HXK-independent pathway (Dekkers et al., 2004).
Because mannose, a stereoisomer of glucose, is a good substrate for HXK and it inhibits
Arabidopsis seed germination at very low concentrations, concentrations at which other
sugars have no effect, it was suggested that it acts via HXK-dependent pathway (Pego et
al., 1999). The idea that mannose and glucose inhibit germination via different pathways
is further supported by the findings that ABI4 is involved in mannose but not glucose
effects on germination (Pego et al., 1999; Dekkers et al., 2004). The data presented here
show that rgl2 and spy mutants in GA signaling pathway are resistant to glucose-induced
delay but not mannose inhibition of germination. These data are consistent with the idea
that mannose and glucose inhibit germination through different pathways, and further
demonstrate that mannose inhibition of seed germination is not via the GA signaling
pathway through RGL2 or SPY.
One of the ABA-insensitive genes may be involved in both glucose-induced delay
of germination and mannose inhibition of germination. The abi3-1 mutant is resistant to
glucose and partially resistant to mannose inhibition of seed germination, which suggests
that ABI3 may be a common factor in both mannose and glucose pathways to inhibit seed
germination. Therefore, mannose inhibits seed germination not only via ABI4 in ABA
signaling pathway but also via ABI3. It remains to be determined whether ABI3 and
ABI4 exert their effects through the same branch of ABA signaling pathway or possibly
act in parallel.
It is clear from our results that glucose delays germination by activating the ABA
signaling pathway via ABI3 and repressing the GA signaling pathway via SPY and
39
RGL2. We have shown that glucose application has a pronounced effect on ABI3 and
RGL2, up regulating both at the transcriptional level. Our data also show that the rgl2
mutant is partially resistant to ABA application and confirm that the abi3 mutant is
resistant to PAC indicating that RGL2 may be involved in the ABA signaling pathway
and that ABI3 is involved in GA signaling pathway. Our data on SPY, RGL2 and ABI3
transcription in rgl2 and abi3 mutant backgrounds indicate that RGL2 up regulates ABI3
transcription and that ABI3 up regulates RGL2 transcription. These data suggest that
there is crosstalk between the ABA and GA signaling pathways and that RGL2 and ABI3
gene products are involved in this process.
Our data also show that both ABI3 and RGL2 genes are induced by glucose,
although whether glucose induces both genes ?directly? remains to be determined.
Figure 5 shows our model of possible mechanism of glucose-induced delay of seed
germination. Glucose leads to a dramatic increase in ABI3 gene expression at the
transcriptional level, which in turn activates the ABA signaling pathway resulting in
inhibition of seed germination. The ABI3 gene product may also activate RGL2
transcription and thus lead to inactivation of GA signaling pathway at the same time.
Glucose also up regulates RGL2 expression either directly or via ABI3 thus leading to
inhibition of seed germination by turning off the GA signaling pathway. Our data also
suggest that RGL2 may activate the ABA signaling pathway by up regulating ABI3
transcription.
Glucose not only plays a role in germination but also in other aspects of the plant
life cycle, such as seedling development. Arabidopsis seedlings germinated on 5%
40
glucose plates fail to develop expanded cotyledons or true leaves (Laby et al., 2000). Our
data demonstrate that when young seedlings are transferred to glucose containing media,
following germination without glucose, that glucose has a stimulatory effect on both root
and shoot growth and development. Moderate glucose levels (e.g. 1.5% to 5%) strongly
stimulate root and true leaf development. Very high glucose levels also lead to better
growth than the complete absence of glucose. Poorer growth on very high concentration
as compared to moderate concentrations of glucose may simply be associated with
osmotic stress.
The interaction between sugar and plant hormone response pathways was
indicated by studies that characterized sugar-hypersensitive and resistant mutants for
seedling development. The mutants in the ABA signaling pathways such as abi1, abi2
and abi3 are sensitive to the inhibitory effect of high glucose levels on early seedling
development, but abi4 and abi5 are resistant ( Finkelstein, 1994; Arenas-Huertero et al.,
2000; Huijser et al., 2000; Laby et al., 2000). Our experiments comparing glucose,
sorbitol and glucose plus sorbitol suggest that the effects of some of these mutations on
later stages of seedling development are related to osmotic stress resistance and are not
specific to glucose.
Our data also show that seedling growth of spy-5 on glucose-free medium is much
better than that of WT. It is possible that part of the stimulatory effect of glucose on
seedling growth is via activation of the GA signaling pathway since GA is necessary for
root and leaf growth. In the spy mutant the GA signaling pathway is on in the absence of
the functional SPY gene product. Therefore in the spy mutant, glucose is not necessary
41
to activate the GA signaling pathway. The reason why spy grows better with than without
glucose may be that only a part of the stimulatory effect of glucose on seedling growth is
via relieving the inhibitory effect of SPY. Since SPY also functions in cytokinin signaling
therefore it cannot be ruled out that glucose exerts it stimulatory effect via this pathway
instead of or in addition to GA signaling pathway (Greenboim-Wainberg et al., 2005).
In conclusion, glucose can delay seed germination through a different pathway
from sugars such as mannose. The effect of glucose delay on seed germination is via
genes in both GA and ABA signaling pathways. Genes we tested, ABI3 and RGL2, may
act via the same pathway in glucose delay of seed germination. We have also
demonstrated that glucose, applied after germination, has a strong stimulatory effect on
seedling growth and development. This effect is partially mediated via activation of GA
and/or inactivation of cytokinin signaling pathways by relieving the inhibitory or the
stimulatory effect of a key regulator, SPY. Therefore, exogenous glucose in moderate
concentrations has opposite effects on plant growth and development depending on the
developmental stage during which it is applied. The inhibitory and stimulatory effects of
glucose are at least in part mediated via components of ABA and GA signaling pathways.
Materials and methods
Plant materials
Two ecotypes of Arabidopsis thaliana were used in this study: Columbia (Col)
and Landsberg erecta (Ler). Various Arabidopsis mutants with altered ABA and GA
signaling were obtained from Arabidopsis stock centers. spy5, abi2-1, abi3-1, abi4-1 and
42
abi5-1 came from the Arabidopsis Biological Resource Center at Ohio State University,
(http://www.arabidopsis.org/abrc/) and rgl2-1 (SGT625, Lee et al., 2002) came from the
Nottingham Arabidopsis Stock Center (http://arabidopsis.info/).
Germination, plant growth assays and RNA isolation
Before plating, seeds were sterilized in 6.25% Sodium hypochlorite for 3 min and
rinsed three times with sterile distilled water. Seeds were planted on 0.5X Murashige and
Skoog medium (0.5MS, Caisson Laboratories) solidified with 0.8% agar (Fisher
Scientific) and containing varying concentrations of glucose, mannose or hormones.
Filter sterilized hormone stock solutions were added after autoclaving to avoid the
inactivation of hormones. ?-D-Glucose and mannose were obtained from Acros Organics.
Paclobutrazol (PAC), gibberellin (GA), and abscisic acid (ABA) were obtained from
Sigma-Aldrich. Arabidopsis seeds were stratified for 3 d at 4?C in dark, then placed in a
growth chamber with 70% humidity and under 18h light and 6h dark at 23?C to facilitate
germination. Germination (based on radicle emergence from the seed coat) was scored
every 6-12 h or daily depending on the experiment. Each plate contained 90?110 seeds.
Every experiment was repeated two to three times. In each experiment different batches
of seeds were used. However, in each experiment WT and mutant seeds used were
collected at the same time from the same age plants grown under the same conditions.
Although time course of germination differed in each experiment the trends in
germination were the same for different batches of seeds. The data shown here is from
one of these experiments. Plant growth was estimated by root length, number of leaves
43
and shoots weight at day 18. Seed germination and plant growth data were analyzed
using Microsoft Excel 2000. For germination tests, seeds collected at the same or similar
times were used and stored at 4?C before using.
For mRNA expression analyses seeds were imbibed in distilled water for 7 days
at 4?C in the dark or imbibed in glucose or water for 72 hours in the dark at 4?C. Total
RNA was extracted from these treated seeds for use in QRT-PCR. RNA extraction was
performed as described previously (Vicient and Delseny, 1999).
Real time PCR
Total RNA (2 ?g) was treated with a DNA-free kit (Ambion INC.) and tested
with real time PCR for DNA contamination. The purified total RNA was used as a
template to synthesize first-strand cDNA using a TaqMan Reverse Transcriptase kit
(Roche) with oligo(dT) primers as per the manufacturer?s instructions. Quantitative real
time PCR using first-strand cDNA as a template was carried out using an ABI Prism
7000 Sequence Detector with TaqMan Universal PCR Master Mix (Roche). PCR
reactions were carried out in a final volume of 50 ?l using gene specific primers and
probes in concentrations determined individually for each set of primers. Probes were
modified with 6-FAM, reporter dye at 5?-end and TAMRA quencher at 3?-end. All oligo
synthesis and modifications were done by Sigma-Genosys. Gene specific primers and
probes used were as follows: APT1 forward 5?TGTTCCTTGCAACCGTCTTCT3?,
reverse 5?TGGTTGAACGGTGGTTTGAG 3?, probe 5?
CCACCACCGTGCTCCTCCTTCG3?; SPY forward 5?
44
GAGCTTGCTTTCCACTTTAATCCA 3?, reverse 5?
ATCAAGGTTGTCACGGTCTTTGTA 3?, probe 5?TGCTGAGGCTTGCAACA
ATTTGGGAGTAC3?; RGL2 forward 5?GGCTGCACAGTGGAGGATTC3?, reverse 5?
CGCGCTAGATCCGAGATGA3?, probe 5?TGAAATCCGCTGGGTTTGACCCG
3?; ABI3 forward 5?CCATGGAAGACATCGGAACCT3?, reverse 5?
GGAGATACATCCTGCTTTTGTTGTT3?, probe
5?TCGTGTTTGGAACATGCGCTACAGGT3?; ABI4 forward 5?
TTCCGGTAACTAATTCGACTTCGT3?, reverse 5?
TTACACCCACTTCCTCCTTGTTC3?, probe5?
TCATCATGAGGTGGCGTTAGGGCA3?.
Thermocycler conditions were 2 min at 50?C, 10 min at 95?C and 40 cycles of 15s at
95?C and 1 min at 60?C. The mRNA level for each gene was determined using the
standard curve method according to manufacturer?s instruction (ABI Prism 7000
Sequence Detection System User Guide). APT1 (Adenosine phosphoribosyl transferase)
transcript level in each sample was used as an internal control (Arroyo et al., 2003). The
mean value from triplicate samples was used to calculate the transcript level. Results
were analyzed using Microsoft Excel.
45
Acknowledgements
We thank Dr. V. Sundaresan for providing permission to use rgl2-1 line and
ABRC and NASC for the mutant seed stocks. We thank Drs. L. Goertzen, R. Locy, N.
Sigh, Fenny Dane, Omar A.Oyarzabal and Covadonga R. Arias for comments on the
manuscript. We are grateful to Dr. L. Silo-Suh for the use of equipment, M. Muraski and
R. Payyavula for technical assistance and Dr. C. Dale and the members of his lab for the
help with QPCR. This work was financially supported by AU biogrant.
46
References
Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J. and Leon, P. 2000. Analysis of
Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant
hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev 14,
2085-96.
Arroyo, A., Bossi, F., Finkelstein, R. R. and Leon, P. 2003. Three genes that affect
sugar sensing (Abscisic Acid Insensitive 4, Abscisic Acid Insensitive 5, and Constitutive
Triple Response 1) are differentially regulated by glucose in Arabidopsis. Plant Physiol.
133, 231-242.
Dekkers, B. J., Schuurmans, J. A. and Smeekens, S. C. 2004. Glucose delays seed
germination in Arabidopsis thaliana. Planta 218, 579-88.
Finkelstein, R. R.1994. Mutations at two new Arabidopsis ABA response loci are
similar to the abi3 mutations. Plant J 5, 765-771.
Finkelstein RR, Gampala SS, Rock CD. 2002. Abscisic acid signaling in seeds and
seedlings. Plant Cell [Suppl] 14,15-45.
Gibson SI, Laby RJ, Kim D. 2001. The sugar-insensitive1 (sis1) mutant of Arabidopsis
is allelic to ctr1. Biochem Biophys Res Commun. 280(1),196-203.
Gibson, S. 2005. Control of plant development and gene expression by sugar signaling.
Curr Opin Plant Biol 8, 93-102.
Greenboim-Wainberg Y, Maymon I, Borochov R, Alvarez J, Olszewski N, Ori N,
Eshed Y, Weiss D. 2005. Cross talk between gibberellin and cytokinin: the Arabidopsis
GA response inhibitor SPINDLY plays a positive role in cytokinin signaling. Plant Cell
47
17(1), 92-102.
Himmelbach, A., Yang, Y. and Grill, E. 2003. Relay and control of abscisic acid
signaling. Curr Opin Plant Biol 6, 470-9.
Huijser, C., Kortstee, A., Pego, J., Weisbeek, P., Wisman, E. and Smeekens, S. 2000.
The Arabidopsis SUCROSE UNCOUPLED-6 gene is identical to ABSCISIC ACID
INSENSITIVE-4: involvement of abscisic acid in sugar responses. Plant J 23, 577-85.
