EFFECT OF DIFFERENT ATMOSPHERES FOR ISOLATION, MOLECULAR 
CHARACTERIZATION, PATHOGENICITY GENE SCREENING, 
AND CONTROL OF CAMPYLOBACTER SPP. FROM 
PROCESSED BROILER MEAT 
 
Except where reference is made to the work of others, the work described in this 
dissertation is my own or was done in collaboration with my advisory  
committee. This dissertation does not include proprietary  
or classified information. 
 
 
       
Syeda Kauser Hussain 
 
 
Certificate of Approval: 
 
 
______________________ 
Joseph J. Giambrone 
Professor 
Poultry Science 
 
 
______________________ 
Mark R. Liles  
Assistant Professor 
Biological Sciences 
 
______________________  
Omar A. Oyarzabal, Chair  
Associate Professor 
Poultry Science 
 
 
______________________ 
Dawn M. Boothe 
Professor  
Anatomy, Physiology, and 
Pharmacology
 
 
______________________ 
George T. Flowers 
Dean 
Graduate School 
 
  
EFFECT OF DIFFERENT ATMOSPHERES FOR ISOLATION, MOLECULAR 
CHARACTERIZATION, PATHOGENICITY GENE SCREENING, 
AND CONTROL OF CAMPYLOBACTER SPP. FROM 
PROCESSED BROILER MEAT 
 
Syeda Kauser Hussain 
 
 
A Dissertation 
Submitted to 
the Graduate Faculty of 
Auburn University 
in Partial Fulfillment of the  
Requirements for the  
Degree of  
Doctor of Philosophy  
 
Auburn, Alabama 
May 9, 2009
 
 
iii 
 
EFFECT OF DIFFERENT ATMOSPHERES FOR ISOLATION, MOLECULAR 
CHARACTERIZATION, PATHOGENICITY GENE SCREENING, 
AND CONTROL OF CAMPYLOBACTER SPP. FROM 
PROCESSED BROILER MEAT 
 
 
Syeda Kauser Hussain 
 
 
Permission is granted to Auburn University to make copies of this dissertation at its 
discretion, upon request of individuals or institutions and at their expense.  
The author reserves all publication rights. 
 
 
 
 
 
 
 
     
       Signature of Author 
 
 
 
     
        Date of Graduation 
 
 
iv 
 
VITA 
 
 
Kauser (Syeda) Hussain, daughter of Dr. Syed Madoom Hussain and Shahzadi 
Hussain; older sister of Aquila Hussain was born on the 18th of August, 1979, in the city 
of Hyderabad, in the state of Andhra Pradesh, India. She graduated with a Bachelor of 
Science degree from Osmania University in June, 1999. She pursued her studies to attain 
her Master of Science degree in May, 2001 from the Department of Genetics, Osmania 
University. She earned the Council of Scientific and Industrial Research ? Junior 
Research Fellow scholarship in June 2001 and subsequently the Senior Research Fellow 
scholarship in October 2003. She worked as a Research Fellow in the E.coli genetics lab 
of Dr. J. Gowrishankar at the Center for DNA Fingerprinting and Diagnostics, Hyderabad 
for three years. Motivated by her sister?s move for further studies to the United States of 
America, she decided to continue pursuing a research career in the USA. In 2004 she 
joined the Pseudomonas laboratory of Dr. Sang-Jin Suh as a Graduate Teaching Assistant 
at Auburn University, AL. In 2005, she joined the Microbiology lab of Dr. Omar 
Oyarzabal at the Department of Poultry Science, Auburn, Alabama as a Graduate 
Research Assistant to pursue her Ph.D.degree. She wishes to continue research in the 
fields of Microbiology, Genetics and Molecular Biology. 
 
 
 
v 
 
DISSERTATION ABSTRACT 
 
EFFECT OF DIFFERENT ATMOSPHERES FOR ISOLATION, MOLECULAR 
CHARACTERIZATION, PATHOGENICITY GENE SCREENING, 
AND CONTROL OF CAMPYLOBACTER SPP. FROM 
PROCESSED BROILER MEAT 
 
Syeda Kauser Hussain 
 
Doctor of Philosophy ? May 9, 2009 
(Senior Research Fellow, Center for DNA Fingerprinting and Diagnostics ? 2004) 
(Master of Science, Osmania University ? 2001) 
(Bachelor of Science, Osmania University ? 1999) 
 
188 Typed Pages 
Directed by Omar A. Oyarzabal 
Our first experiments involved the studies of the effects of Oxyrase?, an enzyme 
based membrane system that selectively reduces oxygen from the medium, during the 
growth and isolation of Campylobacter spp. The effect of Oxyrase was tested without 
adding the microaerobic gas mixture for Bolton broth and an agar plate medium 
(modified Campy-Cefex). Based on chi-square analysis, no significant difference was 
found between enrichment broth cultured under microerobic conditions and enrichment 
broth that had Oxyrase.
 