Izhaki, A., Swain, S. M., Tseng, T. S., Borochov, A., Olszewski, N. E. and Weiss, D.
2001. The role of SPY and its TPR domain in the regulation of gibberellin action
throughout the life cycle of Petunia hybrida plants. Plant J 28, 181-90.
Koornneef M, Bentsink L, Hilhorst H. 2002. Seed dormancy and germination. Curr
Opin Plant Biol 5(1), 33-6.
Laby, R. J., Kincaid, M. S., Kim, D. and Gibson, S. I. 2000. The Arabidopsis sugar-
insensitive mutants sis4 and sis5 are defective in abscisic acid synthesis and response.
Plant J 23, 587-96.
Lee, S., Cheng, H., King, K. E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N. P.
and Peng, J. 2002. Gibberellin regulates Arabidopsis seed germination via RGL2, a
GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev.
16, 646-658.
Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W. H., Liu, Y. X., Hwang, I.,
Jones, T. and Sheen, J. 2003. Role of the Arabidopsis glucose sensor HXK1 in nutrient,
light, and hormonal signaling. Science 300, 332-6.
48
Nambara, E., Akazawa, T. and McCourt, P. 1991. Effects of the gibberellin
biosynthetic inhibitor uniconazol on mutants of Arabidopsis. Plant Physiol. 97, 736-738.
Olszewski, N., Sun, T. P. and Gubler, F. 2002. Gibberellin signaling: biosynthesis,
catabolism, and response pathways. Plant Cell 14 Suppl, S61-80.
Pego, J. V., Weisbeek, P. J. and Smeekens, S. C. 1999. Mannose inhibits Arabidopsis
germination via a hexokinase-mediated step. Plant Physiol 119, 1017-23.
Price, J., Li, T. C., Kang, S. G., Na, J. K. and Jang, J. C. 2003. Mechanisms of
glucose signaling during germination of Arabidopsis. Plant Physiol 132, 1424-38.
Pysh, L., Wysocka-Diller, J., Camilleri, C., Bouchez, D. and Benfey, P. 1999. The
GRAS gene family in Arabidopsis: sequence characterization and basic expression
analysis of the SCARECROW-LIKE genes. Plant J 18, 111-9.
Steber, C. M., Cooney, S. E. and McCourt, P. 1998. Isolation of the GA-response
mutant sly1 as a suppressor of ABI1-1 in Arabidopsis thaliana. Genetics 149, 509-21.
Swain SM, Tseng TS, Thornton TM, Gopalraj M, Olszewski NE. 2002. SPINDLY is
a nuclear-localized repressor of gibberellin signal transduction expressed throughout the
plant. Plant Physiol 129(2), 605-15.
Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP. 2004. Della
proteins and gibberellin-regulated seed germination and floral development in
arabidopsis.Plant Physiol 135(2),1008-19.
Vicient, C. and Delseny, M. 1999. Isolation of total RNA from Arabidopsis thaliana
seeds. Anal Biochem 268, 412-3.
49
Table 1. Relative mRNA levels
Genes
genotypes
ABI3 RGL2 SPY
abi3-1a 0.31 ?0.12 1.21 ?0.44
rgl2-1a 0.14 ?0.04 1.80 ?0.11
WTb 2601.4 ?43.6 46.6 ?3.7
WTc 2.5 ?0.1
a) mRNA levels in mutant seeds/ mRNA levels in Ler seeds imbibed in H2O at 4oC for 7
days
b) mRNA levels in WT (Ler) seeds imbibed in glucose solution/ mRNA levels in WT
seeds imbibed in H2O at 4oC for 3 days
c) mRNA levels in WT (Ler) seeds imbibed in ABA solution/ mRNA levels in WT seeds
imbibed in H2O at 4oC for 3 days
50
Fig.1A. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination on 0.5MS.
Points on the Z-axis are in hours after transfer of plates to the growth chamber.
51
Fig.1B. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination 0.5MS
containing 2.5% glucose. Points on the Z-axis are in hours after transfer of plates to the
growth chamber.
52
Fig.1C. Time course of abi3-1, rgl2-1, spy5 and WT (Ler) seed germination on 0.5MS
containing 2.5% glucose. Points on the Z-axis are in hours after transfer of plates to the
growth chamber.
53
Fig. 2. Effects of mannose on seed germination. Percent germination of WT and mutants,
10 days after transfer to a growth chamber, on 0.5MS containing different concentrations
of mannose. Concentration of mannose (mM) is indicated on the Z-axis.
54
Fig. 3A. Percent germination of WT and mutants, on 0.5MS containing: 1 ?M ABA.
Time (days) after transfer to the growth chamber is indicated on the Z-axis.
55
Fig. 3B. Percent germination of WT and mutants, on 0.5MS containing: 3?M ABA.
Time (days) after transfer to the growth chamber is indicated on the Z-axis.
56
Fig. 3C. Percent germination of WT and mutants, on 0.5MS containing: 10-5 M PAC.
Time (days) after transfer to the growth chamber is indicated on the Z-axis.
57
Fig. 3D. Percent germination of WT and mutants, on 0.5MS containing: 10-4 M PAC.
Time (days) after transfer to the growth chamber is indicated on the Z-axis.
58
Fig. 4A-F. Comparison of glucose and sorbitol effect on the WT seedling development
(A-C) and effects of glucose on GA signaling mutant seedling growth (D-F) analyzed on
day 18 after the transfer to growth chamber. In the glucose plus sorbitol groups, 1.5%
treatment is glucose alone, 2.5% treatment is 1.5% glucose plus 1% sorbitol, 5%
treatment is 1.5% glucose plus 3.5% sorbitol, 7% treatment is 1.5% glucose plus 5.5%
sorbitol.
59
Fig. 4A. Representative WT rosettes grown on various concentrations of glucose, sorbitol
and glucose plus sorbitol, total concentrations are indicated above rosettes
60
Fig. 4B. Root length of WT grown on various concentrations of glucose, sorbitol and
glucose plus sorbitol.
61
Fig. 4C. Shoot weight of WT grown on various concentrations of glucose, sorbitol and
glucose plus sorbitol.
62
Fig. 4D. WT and GA signaling mutant rosettes grown on various concentrations of
glucose. Glucose concentrations (%) are indicated above rosettes.
63
Fig. 4E. Root length of WT and GA signaling mutant grown on various concentrations of
glucose.
64
Fig. 4F. Shoot weight of WT and GA signaling mutant grown on various concentrations
of glucose.
65
Fig. 5. Proposed model for interactions between glucose, ABA and GA signaling
pathways during seed germination and later stages of seedling development. See text for
details.
66
IV. PHYTOHORMONE SIGNALING PATHWAYS INTERACT WITH SODIUM
CHLORIDE DURING SEED GERMINATION AND SEEDLING
DEVELOPMENT
Abstract
Soil salinity is one of the most significant abiotic stresses limiting plant growth.
The adaptation of plant cells to stress conditions involves triggering a network of
signaling events. The plant hormone abscisic acid (ABA) regulates many important
aspects of plant growth and development, and plays a critical role in stress responses. The
process of seed germination is affected by salt and osmotic stress at least partially via the
ABA signaling pathway. Several components in the GA signaling pathway are known to
be involved in germination but have not been tested for their involvement in salt and
osmotic stress. We examined the responses of two mutants in GA signaling pathway to
salt and osmotic stress during seed germination and early seedling development. Two
mutants in the ABA signaling pathway, previously demonstrated to be involved in seed
germination under these stress conditions, were used as positive controls. Real-time PCR
was employed to test the genes relative expression levels in several mutants and under
various stress conditions to determine whether salt stress affects the seed germination via
transcriptional control of the components in GA or ABA signaling pathways. This study
suggested that different genes in ABA and GA signaling pathways are involved during
different developmental stages under stress condition. There is also a suggestion on
67
possible crosstalk between different hormone signaling pathways under the salt and
osmotic stress conditions.
Key words: Abscisic acid, Arabidopsis, Germination, Gibberellic acid, Salt signaling
68
Introduction
Abiotic stresses affect plant growth. Salinity in soil is one of the most significant
abiotic stresses. The phytohormones such as abscisic acid (ABA) play a critical role in
stress responses (Himmelbach et al., 2003). ABA content in plants under normal
physiological conditions is very low. Osmotic stresses induce dramatically levels of ABA
(Himmelbach et al., 1998). Certain salt-tolerant mutant plants have been identified that
were unable to accumulate ABA after hyperosmotic stress treatment (Ruggiero et al.,
2004). Several ABA-insensitive (ABI) and ABA-deficient (ABA) mutants have reduced
sensitivity to salt and osmotic stress during seed germination in Arabidopsis. Quesada et.
al reported that one of the salt-tolerant mutants was a null allele of the ABI4 gene
(Quesada et al., 2000). ABI3, ABI4 and ABI5 encode transcription factors and they have
been shown to regulate ABA responses in seeds and in various aspects of vegetative
growth (Finkelstein et al., 1998; Finkelstein and Lynch, 2000; Signora et al., 2001; Brady
et al., 2003). Salt stress responses of aba mutants after germination are complicated. For
example, the aba1 mutant is more sensitive to salt while aba3 mutant shows the same
sensitivity as WT during seedling development (Xiong et al., 2001). The salt tolerance of
abi mutants in vegetative tissues has not been reported. The possible relation between
stress tolerance and another important plant hormone GA has been studied in Arabidopsis
(Magome et al., 2004). The ddf1 (dwarf and delayed-flowering 1) is a novel Arabidopsis
mutant deficient in GA biosynthesis. Transgenic plants overexpressing DDF showed
increased tolerance to high-salinity stress (Magome et al., 2004). However, the levels of
endogenous active GAs in those plants exposed to stress have not been determined.
69
RGL2 negatively regulates GA responses that primarily control seed germination (Lee et
al., 2002; Tyler et al., 2004). In this report, we examine the response of mutants, rgl2 and
spy in GA signaling pathway, to salt and osmotic stress during seed germination and
early seedling development. We confirm the previous findings about the involvement of
two components of ABA signaling pathway, ABI3 and ABI5 in seed germination under
salt and osmotic stress. We extend this analysis to the response of these mutants to the
stress condition during early seedling development. We find that different genes in ABA
and GA signaling pathways are involved at different stages of plant development under
stress condition.
Results
Components of both ABA and GA signaling pathways are involved in inhibition of seed
germination by exogenous sodium chloride or mannitol
We investigated the seed germination kinetics of several mutants involved in the
ABA and GA signaling on plates containing various concentrations of sodium chloride or
mannitol. The initiation of seed germination is demonstrated by radical emergence. We
tested mutants in GA signaling pathways, spy-5 and rgl2-1 that are known to be involved
in germination. We also used two mutants, abi3-1 and abi5-1, in ABA signaling pathway
that were previously found to be salt resistant (Brocard et al., 2002). Because not all the
mutants are in the same genetic background we first tested WT seeds for degree of
sensitivity to salt during germination. Wassilewskija (Ws) is more sensitive to salt than
Landsberg erecta (Ler) during germination. Germination of Ler seeds on moderate
70
concentration of salt, 200 mM NaCl approached 95% on day 14 while only 1% of Ws
seeds germinated (Fig. 1A). rgl2, abi3 and abi5 are all resistant to high concentration of
salt during seed germination (Fig. 1A and 1B). The spy mutant is as sensitive as WT to
NaCl (data not shown). Moderate concentration (250mM) of salt delayed seed
germination of all the lines tested as shown in Figure 1B. Although the seed germination
percentage of Ler is similar to those of rgl2 and abi3 on day 14 on 250mM salt plates
(Fig. 1A), the seed germination kinetics of mutants are very different than the WT (Fig.
1B). The mutant seeds of rgl2, abi3 and abi5 show over 50% germination on day 4 as
compared to 0% by WT (Fig. 1B). The germination of Ler on 250mM NaCl begins on
day 5 and only approaches 33% on day 7. In contrast, the germination of abi3 and rgl2 is
already above 90% on day 5. The germination kinetics of rgl2 mutant seeds is similar to
abi3 seeds (Fig. 1B). High concentration (300mM) of sodium chloride also completely
inhibited seed germination of abi5 but not abi3 and rgl2. This may be primarily attributed
to different salt sensitivity of the background ecotypes of these mutants (Fig. 1). WS
seeds do not germinate on salt above 200mM (Fig.1A).
The seeds of two ecotypes (Ws, Ler) have different responses to osmotic stress
(mannitol) during germination. Ws is more sensitive to osmotic stress compared with Ler
during germination (Fig. 1C). The mutants we tested, rgl2, abi3 and abi5, are resistant to
high concentration of mannitol during seed germination. Surprisingly, spy mutant seeds
are also resistant to high concentration of mannitol during germination. Although the
seed germination percentage of Ler was similar to those of rgl2 and abi3 on day 14 on
400mM mannitol plates, the seed germination kinetics of mutants are very different than
71
the WT (Fig. 1D). The germination of Ler on 400 mM mannitol begins on day 2 and only
approaches 52% on day 4. The germination frequencies of abi3 and rgl2 are above 90%
on day 4. The germination kinetics of rgl2 mutant seeds is similar to abi3 seeds (Fig. 1D).
The inhibition of seed germination of abi5 mutant was less severe than that of Ws (Fig.
1C). The seed germination of abi5 approached 88% on 400mM mannitol plates while
only 2% of Ws seeds germinated.
Our data suggest that both the ABA signaling pathway via ABI3 and ABI5 and
GA signaling pathway via RGL2 are involved in salt and osmotic stresses inhibition and
delay of seed germination. SPY in GA signaling pathway is only involved in osmotic
stress inhibition.
Components of both ABA and GA signaling pathways have different functions during
completion of seed germination and on seedling survival under salt stress
The completion of seed germination was demonstrated by the cotyledon
emergence and the seedling survival was indicated by the presence of green cotyledons
after 14 days in growth chamber. The two ecotypes used, Ws and Ler, have different
response to salt stress during the completion of seed germination. Ws is more sensitive to
salt stress as compared with Ler (Fig. 2A). However, all of cotyledons of Ws that do
emerge remain green. Only some of Ler cotyledons remain green even at lower salt
concentrations (Compare Fig. 2A and 2B). The abi5 is highly resistant to salt stress
during the completion of seed germination even at higher concentration of salt (250mM).
Also, all of the abi5 cotyledons remain green on lower to medium salt concentrations,
72
150mM and 200mM (Fig. 2A and 2B). However, only about 50% of abi5 cotyledons
remain green at higher salt concentration, 250mM (Fig. 2A and 2B). The trend of rgl2
mutant response to salt stress during completion of seed germination and seedling
survival is similar to that of abi5 mutant. rgl2 is resistant to salt stress during the
completion of seed germination but only partially resistant to salt stress for seedling
survival especially at salt concentration above 200mM (Fig. 2A and 2B). The spy mutant
is indistinguishable from WT for completion of germination and seedling survival under
salt stress (not shown). The abi3 differs from WT and other mutants tested in its response
to salt at later stages of seed germination. Although most of abi3 seeds initiate
germination (Fig. 1A and 1B), none of the seeds complete the process at high salt
concentrations (Fig. 2A). The abi3 seeds that complete germination at lower salt
concentration, 150mM and 200mM, have much lower survival rate than even WT
(compare Fig.2A and 2B).
We extended our analysis to the salt stress effects on later seedling development.
In these experiments seeds were germinated on plates without salt and young seedlings
were transferred to plates with 50mM and 75mM sodium chloride. The root lengths of
rgl2 and abi5 mutant seedlings were not significantly different from those of WT
seedlings on control plates without salt (Fig. 2C). There is also no significant difference
between the root lengths of rgl2 and abi5 mutant seedlings and those of WT seedlings
from day 1 to day 7 after transfer to plates with 50mM and 75mM sodium chloride (Fig.
2D and 2E, abi5 data not shown). The root lengths of abi3 mutant seedlings were
significantly shorter as compared to those of WT seedlings from day 2 to day 7 after
73
transfer to plates with 75mM sodium chloride (Fig. 2E). There is a slight difference
between root lengths of abi3 mutants and WT on 50mM sodium chloride plates (Fig. 2D).
These data suggest that ABI3 may provide protection from salt stress or it may decrease
the sensitivity to salt stress once the roots emerge during later stages of seedling
development. ABI5 and RGL2 do not seem to be involved in seedling growth under salt
stress conditions.
Components of both ABA and GA signaling pathways have different effects on completion
of seed germination and on seedling survival under osmotic stress conditions
All mutants that are resistant to osmotic stress, as shown by initiation of
germination on various concentrations of mannitol (300mM, 400mM and 500mM) were
tested for the germination completion and seedling survival (Fig. 3A). The abi5 is highly
resistant to osmotic stress during the completion of seed germination even at high
(500mM) mannitol concentrations. The trend of rgl2 and abi3 mutant response to
osmotic stress during completion of seed germination and seedling survival is similar to
that of abi5 mutant (Fig. 3A and 3B). The spy mutant is highly resistant to osmotic stress
during the completion of seed germination even at highest mannitol concentration,
600mM, we used (Fig. 3A). All emerged mutant cotyledons except spy remain green on
day 14 (Compare 3A and 3B). Although majority (above 80%) of spy seeds complete
germination on all mannitol concentration used, only less than 20% of seedlings survives
on 600mM mannitol (Fig. 3B).
74
Transcription of genes involved in salt stress sensing during seed germination
We have shown that ABI3, ABI5 and RGL2 are all involved in inhibition of seed
germination under salt and osmotic stress conditions. All three of these genes are
transcription factors regulating expression of downstream effectors of germination.
Therefore we determined transcription levels of these genes on WT and mutant
backgrounds under salt stress conditions.
To investigate the effect of ABI3, ABI5 and RGL2 on seed germination delay and
inhibition by sodium chloride, we compared ABI3, ABI5 and RGL2 mRNA levels in WT
seeds imbibed in 200mM sodium chloride to seeds imbibed in H2O alone. ABI3 mRNA
level in seeds imbibed in salt is more than seventy-six times higher than that of H2O
treated seeds (Table 1). This indicates that sodium chloride induces ABI3 gene expression
at transcriptional level. The ABI5 mRNA level in seeds treated with sodium chloride is
more than forty-eight times higher than that of H2O treated seeds (Table 1). The RGL2
mRNA level in seeds treated with sodium chloride is more than one hundred and fourteen
times higher than that of H2O treated seeds (Table 1). These data suggest that sodium
chloride delays and/or inhibits seed germination via transcriptional induction of all three
genes tested: ABI3, ABI5 and RGL2.
The expression levels of all genes we tested went down in mutant backgrounds
under normal conditions. We analyzed the RGL2 transcription levels in abi3 and WT
seeds imbibed in H2O at 4oC in dark for 3 days. The relative RGL2 mRNA levels in abi3
mutant seeds decreased four fold relative to WT seeds and the relative ABI5 mRNA
levels in abi3 mutant seeds decreased thirteen fold relative to WT seeds (Table 1). This
75
result suggests that ABI3 has a positive effect on the RGL2 and ABI5 gene expression.
Since RGL2 belongs to the GRAS family of putative transcriptional regulators (Pysh et
al., 1999), we also compared the ABI3 and ABI5 transcription levels in rgl2 and WT
seeds. ABI3 mRNA levels in rgl2 mutant seeds decreased by sixty six fold compared to
those in WT seeds and ABI5 mRNA levels in rgl2 mutant seeds decreased by eleven fold
compared to those in WT seeds (Table 1). This suggests that RGL2 may be involved in
the activation of ABI3 and ABI5 expression. The mRNA levels of RGL2 and ABI3 in
abi5 mutant seeds also decreased compared to those in WT seeds. RGl2 mRNA levels in
abi5 mutant seeds decreased by thirty one fold compared to those in WT seeds and ABI3
mRNA levels in abi5 mutant seeds decreased by twenty fold compared to those in WT
seeds. These data suggest that ABI3, ABI5 and RGL2 may be involved in the crosstalk
between the ABA and GA signaling pathways and that it may be accomplished by
reciprocal transcriptional activation.
To see if salt effect on each genes expression is ?direct?, we also looked at
expression levels of each gene under salt stress in mutant backgrounds. The RGL2
expression level in abi3 mutant seeds is not induced by salt (Table 1A). In contrast,
RGL2 expression is induced 14 fold by salt in abi5 background. The ABI3 expression in
rgl2 and abi5 seeds is only slightly induced by salt, 3 and 5 fold respectively. However,
this level of induction is still significantly below the level of induction, 118 fold, in WT
seeds. The ABI5 expression level in rgl2 mutant seeds is only slightly induced by salt, 2
fold, as compared to nearly 50 fold induction in WT. There is no induction by salt of
ABI5 expression in abi3 mutant seeds (Table 1). All of the gene expression levels we
76
tested in the mutant seeds treated with salt are significantly lower than their expression in
the WT seeds treated with salt. These data indicate that salt may induce expression of one
or two of these genes which, in turn up-regulate each other.
Discussion
The salt stress consists of ionic and osmotic impact on plant cells. The mechanism
of salt tolerance is very complex. Along with the primary ionic and osmotic signals,
stress hormone, ABA working as the secondary signal is generated. Plant mutants
defective in ABA and other hormone production or signal transduction have been used to
study the plant hormones function in response to salt stress. Several ABA-insensitive
mutants have reduced sensitivity to salt and osmotic stress during seed germination in
Arabidopsis (Werner et al., 1995; Carles et al., 2002). Our results confirmed the previous
studies that salt delays germination by activating the ABA signaling pathway via ABI3
and ABI5. The previous data showed that a gene in GA signaling pathway, rgl2 is
involved in germination (Lee et al., 2002). The involvement of GA signaling pathway in
the salt and osmotic stress tolerance was demonstrated in our study. In this report we
show that rgl2 seeds can germinate on NaCl and mannitol concentrations higher than the
control. This indicates that rgl2 mutant is less sensitive to general osmotic stress and
NaCl ion toxicity during germination than wild type. This result strongly suggests that the
biological role of RGL2 is to prevent germination when osmotic pressure is too high.
During germination, RGL2 would act also as a sensor for osmotic status and would be
part of a growth repression mechanism during germination when the seed imbibes under
77
unfavorable conditions. All mutants were sensitive to KCl (not shown). It indicates that
abi3, abi5 and rgl2 mutants are less sensitive to ion toxicity caused by Na+, but not Cl-.
Salt application has a pronounced effect on ABI3, ABI5 and RGL2 expression,
Our data show that ABI3, ABI5 and RGL2 gene expression levels are induced by salt,
although whether salt induces all genes ?directly? remains to be determined. The
products of all these genes are putative transcription factors. ABI5 is active throughout
the plant?s life and the highest expression induced by ABA and stress is at the transition
from mature seeds to seedling development (Brocard et al., 2002). The high level of
complexity of the crosstalk and interactions exist between the different regulatory genes
and pathways. Our data show that ABI3, ABI5 and RGL2 transcription in abi3, abi5 and
rgl2 mutant backgrounds was significantly lower, ranging between 4 and 67 fold, in all
the mutant backgrounds as compared to WT in the absence of stress. This indicates that
each of the three genes has a positive effect on the transcription of the other two under
normal conditions. The transcription of ABI5 is not induced by salt in rgl2 and abi3
mutants. Also, there is no induction of RGL2 or ABI5 in abi3 mutant background under
salt stress. The highest induction by salt in any of the mutant backgrounds was observed
for the expression of RGL2 in the abi5 background. Theses results suggest that salt
induction of ABI5 expression may be accomplished via the induction of RGL2 and/or
ABI3 expression first (Fig. 4). It appears that under salt stress ABI3 and/or RGL2
expression is induced first and later each of the three genes up-regulates the expression of
the other two (Fig. 4). These data suggest a complex crosstalk between the ABA and GA
signaling pathways that involves ABI3, ABI5 and RGL2 gene products. ABI3, ABI5 and
78
RGL2 act as major factors during germination because of their accumulation in the
presence of salt. Figure 4 shows our model of a possible mechanism of the salt-induced
delay and inhibition of seed germination. Salt leads to a dramatic increase in ABI3 and
ABI5 gene expressions at the transcriptional level, which in turn activates the ABA
signaling pathway resulting in inhibition of seed germination. The ABI3 and ABI5 gene
products may also activate RGL2 transcription and thus lead to inactivation of GA
signaling pathway at the same time. Salt also up-regulates RGL2 expression either
directly or via ABI3 and/or ABI5 thus leading to inhibition of seed germination by
turning off the GA signaling pathway. Our data also suggest that RGL2 may activate the
ABA signaling pathway by up-regulating ABI3 and ABI5 transcription. Taken together,
the salt tolerance of rgl2 and abi mutants to Na+ ion is relative to the disturbance of both
ABA and GA signaling pathways. It indicates that both ABA and GA signaling pathways
are involved in the effect of salt stress during seed germination.
Salt not only plays a role in germination but also in other aspects of the plant life
cycle, such as seedling development. Quesada et al. reported that the salt tolerant mutants
isolated by seed germination screening may not be resistant to salt during seedling or
adult stages of development (Quesada et al., 2000). The sensitivity or tolerance of abi
mutants to salt stress during the early seedling stage has not been reported. Our results
indicate that the responses to salt during early seedling development in abi3, abi5, rgl2
and spy are not the same. Although all the mutant plants were eventually killed by salt
after long exposure to high salinity environment abi5 and rgl2 young seedlings have
reduced sensitivity to ion toxicity induced by Na+. Both of these mutants, rgl2 and abi5,
79
completed germination at higher rates and survived longer than WT under salt stress
conditions. On the other hand, the abi3 young seedlings are resistant to osmotic stress but
are hypersensitive to ion toxicity caused by Na+. We speculate that Na+, not Cl- , causes
these altered responses by mutants because all mutants are indistinguishable from WT
when germinated and/or grown on KCl containing media (not shown). Our results
indicate that the functions of ABI genes are different during early seedling development.
ABI5 may prevent the initiation and the completion of seed germination under osmotic
and salt stress. ABI3 seems to have different functions during different stages of seed
germination under salt stress. It seems that ABI3 gene product together with ABI5 and
RGL2 inhibits initiation of seed germination. However, abi3 mutants seem to be
hypersensitive to salt after germination has been initiated. This suggests that the normal
ABI3 product may provide some kind of protection to young seedlings if the germination
is initiated under high salt stress. RGL2 transcription is not detectable after the seed
germination under non-stress conditions (Lee et al., 2002). Our data indicate that RGL2
together with ABI3 and ABI5 prevents initiation of seed germination. RGL2 like ABI5
also seems to inhibit all stages of seed germination under osmotic and salt stress. Also
like ABI5, RGL2 seems to have no function in post-germination seedling development.
In conclusion, several components of ABA and GA signaling pathways are
involved in inhibition of seed germination under osmotic and salt stress conditions. In
addition, it appears that one of the components of the ABA signaling pathway, ABI3, has
an additional role in salt tolerance if seed germination is initiated under high salt stress
conditions.
80
Materials and methods
Plant materials
Two ecotypes of Arabidopsis thaliana were used in this study: Landsberg erecta
(Ler) and Wassilewskija (Ws). Various Arabidopsis mutants with altered ABA and GA
signaling were obtained from Arabidopsis stock centers. spy5, abi3-1 and abi5-1 came
from the Arabidopsis Biological Resource Center at Ohio State University,
(http://www.arabidopsis.org/abrc/) and rgl2-1 (SGT625, Lee et al., 2002) came from the
Nottingham Arabidopsis Stock Center (http://arabidopsis.info/).
Germination, plant growth assays and RNA isolation
Before plating, seeds were sterilized in 6.25% Sodium hypochlorite for 3 min and
rinsed three times with sterile distilled water. Seeds were planted on 0.5X Murashige and
Skoog medium (0.5MS, Caisson Laboratories) solidified with 0.8% agar (Fisher
Scientific) and containing varying concentrations of sodium chloride or mannitol.
Sodium chloride was obtained from Fisher Scientific and mannitol was obtained from
Sigma. Arabidopsis seeds were stratified for 3 d at 4?C in dark, then placed in a growth
chamber with 70% humidity and under 18h light and 6h dark at 23?C to facilitate
germination. Germination (based on radicle emergence from the seed coat) was scored
daily for 3-14 days. Each plate contained 90?110 seeds. Every experiment was repeated
two to three times. In each experiment different batches of seeds were used. However, in
each experiment WT and mutant seeds used were collected at the same time from the
81
same age plants grown under the same conditions. Although time course of germination
differed in each experiment the trends in germination were the same for different batches
of seeds. The data shown here is from one of these experiments. Completion of seed
germination was measured by cotyledon emergence by day 14. Plant survival was
estimated by percentages of cotyledons remaining green at day 14.
For later seedling growth development assay, seeds were plated on 0.5MS
solidified with 0.8% agar and plus 3% sucrose. Arabidopsis seeds were stratified for 3 d
at 4?C in dark, then placed in a growth chamber with 70% humidity and under 18h light
and 6h dark at 23?C to facilitate germination. Young seedlings were transferred to 50mM
or 75mM sodium chloride plates at day 4 and plates were upside down. Root lengths
were measured from day 1 to day 7 after transferred to salt plates. Seed germination,
plant growth and plant survival data were analyzed using Microsoft Excel 2000. For
germination tests, seeds collected at the same or similar times were used and stored at
4?C before use.
For mRNA expression analyses mutant seeds were imbibed in distilled water for 3
days at 4?C in the dark or WT/ mutant seeds were imbibed in stress solutions, hormone
solutions or water for 3 days in the dark at 4?C. Total RNA was extracted from these
treated seeds for use in QRT-PCR. RNA extraction was performed as described
previously (Vicient and Delseny, 1999).
Real time PCR
82
Total RNA (2 ?g) was treated with a DNA-free kit (Ambion INC.) and tested
with real time PCR for DNA contamination. The purified total RNA was used as a
template to synthesize first-strand cDNA using a TaqMan Reverse Transcriptase kit
(Roche) with oligo(dT) primers as per the manufacturer?s instructions. Quantitative real
time PCR using first-strand cDNA as a template was carried out using an ABI Prism
7000 Sequence Detector with TaqMan Universal PCR Master Mix (Roche). PCR
reactions were carried out in a final volume of 50 ?l using gene specific primers and
probes in concentrations determined individually for each set of primers. Probes were
modified with 6-FAM, reporter dye at 5?-end and TAMRA quencher at 3?-end. All oligo
synthesis and modifications were done by Sigma-Genosys. Gene specific primers and
probes used were as follows: APT1 forward 5?TGTTCCTTGCAACCGTCTTCT3?,
reverse 5?TGGTTGAACGGTGGTTTGAG3?, probe 5?
CCACCACCGTGCTCCTCCTTCG3?; RGL2 forward 5?
GGCTGCACAGTGGAGGATTC3?, reverse 5?CGCGCTAGATCCGAGATGA3?,
probe 5?TGAAATCCGCTGGGTTTGACCCG
3?; ABI3 forward 5?CCATGGAAGACATCGGAACCT3?, reverse 5?
GGAGATACATCCTGCTTTTGTTGTT3?, probe
5?TCGTGTTTGGAACATGCGCTACAGGT3?; ABI5 forward
5?GAGGTGGCGTTGGGTTTG3?, ABI5 reverse 5?GGGCTTAACGGTCCAACCAT3?,
probe5?AGCGGGTGGACAGCAAATGGG3?
Thermocycler conditions were 2 min at 50?C, 10 min at 95?C and 40 cycles of 15s at
95?C and 1 min at 60?C. The mRNA level for each gene was determined using the
83
standard curve method according to manufacturer?s instruction (ABI Prism 7000
Sequence Detection System User Guide). APT1 (Adenosine phosphoribosyl transferase)
transcript level in each sample was used as an internal control (Arroyo et al., 2003). The
mean value from triplicate samples was used to calculate the transcript level. Results
were analyzed using Microsoft Excel.
Acknowledgments
We thank Dr. V. Sundaresan for providing permission to use rgl2-1 line and
ABRC and NASC for the mutant seed stocks. We thank Drs. N. Sigh, Fenny Dane, Omar
A.Oyarzabal and Covadonga R. Arias for comments on the manuscript. We are grateful
to Dr. L. Silo-Suh for the use of equipment and Dr. C. Dale and the members of his lab
for the help with QPCR. This work was financially supported by AU biogrant.
84
References
Arroyo, A., Bossi, F., Finkelstein, R. R. and Leon, P. 2003. Three genes that affect
sugar sensing (Abscisic Acid Insensitive 4, Abscisic Acid Insensitive 5, and Constitutive
Triple Response 1) are differentially regulated by glucose in Arabidopsis. Plant Physiol.
133, 231-242.
Brady SM, Sarkar SF, Bonetta D, McCourt P. 2003. The ABSCISIC ACID
INSENSITIVE 3 (ABI3) gene is modulated by farnesylation and is involved in auxin
signaling and lateral root development in Arabidopsis. Plant J 34(1), 67-75.
Brocard IM, Lynch TJ, Finkelstein RR. 2002. Regulation and role of the Arabidopsis
abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress response. Plant Physiol
129(4), 1533-43.
Carles C, Bies-Etheve N, Aspart L, L?on-Kloosterziel KM, Koornneef M,
Echeverria M, Delseny M. 2002. Regulation of Arabidopsis thaliana Em genes: role of
ABI5. Plant J 30(3), 373-83.
Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM. 1998. The Arabidopsis
abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell
10(6), 1043-54.
Finkelstein RR, Lynch TJ. 2000. The Arabidopsis abscisic acid response gene ABI5
encodes a basic leucine zipper transcription factor. Plant Cell 12(4), 599-609.
Himmelbach, A., Iten, M. and Grill, E. 1998. Signalling of abscisic acid to regulate
plant growth. phil. Trans 353. 1439-1444.
85
Himmelbach, A., Yang, Y. and Grill, E. 2003. Relay and control of abscisic acid
signaling. Curr Opin Plant Biol 6, 470-9.
Lee, S., Cheng, H., King, K. E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N. P.
and Peng, J. 2002. Gibberellin regulates Arabidopsis seed germination via RGL2, a
GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev.
16, 646-658.
Liu J, Zhu JK. 1997. An arabidopsis mutant that requires increased calcium for
potassium nutrition and salt tolerance. Proc Natl Acad Sci 94(26), 14960-4.
Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K. 2004. Dwarf and delayed-
flowering 1, a novel Arabidopsis mutant deficient in gibberellin biosynthesis because of
overexpression of a putative AP2 transcription factor. Plant J 37(5),720-9.
Pandey GK, Cheong YH, Kim KN, Grant JJ, Li L, Hung W, D'Angelo C, Weinl S,
Kudla J, Luan S. 2004. The calcium sensor calcineurin B-like 9 modulates abscisic acid
sensitivity and biosynthesis in Arabidopsis. Plant Cell 16(7), 1912-24.
Pysh, L. D., Wysocka-Diller, J. W., Camilleri, C., Bouchez, D. and Benfey, P. N.
1999. The GRAS gene family in Arabidopsis: sequence characterization and basic
expression analysis of the SCARECROW-LIKE genes. Plant J 18, 111-9.
Quesada V, Ponce MR, Micol JL. 2000. Genetic analysis of salt-tolerant mutants in
Arabidopsis thaliana. Genetics 154(1), 421-36.
Quesada V, Garc?a-Mart?nez S, Piqueras P, Ponce MR, Micol JL. 2002. Genetic
architecture of NaCl tolerance in Arabidopsis. Plant Physiol 130(2),951-63.
86
Ruggiero B, Koiwa H, Manabe Y, Quist TM, Inan G, Saccardo F, Joly RJ,
Hasegawa PM, Bressan RA, Maggio A. 2004. Uncoupling the effects of abscisic acid
on plant growth and water relations. Analysis of sto1/nced3, an abscisic acid-deficient but
salt stress-tolerant mutant in Arabidopsis. Plant Physiol 136(2), 3134-47.
Signora L, De Smet I, Foyer CH, Zhang H. 2001. ABA plays a central role in
mediating the regulatory effects of nitrate on root branching in Arabidopsis. Plant J 28(6),
655-62.
Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP. 2004. Della
proteins and gibberellin-regulated seed germination and floral development in
arabidopsis.Plant Physiol 135(2),1008-19.
Vicient, C. and Delseny, M. 1999. Isolation of total RNA from Arabidopsis thaliana
seeds. Anal Biochem 268, 412-3.
Xiong L, Lee Bh , Ishitani M, Lee H, Zhang C, Zhu JK. 2001. FIERY1 encoding an
inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress
signaling in Arabidopsis. Genes Dev 15(15), 1971-84.
Werner, W.E. and Finkelstein, R.R. 1995. Arabidopsis mutants with reduced response
to NaCl and osmotic stress. Physiol. Plant 93, 659?666.
87
Table 1. Relative mRNA levels
Treatment/genotype NaCla rgl2b abi3b abi5b rgl2c abi3c abi5c
RGL2 114.5 ?38.6 - 0.23?0.04 0.032?0.008 - 0.67?0.042 14.4?1.3
ABI3 76.4 ?3.4 0.015?0.009 - 0.05?0.006 2.67?0.1 - 5.27?0.96
ABI5 48.7 ?5.7 0.094?0.12 0.077?0.003 - 2.18?0.23 0.82?0.053 -
a. mRNA levels in WT seeds imbibed in salt solution/ mRNA levels in WT seeds
imbibed in H2O at 4oC for 3 days.
b. mRNA levels in mutant seeds/mRNA levels in WT seeds imbibed in H2O at 4oC for 3
days.
c. mRNA levels in mutant seeds imbibed in salt solution/mRNA levels in mutant seeds
imbibed in H2O at 4oC for 3 days
88
Table 1A. Relative mRNA levels
Treatment/genotype NaCla rgl2b abi3b abi5b rgl2c abi3c abi5c
RGL2 +115 - -4 -31 - -1.5 +14
ABI3 +76 -67 - -20 +3 - +5
ABI5 +49 -11 -13 - +2 1 -
Fold increase marked as +number, fold decrease marked as ?number.
a. mRNA levels in WT seeds imbibed in salt solution/ mRNA levels in WT seeds
imbibed in H2O at 4oC for 3 days.
b. mRNA levels in mutant seeds/mRNA levels in WT seeds imbibed in H2O at 4oC for 3
days.
c. mRNA levels in mutant seeds imbibed in salt solution/mRNA levels in mutant seeds
imbibed in H2O at 4oC for 3 days
89
Fig.1A. Percentage of WT and mutant germination on 0.5MS containing different
concentrations of sodium chloride, 14 days after transfer to a growth chamber.
Concentration of sodium chloride (mM) is indicated on the Z-axis.
150
200
250
300
abi5Ws
Lerabi3
rgl2
0
20
40
60
80
100
Ge
rm
ina
tio
n(
%)
90
Fig.1B. Time course of abi3-1, abi5-1, rgl2-1, and WT (Ler and Ws) seed germination
on 250mM sodium chloride. Time (days) after transfer to the growth chamber is indicated
on the Z-axis.
4
5
6
7
abi5Ws
Lerabi3
rgl2
0
20
40
60
80
100
Ge
rm
ina
tio
n(
%)
91
Fig. 1C. WT and mutant seed germination percentages, 14 days after transfer to growth
chamber, on plates containing mannitol. Concentrations of mannitol (mM) are indicated
on the Z-axis.
300
400
500
600
abi5Ws
Lerabi3
rgl2spy
0
20
40
60
80
100
Ge
rm
ina
tio
n(
%)
92
Fig. 1D. Time course of abi3-1, rgl2-1, and WT (Ler) seed germination on 400mM
mannitol. Time (days) after transfer to the growth chamber is indicated on the Z-axis.
2
3
4
5
ler
abi3-1
rgl2-5
spy5
0
20
40
60
80
100
Ge
rm
ina
tio
n(
%)
Da
ys
93
Fig. 2A. Completion of germination under salt stress. Percentage of WT and mutant
cotyledon emergence, 14 days after transfer to a growth chamber, on 0.5MS containing
different concentrations of sodium chloride. Concentrations of sodium chloride (mM) are
indicated on the Z-axis.
150
200
250
300
abi5Ws
Lerabi3
rgl2
0
20
40
60
80
100
Co
tyl
ed
on
s(
%)
94
Fig. 2B. Percentage of WT and mutant seedling survival as determined by the presence of
green cotelydons, 14 days after transfer to a growth chamber. Concentration of sodium
chloride (mM) is indicated on the Z-axis.
150
200
250
300
abi5Ws
Lerabi3
rgl2
0
20
40
60
80
100
Gr
ee
nc
ot
yle
do
ns
(%
)
95
Fig. 2C. Root length of WT and mutant seedlings, on 0.5MS without salt. Time (days)
after transfer to the growth chamber is indicated on the X-axis.
0.00
0.20
0.40
0.60
0.80
1.00
1.20
1.40
1.60
1.80
1 2 3 4 5 6 7
Days
Ro
ot
L
en
gt
h
(cm
)
Ler
rgl2
abi3
96
Fig. 2D. Root length of WT and mutants seedlings, on 0.5MS containing 50mM NaCl.
Time (days) after transfer to salt plates is indicated on the X-axis.
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.90
1 2 3 4 5 6 7
Days
Ro
ot
L
en
gt
h
(cm
)
ler
rgl2
abi3
97
Fig. 2E. Root length of WT and mutants seedlings on 0.5MS containing 75mM NaCl.
Time (days) after transfer to the salt plates is indicated on the X-axis.
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.90
1 2 3 4 5 6 7
Days
Ro
ot
L
en
gt
h
(cm
)
ler
rgl2
abi3
98
Fig. 3A. Completion of germination under osmotic stress. WT and mutant cotyledon
emergence at day 14 after transfer to growth chamber on various concentrations of
mannitol. Concentration of mannitol (mM) is indicated on the Z-axis.
300
400
500
600
abi5Ws
Lerabi3
rgl2spy
0
20
40
60
80
100
Co
tyl
ed
on
s(
%)
99
Fig. 3B. WT and mutant germinated seedling survival (presence of green cotyledon) at
day 14 after transfer to growth chamber on various concentrations of mannitol.
Concentrations of mannitol (mM) is indicated on the Z-axis.
300
400
500
600
abi5Ws
Lerabi3
rgl2spy
0
20
40
60
80
100
Gr
ee
nc
ot
yle
do
ns
(%
)
100
Fig. 4. Proposed model for interactions between salt, ABA and GA signaling pathways
during seed germination. See text for details.
Exogenous Salt
RGL2 ABI3
Seed germination
GA signaling pathway
ABI5
101
V. SEVERAL GENES IN GRAS FAMILY OF TRANSCRIPTION FACTORS ARE
INVOLVED IN SATL STRESS TOLERANCE IN ARABIDOPSIS
Abstract
Exogenous salt inhibits seedling development when applied after germination. We
have identified several mutants that are hypersensitive to salt during seedling
development. Three genes in GRAS family, SCARECROW (SCR), SHORT ROOT (SHR)
and SCARECROW-LIKE 3 (SCL3) are involved in the salt-induced inhibition of seedling
development. Transcription of the SCR and SHR genes is up-regulated by salt. There are
differences in stress tolerance between genotypes or differences in stress tolerance at
different developmental stages of a single genotype. This study also demonstrated the
interaction among GRAS family genes (SCR, SHR and SCL3) and components (SOS1,
SOS2 and SOS3) in SOS signaling pathway. The result indicated that SCR and SHR may
play important roles in the salt-induced inhibition of seedling development via regulating
transcription levels of SOS1, 2 and 3 in SOS signaling pathway.
Key words: Abscisic acid, Arabidopsis, Seedling development, Salt signaling, Salt-
Overly-Sensitive (SOS) pathway.
102
Introduction
There are many environmental stresses that a plant may experience during its
lifecycle such as extremes of temperature, drought and salinity. Soil salinity is one of
serious environmental stresses reducing the productivity of plants. Soil salinity affects
every stage of plant development from seed germination to mature plant growth. The
growth of most plants is inhibited by the presence of high concentrations of soil sodium
ions. Tolerance or susceptibility to salt stress is a very complex phenomenon. Most of the
stress-signaling intermediates have not been identified. Because ABA and GA are key
internal regulators of Arabidopsis plant growth it seems likely that salt exerts its
inhibitory effects via the biosynthesis, degradation or signaling pathways for these
hormones. Stress-responsive genes are regulated by both ABA-dependent and ABA-
independent signaling pathways (Zhu, 2002). ABA biosynthesis is up-regulated by
osmotic stress. The genetic studies on ABA-deficient mutants los5/aba3 and los6/aba1 of
Arabidopsis indicated that ABA plays a crucial role in osmotic stress-regulated gene
expression (Xiong et al., 2001; Xiong et al., 2002a). Our previous study showed that
several genes in the ABA and GA signaling pathways are involved in the delay and
inhibition of seed germination caused by salt stress.
Plant roots play important roles by taking up mineral nutrients from soil solutions.
Plants have solute exclusion mechanisms to maintain low [Na+] in shoots under salt stress
based on anatomical mechanisms. Endodermal Casparian bands are highly effective to
exclude charged solutes such as Na+ (Steudle, 2000). Two main components of casparian
bands are aliphatic and aromatic suberin. Aliphatic suberin is more hydrophobic and less
103
permeable to water. Caspariann bands prevent the passage of ions and big polar solutes.
The endodermal tissue acts as an efficient barrier and builds up a Na + gradient between
the root and the shoot.
The GRAS family (GIBERLLIC ACID INSENSITIVE (GAI), REPRESSOR of
GA1 (RGA) and SCARECROW (SCR)) in Arabidopsis consists of at least 33 structurally
related sequences (Bolle, 2004). The first GRAS family member isolated was SCR,
which is involved in root and shoot radial patterning (Di Laurenzio et al., 1996;
Wysocka-Diller et al., 2000). Another GRAS protein that is also involved in root and
shoot radial patterning is SHORT ROOT (SHR) (Helariutta et al., 2000). The scr mutant
seedling roots have only a single ground tissue cell layer in place of the two, cortex and
endodermis, present in the WT (Di Laurenzio et al., 1996). This single remaining cell
layer in scr roots expresses differentiated characteristics of both the cortex and the
endodermis (Di Laurenzio et al., 1996, Wysocka-Diller et al., 2000). However, it is not
clear whether this hybrid layer is fully functional as endodermis and cortex. In shr roots
there is also a single ground tissue layer but this layer differentiates into cortex resulting
in the complete deletion of root endodermis (Benfey et al., 1993; Helariutta et al., 2000).
Given these structural defects in scr and shr root endodermis one might expect that these
mutants would exhibit hypersensitivity to salt.
Another GRAS family member, SCARECROW-LIKE 3 (SCL3) has a tissue-
specific expression pattern in the root similar to SCR (Pysh et al., 1999). Considering the
expression pattern of SCL3 as well as its sequence homology to SCR and SHR it seems
likely that it may play a role in endodermal specification and/or function. SCR and SCL3
104
have been shown to be transcriptionally up-regulated by SHR (Levesque et al., 2006).
SCL3 was suggested to be down-regulated by GA (Curtis et al., 2005). However,
phenotype of scl3 has not been reported therefore its function was unknown.
Sodium is one of the nonessential ions in the soil. Sodium ions are abundant in
saline soils. Regulation of cellular ion homeostasis during salinity stress is very important
to increase salt tolerance of plants. The generation of a transient elevation of cytosolic
Ca2+ and the subsequent activation of Ca2+ sensor protein expression and/or activity are
the responses of plant cells to salt stress (Knight et al., 1997). Much research has been
directed toward understanding the molecular and cellular mechanisms of salt tolerance in
plants, but most of the components and mechanisms involved in the plant?s response to
ionic stress remain unknown. However, the identification of components (SOS1, SOS2
and SOS3) in the Salt-Overly-Sensitive (SOS) pathway in Arabidopsis is a promising
entry point for the elucidation of salt stress mechanism. The sos1 (salt overly sensitive 1),
sos2 and sos3 mutants were identified using a root-bending assay on NaCl-containing
agar plates (Wu et al., 1996; Zhu et al., 1998). SOS1 gene encodes the plasma membrane
Na+/H+ exchanger (antiporter) (Shi et al., 2000). SOS2 gene encodes a serine/threonine
type protein kinase which activity is required for salt tolerance (Liu et al., 2000). The N-
terminal kinase catalytic domain of SOS2 is similar to that of the yeast Suc
nonfermenting1 (SNF1) and AMP-activated (AMPK) kinases (Hardie, 1999). The N-
terminal catalytic domain and the C-terminal regulatory domain of SOS2 are essential for
SOS2 normal function. SOS3 encodes a protein that acts as a Ca2+ sensor in the plant. The
sequence of SOS3 has a significant similarity with that of the calcineurin B subunit from
105
yeast and neuronal calcium sensors from animals (Liu and Zhu, 1998). SOS3 and SOS2
interaction has been shown in the yeast two-hybrid assay and the analysis of double
mutant sos3/sos2 suggested that SOS2 and SOS3 work in the same pathway (Halfter et al.,
2000). SOS2 and SOS3 genes not only interact together but also regulate SOS1 gene
expression. SOS1 gene expression level is low in wild type (WT) in the absence of salt
but is up regulated, partially by SOS2/SOS3, during salt stress (Shi, 2000). SOS2 and
SOS3 are also required for the activation of SOS1 Na+/H+ exchanger. Quintero et al
(2002) reconstituted the SOS system in yeast cells and found that the SOS2/SOS3 kinase
complex promoted the phosphorylation of SOS1. The co-expression of SOS1, SOS2 and
SOS3 enhanced the salt tolerance of a yeast mutant that lacked Na+ transporters. SOS2
protein activity partially phosphorylated SOS1 independently of SOS3, but SOS2 protein
alone was not as efficient as the SOS2/SOS3 kinase complex for activation of SOS1 in
vivo (Quintero, 2002). In addition, the increased salt tolerance in plants may be induced
by the co-overexpression of SOS1, 2 and 3 (Guo et al., 2004). These results suggest that
SOS1-3 all function in the same pathway to protect plants form salt toxicity.
In this study, we analyzed three alleles of scl3 in order to deduce its function. We
found that SCL3 is not required for normal radial patterning or for plant growth and
development in the absence of environmental stress. SCL3 is important for salt tolerance
during germination and seedling development. We have also looked at scr and shr
responses to salt stress. We found that SHR, SCR and SCL3 genes may all be involved in
response to salt stress by interacting with each other and by affecting the expression of
the components of the SOS pathway.
106
Results
SCL3, a component of GRAS family is important for conferring resistance to salt stress
We have obtained from the Arabidopsis stock center seeds of the T-DNA
insertion line (salk_002516) potentially containing a T-DNA insert within the coding
region of the SCL3 gene. We called this line scl3-1. We tested scl3-1 mutants for seed
germination and the subsequent growth and development under various conditions. The
scl3-1 plants are indistinguishable from WT plants when grown on agar plates with or
without sucrose or when grown in soil (not shown). The phenotypic differences between
scl-3 line and WT were observed only under salt stress.
In one set of experiments, two scl3-1 lines (generated from two original seeds
from the stock center) were tested for post germination responses to salt stress. WT and
scl3-1 seeds were germinated on agar plates without salt in the media. Newly germinated
seedlings were then transferred to plates containing 120 mM NaCl. The roots of scl3-1
seedlings showed three different phenotypes under salt stress conditions (Fig. 1A).
Approximately a quarter of the scl3-1 seedlings had long roots of similar length to WT
controls (Fig. 1A ?phenotype 3). The remaining seedlings, three quarters of the total, had
roots much shorter than WT suggesting salt hypersensitivity. The root growth of
approximately two thirds of shorter root seedlings showed partial sensitivity to salt stress.
These seedlings had roots of an intermediate length (Fig. 1A - phenotype 2), between the
WT length and the very short ones. The remaining scl3-1 seedlings, approximately a
quarter of the total, had very short roots (Fig. 1A - phenotype 1). These results suggest
that the scl3-1 lines used in these experiments are heterozygous for the mutation causing
107
salt sensitive phenotype. The partial salt sensitivity of half of the seedlings suggests
incomplete dominance of this allele. To demonstrate that the salt oversensitivity is related
to SCL3 gene function we tested if the phenotype co-segregates with the T-DNA
insertion in the SCL3 gene.
Genomic DNAs were extracted from individual scl3-1 seedlings that had different
phenotypes under salt stress conditions (Fig. 1A). Primers were designed and synthesized
for PCR analysis on genomic DNAs to detect the presence or the absence of T-DNA
within the SCL3 gene. For the detection of wild-type SCL3 and mutant scl3-1 allele,
PCR reactions were performed using scl3F/LBb1 (SCL3 forward/T-DNA), scl3R/LBb1
(SCL3 reverse/T-DNA) and scl3F/scl3R (SCL3 forward and reverse) primer
combinations. Amplification with SCL3 primers alone indicates the absence of T-DNA
insertion in the sequence between these primers. Amplification with any combination of
one SCL3 primer, forward or reverse, and a T-DNA primer indicates the presence of T-
DNA insert in or near the SCL3 locus. Thus, the only amplification products in WT are
generated with SCL3 primers alone. We obtained a 1Kb product with SCL3 primers alone
using template DNA from plants with phenotype 3 (Fig. 2B) and plants with phenotype 2
(not shown). Amplification product was generated with Scl3R/LBb1 primer combination
in template DNA from plants with phenotype 2 (not shown) and phenotype 1 (Fig. 2B). It
suggested that the partial salt sensitivity is caused by one copy of scl3-1 allele and that
plants with intermediate length roots (phenotype 2) are heterozygous for scl3-1. There
were no amplification products with SCL3 primers alone when we used DNA from plants
with phenotype 1 (Fig. 2B). The presence of T-DNA containing SCL3 allele and the
108
absence of wild-type SCL3 allele in plants with very short roots (phenotype 1) indicates
that these plants are homozygous for scl3-1. PCR fragments amplified with scl3R/LBb1
primer combinations were used for sequencing to identify the precise insertion point of
T-DNA in scl3-1 allele. Sequencing analysis indicates that T-DNA is inserted in the
SCL3 coding region and the T-DNA insertion point is at position 543 just 306 bases
downstream of the start codon (Fig. 2A). The data shows that if the scl3-1 derived mRNA
was translated a truncated protein would be produced (Fig.2C). The truncated protein
would be composed of only 102 normal amino acids, out of the normal 482, fused to two
new ones encoded by the T-DNA (Fig. 2C). Because this represents less than a quarter of
the normal SCL3 product this suggests that the truncated protein is not functional.
In order to further confirm the function of SCL3 in salt tolerance, we analyzed
phenotypes of other potential alleles of SCL3, scl3-2 and scl3-3, under salt stress. The
seedling growth of scl3-2, scl3-3 and WT is shown in Fig. 1C. The scl3-2 and scl3-3
mutant seedlings have similar phenotype to that of WT seedlings when grown on control
plates without salt (not shown). scl3-2 and scl3-3 did not show the same level of
sensitivity to salt as scl3-1 allele. scl3-2 mutant showed partial sensitivity to salt stress
(Fig 1C). The phenotype of scl3-3 mutant is similar to WT when grown on 120mM NaCl.
To demonstrate the relationship between plant phenotypes under salt stress and T-DNA
insertion positions, genomic DNAs were extracted from individual scl3-2 and scl3-3
seedlings. To detect the presence of T-DNA in scl3-2 and scl3-3 the same primer
combinations were used as for scl3-1 described above. The PCR diagnostic test results
are shown in Fig. 2D. The 1Kb amplified fragments were detected with scl3F/scl3R
109
primer pair with both scl3-2 and scl3-3 DNAs. It indicated that there is no T-DNA in
either scl3-2 or scl3-3 allele between the forward and the reverse primer sequences. In
addition, the SCL3 forward primer (scl3F) combined with one of the T-DNA primers
(LBb) were the primer pair that yielded amplification products with DNA from both
alleles. An amplification product about 1.5 Kb in length was detected in DNA template
from scl3-3 plants with scl3F/LBb primer combination. The size of the fragment suggests
that T-DNA insertion point in scl3-3 is located beyond the coding region of SCL3 gene
(Fig. 2A). An amplification product detected with DNA template from scl3-2 plants with
scl3F/LBb1was larger than 1.5 K indicating that the T-DNA insertion in scl3-2 is even
further downstream than the one in the scl3-3. PCR fragments amplified with DNA
templates from scl3-2 and scl3-3 plants with scl3F/ LBb1 primer pairs were used for
sequencing to identify the precise insertion point of T-DNA in each SCL3 allele. The
sequence analysis indicates that the T-DNA insertion points in both scl3-2 and scl3-3
alleles are within the 3?UTR. The T-DNA insertion point of scl3-3 is at base position
1753 and that of scl3-2 is at 1920 (Fig. 2A). Although, both alleles contain inserts beyond
the coding region of SCL3 gene they differ in their phenotype. The T-DNA in scl3-2 is
even further downstream than the insert in the scl3-3. However, scl3-2 is a stronger allele.
The T-DNA insertion in scl3-2 may interfere with a polyadenylation signal that may lead
to transcript instability in this allele. The finding that the position of T-DNA in each scl3
allele correlates well with the phenotype confirms the conclusion that SCL3 gene is
involved in salt tolerance.
110
Two other genes in GRAS family, SCR and SHR are involved in root
development and have similar root expression patterns to SCL3 (Pysh et al., 1999). To
see if SCR and/or SHR may be involved in salt tolerance we tested the mutants for salt
sensitivity. The roots of scr1 and shr1 mutants are much shorter than those of WT even
on control plates. The scr1 and shr1 mutant roots stop growing after achieving lengths of
up to 2cm and 1cm respectively. Therefore, it is difficult to compare the root growth of
scr1 and shr1 mutants and those of WT directly. WT, scr1 and shr1 seeds were
germinated on agar plates without salt in the media. Newly germinated seedlings were
then transferred to plates containing 120 mM NaCl. The root growth of scr1 and shr1
seedlings under salt stress is not significantly different from the two mutant seedling
growth on control plates containing no salt (data not shown). These findings suggest that
scr1 and shr1 are not hypersensitive to salt stress.
Transcription of genes involved in plant salt tolerance
The mutants of three genes, SOS1, SOS2 and SOS3 in SOS signaling pathway
have salt hypersensitive phenotypes. We have identified another gene involved in salt
tolerance. The scl3 mutants show salt hypersensitive phenotypes similar to SOS mutants.
In our study, we also analyzed scr and shr mutants that have the defects in root
architecture affecting the structure of endodermis. However, in spite of these defects scr
and shr do not seem to be salt hypersensitive. To investigate potential roles of SOS1,
SOS2, SOS3, SCL3, SCR and SHR in salt tolerance we analyzed their expression under
stress conditions and on mutant backgrounds by Real Time PCR. First, we compared
111
mRNA levels corresponding to all six genes in WT 10-day roots imbibed in 200mM
NaCl to roots imbibed in H2O alone for 12 hours. We tested transcription levels of these
genes in three different WT ecotypes, Ws, Col and Ler. The expression levels of all genes
except SCR are similar in these three different ecotypes. SCR expression levels increased
six fold in Ler background and twelve fold in Ws background under salt stress (Fig. 3A).
The expression of only two genes, SCR and SHR, are induced by salt under conditions
used in our experiment. SCR mRNA level is up-regulated by salt stress at least five fold
depending on the ecotype (Fig. 3A). SHR mRNA level increases at least four fold in the
presence of salt. This indicates that sodium chloride induces SCR and SHR gene
expressions at the transcriptional level. SOS1, SOS2, SOS3 and SCL3 gene expression
levels did not change in the WT roots under salt stress as compared to WT roots under
non-stress conditions. Our SOS1, SOS2 and SOS3 expression data is inconsistent with
data from previous studies that showed that SOS1, SOS2 and SOS3 expression in the
roots is up-regulated by salt stress ( Liu et al., 2000; Shi et al., 2000; Gong et al., 2001).
This discrepancy may be due to the differences in experimental conditions used in the
two studies. We imbibed roots for 12 hours in 200mM salt instead of 6 hours. Our data
suggest that salt may inhibit root growth via transcriptional induction of both SCR and
SHR genes.
SCR, SHR and SCL3 gene products are transcription factors. It is possible that
they regulate the expression levels of genes that are directly involved in salt signaling
pathway. SOS1, SOS2 and SOS3 in SOS signaling pathway may be their potential targets.
The SCL3 transcription level may also be regulated by SCR or SHR since scl3 mutants
112
show salt hypersensitive phenotypes similar to SOS mutants. To investigate the
interactions among these genes under normal conditions, we analyzed the gene
expression levels in the mutant backgrounds under non-stress conditions. The SOS1,
SOS2 and SOS3 transcription levels were analyzed in shr, scr, scl3 and WT 10 days old
roots after roots imbibed in H2O at 4 ?C in the dark for 12 hours. There were no
significant differences of SOS1, SOS2 and SOS3 gene expressions in shr, scr or scl3
mutant backgrounds under normal conditions (Fig. 3B). The SCR, SHR and SCL3
transcription levels in mutants are similar to WT in the absence of stress (Fig. 3B). This
suggests that there is no interaction among these genes under normal conditions.
To further investigate the potential interactions among SCR, SHR and SCL3 genes
and/or their potential role in the regulation of SOS1, SOS2, SOS3 and SCL3 expression
we compared transcription levels in mutants and WT under salt stress conditions by Real
Time PCR. The shr, scr, scl3 and WT 10-day roots were imbibed in 200mM sodium
chloride at 4 ?C in the dark for 12 hours. The transcription levels of SOS1 were most
significantly altered in the three mutants in response to salt. The SOS1 expression is
twelve fold higher in shr and two fold higher in scr relative to WT roots under salt stress.
In contrast, the expression of SOS1 in scl3 is four fold lower than in WT roots (Fig. 3C).
These results suggest that SHR and perhaps SCR negatively regulate the SOS1 gene
expression under salt stress. However, SCL3 has an opposite effect and seems to
positively control the SOS1 transcription. The SOS2 mRNA levels in shr and scr
increased five-fold relative to WT (Fig. 3C). The SOS3 mRNA levels in shr and scr
increased ten-fold and five-fold respectively as compared to WT (Fig. 3C). These results
113
suggest that SHR and SCR also down-regulate SOS2 and SOS3 expression under salt
stress. SHR may regulate SOS2 and SOS3 gene expression indirectly through up-
regulation of SCR. The expression of SCR in shr background is seven fold lower under
salt stress (Fig. 3C). There were no significant differences in SOS2 and SOS3 expression
in scl3 mutants. These results suggest that SHR and SCR may down-regulate SOS2 and
SOS3 gene expression under salt stress but SCL3 is not involved in regulation of SOS2
and SOS3 gene expression. The SCL3 expression is increased five fold in shr background
suggesting that SHR down-regulate SCL3 expression under salt stress.
Components of GRAS family may be involved in seed germination under salt stress
The shr1 and scr1 mutants have abnormal root architecture but do not seem to be
hypersensitive to salt during seedling development. The scl3 mutant is hypersensitive to
salt during seedling development. We investigated the initiation of seed germination
kinetics of these mutants on plates containing intermediate concentrations of sodium
chloride. The initiation of seed germination is demonstrated by radical emergence. We
tested mutant scl3-1 that shows a similar phenotype as the WT plant under the normal
conditions. Germination of wild type (WT) and scl3 seeds in sodium chloride-free control
plates approached 100% after 72 h (Fig. 4A). However, scl3-1 mutant is hypersensitive to
the moderate concentration of salt during seed germination (Fig. 4). Germination of WT
approached 93% on day 7 on 200mM salt plates while only 74% of scl3 mutant seeds
germinated (Fig. 4A). The dramatic increase of germination frequency of Col begins on
day 3 but the germination frequency of scl3 increases dramatically 2 days later on
114
200mM NaCl (Fig. 4A). These data indicate that scl3 mutant is more salt sensitive than
Col during germination. The mutant seeds of shr1 and scr1, all have a significantly
higher germination rate than WT on 200mM NaCl plates (Fig. 4B). Germination of scr1
and shr1 approached 71% and 82% respectively on day 7 on 200mM salt plates while
only 25% of Ws seeds germinated. Our data suggest that all three GRAS family genes,
SCR1, SHR1 and SCL3 are involved in seed germination under salt stress.
Discussion
SCR and SHR are transcriptional regulators belonging to GRAS family (Bolle,
2004). Both proteins are localized to root endodermis where they form heterodimers and
regulate transcription of target genes (Cui et al., 2007). The scr and shr mutants have
defects in root architecture affecting the structure and possibly the function of
endodermis. The defective endodermis of scr and shr may affect Na + transport between
root and shoot. Given these structural defects of scr and shr mutants we expected that
they would exhibit hypersensitivity to salt. However, our results suggest that scr and shr
are not salt hypersensitive after germination and that they may be slightly salt resistant
during germination. These findings suggest that there must be some mechanism to
compensate for the presence of the defective endodermis in these mutants.
DELLA proteins in GRAS family are all repressors of GA signaling pathway
(Zentella et al., 2007). These proteins may also integrate signals from other hormone
signaling pathways and environmental cues to inhibit seed germination and restrict
seedling growth (Achard et al., 2003, 2006). SCL3 is in the GRAS family but it is not a
115
DELLA protein. The function of SCL3 has not been reported. There is evidence for the
expression of SCL3 being controlled by both GA and DELLA transcription regulators
(Zentella et al., 2007). Our study identified the function for SCL3 in plant salt stress
tolerance. We have shown that scl3 mutant alleles are salt hypersensitive both during
germination and also during seedling growth. SCL3 has a tissue-specific expression
pattern in the root similar to SCR (Pysh et al., 1999). Therefore, it was suggested that
SCL3 may play a role in the specification and/or function of root endodermis (Pysh et al.,
1999). However, our data indicates that SCL3 may not have a function in root
development and/or growth under non-stress conditions.
Our data indicates that SCR, SHR and SCL3 are all involved in salt tolerance.
These three proteins are transcriptional regulators. Therefore their primary function is to
regulate the transcription of downstream targets that would have a direct function in
stress response. Genes that are associated with abiotic stress response can be divided into
four groups based on their gene product function: osmolyte biosynthesis, antioxidant
protectants, protection of cell integrity and ion homeostasis (Nakajima et al, 2001;
Valliyodan and Nguyen, 2006). Regulation of cellular ion homeostasis is important for
plant salt tolerance. The Salt-Overly-Sensitive (SOS) pathway in Arabidopsis has been
well-characterized (Chinnusamy et al., 2004). The components in SOS pathway, SOS1,
SOS2 and SOS3, can transduce a salt stress-induced Ca2+ signal to reinstate cellular ion
homeostasis (Zhu, 2002). In our study we investigated a possibility of an interaction
between SCR, SHR and/or SCL3 transcription regulators and the components of SOS
pathway in salt stress responses of seedling roots. Our results suggest that salt may inhibit
116
root growth by inducing SHR and/or SCR gene expression first. Salt may up-regulate SCR
expression both directly and/or via SHR. Our data on SOS1, SOS2 and SOS3 transcription
in shr and scr mutants under salt stress indicate that SHR and SCR down-regulate
transcription of SOS1, SOS2 and SOS3. These results may explain why shr and scr
mutant seedlings do not have salt-sensitive phenotypes in spite of the defective root
morphology. The endodermal casparian bands in shr and scr mutants are missing and/or
are defective thus the movement of solutes such as Na+ may not be effectively controlled
by the abnormal endodermis. This defect is compensated for by the overexpression of
SOS genes in scr and shr backgrounds under stress conditions. In the absence of SCR
and/or SHR SOS gene expression is no longer repressed. Additional SOS1, SOS2 and
SOS3 proteins in mutants can transduce a salt stress signal and reinstate cellular ion
homeostasis to provide the protection from salt. In conclusion, the protection provided by
SOS gene products compensates for the endodermal defects in scr and shr roots. So the
phenotypes of shr and scr mutants under salt stress are similar as under non-stress
conditions. The function of SCL3 in salt tolerance can be partially explained by our
results linking SCR/SHR/SCL3 and SOS expression under salt stress. SCL3 expression
seems to be down-regulated by SHR. In addition, SCL3 up-regulates SOS1 expression.
Combining all these data together suggests that SCL3 mediates salt tolerance by
increasing SOS1 transcription. Our data also, indicates that SHR down-regulates SCL3
under salt stress thus indirectly leading to decreased SOS1 transcription. Thus, in shr
background SOS1 may be overexpressed because there is no repression by SHR and/or
there is stimulation by overexpressed, no longer repressed by SHR, SCL3. These data are
117
in agreement with previous findings that SHR directly controls SCR transcription and that
SHR controls SCR and SCL3 transcription via binding to their promoters (Levesque et al.,
2006). Our data suggests a very complex mechanism of gene expression regulation by
SCR/SHR and SCL3 which is supported by recent finding that SCR is required for SHR
to regulate some of its targets (Cui et al., 2007).
Based on the expression data of GRAS and SOS genes we have built a working
model for the gene interaction under salt stress. Figure 6 depicts our model. According to
this model, salt induces SHR and SCR gene expression either directly or indirectly or both.
SHR also up-regulates SCR and down-regulates SCL3. In addition, SHR and/or SCR in
turn down-regulate SOS1, SOS2 and SOS3 gene expression. SCL3 stimulates SOS1
expression. The levels of SCR, SHR and SCL3 products result in the regulation of SOS
pathway via repression and/or induction of transcription of its components.
Our most recent findings indicate that scr1 and shr1 mutant seeds are resistant to
salt stress during germination. In addition, SCL3 may also have a function during
germination under salt stress. The scl3 seeds are salt hypersensitive. Further experiments
are required to investigate the role of GRAS genes during germination.
Materials and methods
Plant materials
Three ecotypes of Arabidopsis thaliana were used in this study: Columbia (Col),
Wassilewskija (Ws) and Landsberg erecta (Ler). Various Arabidopsis mutants were
obtained from Arabidopsis stock centers. scl3-1(salk_002516), scl3-2(salk_023428),
118
scl3-3(salk_099576), 35s::scr, abi3-1 and abi5-1 came from the Arabidopsis Biological
Resource Center at Ohio State University, (http://www.arabidopsis.org/abrc/) and rgl2-1
(SGT625, Lee et al., 2002) came from the Nottingham Arabidopsis Stock Center
(http://arabidopsis.info/).
Germination and root growth assays
Before plating, seeds were sterilized in 6.25% Sodium hypochlorite for 3 min and
rinsed three times with sterile distilled water. Seeds were planted on 0.5X Murashige and
Skoog medium (0.5MS, Caisson Laboratories) solidified with 0.8% agar (Fisher
Scientific) and containing varying concentrations of salts or 75mg/l kanamycin. Filter
sterilized Kanamycin stock solution was added after autoclaving to avoid inactivation of
the antibiotic. Arabidopsis seeds were stratified for 3 d at 4?C in dark, then placed in a
growth chamber with 70% humidity and under 18h light and 6h dark at 23?C to facilitate
germination. Germination (based on radicle emergence from the seed coat) was scored
daily. Each plate contained 90?110 seeds. Every experiment was repeated two to three
times. In each experiment different batches of seeds were used. However, in each
experiment WT and mutant seeds used were collected at the same time from the same age
plants grown under the same conditions. Although time course of germination differed in
each experiment the trends in germination were the same for different batches of seeds.
The data shown here are from one of these experiments.
Seeds were planted on 0.5X Murashige and Skoog medium (0.5MS, Caisson
Laboratories) solidified with 0.8% agar (Fisher Scientific) and 3% sucrose and were
119
covered with a piece of biomembrane. The biomembrane with four-day-old seedlings
were transferred to 0.5MS medium containing 0.8% agar and indicated NaCl
concentrations. The plates were inverted and placed on racks vertically. The root lengths
were measured at day 12 after transferring to salt plates. Seed germination and root
growth data were analyzed using Microsoft Excel 2000. For germination tests, seeds
collected at the same or similar times were used and stored at 4?C before using.
DNA isolation and PCR
Genomic DNA was extracted from 2-week-old seedlings of several scl3 allels
mutants. The DNA isolation method is as following:
PCR analysis of T-DNA insertions was performed using left border (LB) primer
and SCL3 forward and reverse primers. The primers sequences were: LBb1 of pBIN-
pROK2 for SALK lines 5?GCGTGGACCGCTTGCTGCAACT3?
(http://signal.salk.edu/tdnaprimers.html); SCL3 forward
5?GCCTTCAATGGTGGCTATGT3?, reverse 5? CCGAAGAGCATCTTCTCCAC3?.
Thermocycler conditions were as following: stage 1 has 10 cycles with 1 min at 94?C,
1min at 58?C and 2min at 72?C, stage 2 has 30 cycles with 20seconds at 94?C, 30
seconds at 58?C and 2min at 72?C, stage 3 has 1 cycle with 10min at 72?C. After
confirmation of T-DNA insertion and insertion direction in scl3-1, a PCR amplification
product with the following primers was sequenced (Genomics & sequencing laboratory,
Auburn University). SCL3 reverse 5?CCGAAGAGCATCTTCTCCAC3?paired with left
border reverse 5?GCTTGCTGCAACTCTCTCAG3?. Thermocycler conditions were the
120
same as shown above. Two PCR amplification product from scl3-2 and scl3-3 with the
SCL3 forward and LBb1 primer pairs were sequenced. T-DNA primers were designed
with program from http://signal.salk.edu/tdnaprimers.html and other primers were
designed with program on http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.
RNA isolation and Real time PCR
For mRNA expression analyses ten-day-old seedlings were imbibed in 0.5MS
medium or 0.5MS medium with 200mM NaCl for 12 hours in the dark at 23?C. Shoots
and roots were separated after imbibition. Total RNA was extracted from these treated
shoots and roots with RNApure kit (Genehunter Corporation) for use in QRT-PCR. RNA
extraction was performed as described in the instruction of the manufacture (Genehunter
Corporation).
Total RNA (2 ?g) was treated with a DNA-free kit (Ambion INC.) and tested
with real time PCR for DNA contamination. The purified total RNA was used as a
template to synthesize first-strand cDNA using a TaqMan Reverse Transcriptase kit
(Roche) with oligo (dT) primers as per the manufacturer?s instructions. Thermocycler
conditions were 10min at 25?C, 30min at 48?C, 5min at 95?C and hold temperature is
0?C. Quantitative real time PCR using first-strand cDNA as a template was carried out
using an ABI Prism 7000 Sequence Detector with TaqMan Universal PCR Master Mix
(Roche). PCR reactions were carried out in a final volume of 50 ?l using gene specific
primers and probes in concentrations determined individually for each set of primers.
Probes were modified with 6-FAM, reporter dye at 5?-end and TAMRA quencher at 3?-
121
end. All oligo synthesis and modifications were done by Sigma-Genosys. Gene specific
primers and probes used were as follows: APT1 forward
5?TGTTCCTTGCAACCGTCTTCT3?, reverse 5?TGGTTGAACGGTGGTTTGAG 3?,
probe 5?CCACCACCGTGCTCCTCCTTCG3?; SCL3 forward 5?
GCGGGTGCGCAGTAATTT 3?, reverse 5?TTCCTGCATCTCCAAGCTGAT
3?, probe 5?TGGCAAGATCGACCTCTATACTCGG 3?; SOS1 forward 5?
ACCACTTTCCTTTTGACAGAAACG3?, reverse 5?
TCAGCAGGTCCTAGCTCCTCAT 3?, probe 5?
AGGCCTTACGAGCGTTTCAAGATCTAGGAGA3?; SOS2 forward 5?
CAAGACAAGGCTCGAGGGATTA3?, reverse 5?
GCCACCTCGTAAATCTCTATCACA3?, probe 5?
CTTCGATCAAGGCCGGACAGTTAGCTG3?. SOS3 forward 5?
GCGAAATGGAGTGATCGAGTTT3?, reverse 5?GCGCGCTTGGATGGAA3?, probe
5?TGAATTTGTCCGGTCCTTAGGTG3?. SHR forward 5?
GGAGCAATCTTGGAAGCAGTAGAC3?, reverse 5?CGGCCATTGAGTGCAAAAC3?,
probe 5?CAAAGATCCACATCGTTGACATAAGCTCCA3?. SCR forward 5?
ATGCACCACCGCAACCA3?, reverse 5?CTCCGCCGTATTTGTTTGGA3?, probe 5?
AGACAGTGACGGCCACTGTTCCC3?. Thermocycler conditions were 2 min at 50?C,
10 min at 95?C and 40 cycles of 15s at 95?C and 1 min at 60?C. The mRNA level for
each gene was determined using the standard curve method according to manufacturer?s
instruction (ABI Prism 7000 Sequence Detection System User Guide). APT1 (Adenosine
phosphoribosyl transferase) transcript level in each sample was used as an internal
122
control (Arroyo et al., 2003). The mean value from triplicate samples was used to
calculate the transcript level. Results were analyzed using Microsoft Excel.
Acknowledgments
We thank Dr. V. Sundaresan for providing permission to use rgl2-1 line and
ABRC and NASC for the mutant seed stocks. We thank Drs. N. Singh, Fenny Dane,
Omar A.Oyarzabal and Covadonga R. Arias for comments on the manuscript. We are
grateful to Dr. L. Silo-Suh for the use of equipment and Dr. C. Dale and the members of
his lab for the help with QPCR. This work was financially supported by AU biogrant.
123
References
Achard, P., Cheng, H., De Grauwe, L., Decat, J., Schoutteten, H., Moritz, T., Van
Der Straeten, D., Peng, J., and Harberd, N.P. 2006. Integration of plant responses to
environmentally activated phytohormonal signals. Science 311, 91?94
Achard, P., Vriezen, W.H., van der Straeten, D., and Harberd, N.P. 2003. Ethylene
regulates Arabidopsis development via the modulation of DELLA protein growth
repressor function. Plant Cell 15, 2816?2825.
Benfey PN, Linstead PJ, Roberts K, Schiefelbein JW, Hauser MT, Aeschbacher RA.
1993. Root development in Arabidopsis: four mutants with dramatically altered root
morphogenesis. Development 119(1), 57-70.
Bolle C. 2004. The role of GRAS proteins in plant signal transduction and development.
Planta 218(5), 683-92.
Chinnusamy V, Schumaker K, Zhu JK. 2004 Molecular genetic perspectives on cross-
talk and specificity in abiotic stress signalling in plants. J Exp Bot 55(395), 225-36.
Cui H, Levesque MP, Vernoux T, Jung JW, Paquette AJ, Gallagher KL, Wang JY,
Blilou I, Scheres B, Benfey PN. 2007. An evolutionarily conserved mechanism
delimiting SHR movement defines a single layer of endodermis in plants. Science
316(5823), 421-5.
Curtis IS, Hanada A, Yamaguchi S, Kamiya Y. 2005 Modification of plant
architecture through the expression of GA 2-oxidase under the control of an estrogen
inducible promoter in Arabidopsis thaliana L. Planta 222, 957-67.
124
Di Laurenzio L, Wysocka-Diller J, Malamy JE, Pysh L, Helariutta Y, Freshour G,
Hahn MG, Feldmann KA, Benfey PN. 1996. The SCARECROW gene regulates an
asymmetric cell division that is essential for generating the radial organization of the
Arabidopsis root. Cell 86, 423-33.
Guo Y, Qiu QS, Quintero FJ, Pardo JM, Ohta M, Zhang C, Schumaker KS, Zhu JK.
2004. Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical
requirement for its kinase activity and C-terminal regulatory domain for salt tolerance in
Arabidopsis thaliana. Plant Cell 16(2),435-49.
Hardie DG. 1999. Roles of the AMP-activated/SNF1 protein kinase family in the
response to cellular stress. Biochem Soc Symp 64,13-27.
Helariutta, Y., Fukaki, H., Wysocka-Diller, J., Nakajima, K., Jung, J., Sena, G.,
Hauser, M. T. and Benfey, P. N. 2000. The SHORT-ROOT gene controls radial
patterning of the Arabidopsis root through radial signaling. Cell 101, 555-67.
Knight, H., Trewavas, A. J. and Knight, M. R. 1997. Calcium signalling in
Arabidopsis thaliana responding to drought and salinity. Plant J 12, 1067-78.
Lee, S., Cheng, H., King, K. E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N. P.
and Peng, J. 2002. Gibberellin regulates Arabidopsis seed germination via RGL2, a
GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev
16, 646-58.
Levesque MP, Vernoux T, Busch W, Cui H, Wang JY, Blilou I, Hassan H, Nakajima
K, Matsumoto N, Lohmann JU, Scheres B, Benfey PN. 2006. Whole-genome analysis
of the SHORT-ROOT developmental pathway in Arabidopsis. PLoS Biol 4(5), 0739-52.
125
Liu J, Zhu JK. 1998. A calcium sensor homolog required for plant salt tolerance.
Science 280(5371), 1943-5.
Nakajima K, Sena G, Nawy T, Benfey PN. 2001. Intercellular movement of the
putative transcription factor SHR in root patterning. Nature 413(6853), 307-11.
Pysh, L. D., Wysocka-Diller, J. W., Camilleri, C., Bouchez, D. and Benfey, P. N.
1999. The GRAS gene family in Arabidopsis: sequence characterization and basic
expression analysis of the SCARECROW-LIKE genes. Plant J 18, 111-9.
Quintero FJ, Ohta M, Shi H, Zhu JK, Pardo JM. 2002. Reconstitution in yeast of the
Arabidopsis SOS signaling pathway for Na+ homeostasis. Proc Natl Acad Sci 99(13),
9061-6.
Shi, H., Ishitani, M., Kim, C. and Zhu, J.-K. 2000. The Arabidopsis thaliana salt
tolerance gene SOS1 encodes a putative Na+/H+ antiporter. PNAS 97, 6896-6901.
Steudle E. 2000. Water uptake by roots: effects of water deficit. J Exp Bot 51(350),1531-
42.
Valliyodan B, Nguyen HT. 2006. Understanding regulatory networks and engineering
for enhanced drought tolerance in plants. Curr Opin Plant Biol 9(2),89-95.
Wu SJ, Ding L, Zhu JK. 1996. SOS1, a Genetic Locus Essential for Salt Tolerance and
Potassium Acquisition. Plant Cell 8, 617-627.
Wysocka-Diller JW, Helariutta Y, Fukaki H, Malamy JE, Benfey PN. 2000.
Molecular analysis of SCARECROW function reveals a radial patterning mechanism
common to root and shoot. Development 127, 595-603.
126
Xiong, L., Ishitani, M., Lee, H. and Zhu, J.-K. 2001. The Arabidopsis LOS5/ABA3
Locus Encodes a Molybdenum Cofactor Sulfurase and Modulates Cold Stress- and
Osmotic Stress-Responsive Gene Expression. Plant Cell 13, 2063-2083.
Xiong, L., Lee, H., Ishitani, M. and Zhu, J.-K. 2002a. Regulation of Osmotic Stress-
responsive Gene Expression by the LOS6/ABA1 Locus in Arabidopsis. J. Biol. Chem.
277, 8588-8596.
Xiong, L., Lee, H., Ishitani, M. and Zhu, J. K. 2002b. Regulation of osmotic stress-
responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. J Biol Chem 277,
8588-96.
Zentella R, Zhang ZL, Park M, Thomas SG, Endo A, Murase K, Fleet CM,
Jikumaru Y, Nambara E, Kamiya Y, Sun TP. 2007 Global analysis of della direct
targets in early gibberellin signaling in Arabidopsis. Plant Cell 19(10), 3037-57.
Zhu, J. K. 2002. Salt and drought stress signal transduction in plants. Annu Rev Plant
Biol 53, 247-73.
Zhu JK, Liu J, Xiong L. 1998 Genetic analysis of salt tolerance in arabidopsis.
Evidence for a critical role of potassium nutrition. Plant Cell 10(7), 1181-91.
127
Fig. 1A. Three root phenotypes of seedlings from heterozygous scl3-1. 12-day seedlings
grown on 120mM NaCl are shown for each phenotype category. Phenotype 1: shortest
root seedlings; Phenotype 2: intermediate root seedlings; Phenotype 3: WT length root
seedlings.
128
Fig. 1B. The root growth of two potentially heterozygous scl3-1 lines (scl3-D and scl3-E)
12 day seedlings on 120 mM NaCl.
Phenotype 1: scl3-1 seedlings with phenotype of salt sensitivity.
Phenotype 2: scl3-1 seedlings partially sensitive to salt.
Phenotype 3: scl3-1 seedlings have the same phenotype as WT.
0
0.5
1
1.5
2
2.5
scl3-D scl3-E
mutant lines
Ro
ot
L
en
gt
h
(cm
)
phenotype 1
phenotype 2
phenotype 3
129
Fig. 1C. Comparison of representative WT, scl3-2 and scl3-3 mutant 12-day seedlings on
control and 120mM NaCl plates
130
Fig. 2A. Schematic representation of SCL3 locus. 1. The entire transcription unit is
shown. The number s indicated positions in mRNA. The box represents the coding region
of SCL3. The T-DNA insertion sites are indicated by the open triangles. Arrowheads
denote positions and orientation of primers used for PCR reactions that yielded
amplification products in at least on DNA sample.
131
Fig. 2B. PCR diagnostic tests for the presence of T-DNA in scl3-1 line. Scl3-1 DNA s
from phenotype 1 and phenotype 3 we used. PCR reactions were performed using
scl3F/scl3R, scl3F/LBb and scl3R/LBb primers, respectively.
a. scl3-1 with phenotype 3 (WT looking)
b. scl3-1 with phenotype 1
132
Fig. 2C. Truncated protein translated from scl3-1 mutant
133
Fig. 2D. PCR diagnostic tests for scl3-2 and scl3-3 plants. For the detection of wild-type
SCL3 and mutated scl3-2, scl3-3 alleles, PCR reactions were performed using
scl3F/scl3R, scl3F/LBb and scl3R/LBb primers, respectively.
134
Fig. 3A. Induction of gene expression by salt. mRNA levels in 10 day WT roots imbibed
in 200mM NaCl / mRNA levels in roots imbibed in H2O alone at 4oC for 12 hours
0
2
4
6
8
10
12
14
16
SOS1 SOS2 SOS3 SCL3 SCR SHR
Re
la
ti
ve
m
RN
A
le
ve
ls
Ws
Ler
Col
n
135
Fig. 3B. Real time PCR. mRNA levels in 10 day mutant roots/ mRNA levels in 10 day
WT roots imbibed in H2O at 4oC for 12 hours. X-axis shows names of genes, Y-axis
shows the genes relative mRNA levels in mutant roots.
0
0.5
1
1.5
2
2.5
3
SOS1 SOS2 SOS3 SCL3 SCR SHR
Re
la
tiv
e
m
RN
A
le
ve
ls
shr1
scr1
scl3-1
136
Fig. 3C. mRNA levels in 10 day mutant roots/ mRNA levels in 10 day WT roots imbibed
in 200mM NaCl at 4oC for 12 hours. X-axis shows names of genes, Y-axis shows the
genes relative mRNA levels in mutant roots.
0
2
4
6
8
10
12
14
SOS1 SOS2 SOS3 SCL3 SCR SHR
Re
la
tiv
e
m
RN
A
le
ve
ls
shr1
scr1
scl3-1
137
Fig. 4A. Time course of WT and scl3 mutant seed germination on 0.5MS or 0.5MS
containing 200mM NaCl. Points on the Z-axis are in days after transfer of plates to the
growth chamber.
2d
3d
5d
6d
7d
Col (0m
M)scl3-1(0
mM)Col (20
0mM)scl3-1(2
00mM)
0
20
40
60
80
100
Ge
rm
in
ati
on
(%
)
138
Fig. 4B. Percentage of WT and mutants seeds germination on 0.5MS or 0.5MS
containing 200mM NaCl at day 7 after transfer of plates to the growth chamber.
0
20
40
60
80
100
Ws scr1 shr1
Ge
rm
in
ati
on
(%
)
139
Fig. 5. Proposed model for interactions between SOS signaling pathway and
transcriptional regulators in GRAS family under salt stress.
140
VI. CONCLUSIONS
My dissertation research focused on several genes in phytohormones pathways
and GRAS family are involved in sugars and salt stress effect on plant development. The
major results of my project are described in the following:
In the glucose effect on seed germination project:
1. Glucose can delay seed germination through a different pathway from sugars
such as mannose.
2. The effect of glucose delay on seed germination is via genes RGl2 and SPY in
GA signaling pathway and ABI3 in ABA signaling pathway.
3. ABI3 and RGL2 may act via the same pathway in glucose delay of seed
germination.
4. Glucose, applied after germination, has a strong stimulatory effect on seedling
growth and development. This effect is partially mediated via activation of GA and/or
inactivation of cytokinin signaling pathways by relieving the inhibitory or the stimulatory
effect of a key regulator, SPY.
5. Exogenous glucose in moderate concentrations has opposite effects on plant
growth and development depending on the developmental stage during which it is applied.
The inhibitory and stimulatory effects of glucose are at least in part mediated via
components of ABA and GA signaling pathways.
141
In salt stress effect on seed germination and early seedling development project:
1. Salt delays germination by activating the ABA signaling pathway via ABI3 and
ABI5 and repressing the GA signaling pathway via RGL2.
2. The crosstalk and interactions exist among the different regulatory genes and
pathways. There are cross talks between the ABA and GA signaling pathways and that
ABI3, ABI5 and RGL2 gene products are involved in this process.
3. Abi3, abi5 and rgl2 mutants are resistant to osmotic pressure during the seed
germination. It indicates that both ABA signaling pathway via ABI3 and ABI5 and GA
signaling pathway via RGL2 are involved in osmotic sensing during the seed germination.
4. The functions of ABI genes are different during early seedling development.
ABI5 but not ABI3 may act as a negative regulator of ABA signaling pathway to adjust
the ion cell balance during early seedling stage.
5. Both ABA signaling pathway via ABI3 and ABI5 and GA signaling pathways
via RGL2 are involved in the early seedling tolerance to osmotic stress.
6. Genes in the ABA signaling pathway showed the different functions during the
different stages of plant growth under salt stress. abi3 mutant seedlings are sensitive to
the salt stress but abi5 mutant seedlings are similar as the WT seedling under the salt
treatment.
In the GRAS family gene function project:
1. scl3 mutant alleles are salt hypersensitive both during germination and also
during seedling growth.
142
2. SCR and SHR genes in GRAS family are involved in the salt inhibition of seed
germination.
3. Salt stress inhibits root growth by inducing SHR and SCR gene expression at
the transcriptional level directly or indirectly or both, which in turn down-regulate SOS1,
SOS2 and SOS3 gene expressions. This results in down-regulation of SOS pathway via
components in SOS pathway.
4. SCL3 expression seems to be down-regulated by SHR. In addition, SCL3 up-
regulates SOS1 expression. SCL3 mediates salt tolerance by increasing SOS1
transcription.
It is the first time that the function of SCL3 gene in GRAS family has been
identified under the stress condition. The function of SHR and SCR genes under the stress
condition is a unique finding in this report. The crosstalk among phytohormones, glucose
and salt signaling pathways via several genes has been discussed. Different genes in the
different signaling pathways have different effect on different stages of plant growth.
The future work is still needed because of the complexity of the network among various
pathways.
Publications of my dissertation research:
Kun Yuan and Joanna Wysocka-Diller. 2006. Phytohormone signaling pathways interact
with sugars during seed germination and seedling development. Journal of Experimental
Botany 57(12): 3359-67.