   
vi 
Comparison between plate media, however, showed that plates supplemented 
with Oxyrase had the lowest recovery rate (P < 0.05). The percentage of similar group of 
organisms after denaturing gradient gel electrophoresis (DGGE) analysis was 85% and of 
the different group of organisms was 15%. The analysis of Campylobacter isolates 
collected from broth with and without Oxyrase for restriction fragment length 
polymorphism (RFLP) showed similar band patterns for some strains and different band 
patterns for other strains. 
The second set of experiment examined if incubation under microaerobic 
conditions was indispensable for Campylobacter spp. to grow in Bolton broth. These 
experiments were also done with naturally contaminated broiler meat. Microscopy results 
from the two enrichment broth media showed no difference between the sub-samples for 
the growth and isolation of Campylobacter (chi square = 0.21). These results suggest that 
retail broiler meat enriched in Bolton broth may not need the addition of microaerobic 
gas mix for Campylobacter to multiply. DGGE showed the presence of different 
microbial niches in both the broth media. RFLP analysis showed band similarity for some 
samples and band differences for others. 
The third set of studies involved the molecular characterization of Campylobacter 
strains from carcasses rinses from four commercial processing plants. Three plants (A, B 
and C) had similar percentages of Campylobacter positive carcass rinses: 78%, 78% and 
62%, respectively. Plant D, however, showed the lowest percentage (33%) of 
Campylobacter positive carcasses. The mean log CFU/ml was similar for all the four 
plants and was less than 1 CFU/ml. Pulsed-field gel electrophoresis (PFGE) analysis  
 
 
 
vii 
 
revealed a considerable diversity in the band patterns among the isolates when the rinse 
of a single broiler carcass was direct-plated on different plate media. These results 
confirmed the presence of more than one strain of Campylobacter spp. on a single 
carcass. Campylobacter coli from different plants showed similar PFGE patterns. 
Next set of studies involved the screening of C. jejuni isolates for the presence of 
pathogenecity genes. Multiplex PCR assays were used to test for the presence of flhB, 
flagellar protein biosynthesis and export gene; flgB, flagellar basal body protein synthesis 
gene; flgE2, flagellar hook protein gene; docA, colonization and infectivity gene; and 
cdtA, a gene whose product makes the eukaryotic cells to be blocked in either G2 or early 
M phase. Multiplex PCR assays were successfully designed for the following gene 
combinations, fliM and docA; flgE2, cdtA and flhB; and cadF and flgB. Thirty-six C. 
jejuni isolates from one processing plant were positive for the presence of flhB, flgB, 
flgE2 and cdtA genes, but were negative for docA gene. However, 58 C. jejuni isolates 
from another poultry processing plant were positive for all these genes, including docA.  
 In the last set of experiments, the effects of lemon based marinades were studied. 
Retail poultry meat positive for the presence of Campylobacter was used in these studies. 
The marinades that were used for the study included mesquite, baja chipotle, herb and 
garlic and real lemon. In inoculation trials, reduction in numbers of Campylobacter at the 
end of marination in combination with refrigeration at 0.5 h 6 h and 24 h were observed. 
In the case of naturally occurring Campylobacters on retail broiler meat, there was 
significant reduction in their numbers with all the marinades (baja chipotle, herb and 
garlic and real lemon) when marinated for 4 h under refrigeration was performed.
 
   
viii 
ACKNOWLEDGEMENTS 
 
 I take this opportunity to express my gratitude to Dr. Omar Oyarzabal, who has 
been a mentor, and a great guide, during my research work over the past four years. 
 Special thanks to my committee members Dr. Joseph Giambrone, Dr. Mark Liles, 
and Dr. Dawn Boothe for their help and counsel that helped me finish my research. I 
would also like to thank Dr. Tung-Shi Huang for reviewing my dissertation.  
 Special thanks to Dr. J. Gowrishankar for being a great advisor during my 
research at Center for DNA Fingerprinting and Diagnostic, India. I sincerely appreciate 
Dr. Sang-Jin Suh, whose efforts played an important role in my admission into the 
Auburn University. I would like to thank my laboratory colleagues for all the help and 
support and for making the lab a great place to work.  
 Huge thanks to all my friends especially Karthik, for his innovative ideas and 
awesome company, Lin for the fun coffee and shopping breaks, and Larissa for the 
combined group studying.  
 Most importantly I would like to thank God Almighty for making all of this 
happen. I dedicate my dissertation and my Doctor of Philosophy degree to my Dad, my 
Mom, and my little Sister who have been my constant inspiration. I couldn?t thank them 
enough for their unconditional love, patience, support, and encouragement. 
 
 
ix 
 
Style manual or journal used: Journal of Food Protection 
Computer software used: Microsoft Office 2007? 
 
 
x 
 
TABLE OF CONTENTS 
LIST OF TABLES ?????????????????????? ????. xiii  
LIST OF FIGURES ??????????????????????????. xv  
CHAPTER I: INTRODUCTION ?????????????????????.. 1  
CHAPTER II: LITERATURE REVIEW ...????.????????.???...?. . 5 
2.1 The History of Campylobacter ??????????????? ?.. .6 
2.2 Campylobacter ? General Description ? ????????????. ...6 
2.3 Campylobacter and Food ? Campylobacteriosis ????? ???? ... 7 
2.4 Campylobacter ? Virulence Determinants ????????????. 8 
2.5 Campylobacter Enrichment and Growth Conditions ???????... 1 1 
2.6 Oxyrase ?????????????????????????  12 
2.7 Detection and Characterization by Various Molecular Techniques ? ? 13 
2.8 Marination of Meat for Control of Campylobacter spp ??????..  20 
2.9       Summary of the results from this study ????????????... 21  
CHAPTER III: EVALUATION OF OXYRASE? FOR THE ISOLATION OF 
CAMPYLOBACTER SPP. FROM RETAIL BROILER MEAT 
3.1 Introduction ? ?????????????????????? .. 44 
3.2 Materials and Methods ???????????????????. 46 
3.3 Results ????????????????...???????? ... 50 
3.4 Discussion ????????????????????????  51 
 
   
xi 
CHAPTER IV: MICROBIOLOGICAL AND MOLECULAR METHODS 
EVALUATION OF ENRICHMENT MEDIA WITHOUT THE 
MICROAEROBIC GAS MIXTURE FOR GROWTH OF  
CAMPYLOBACTER SPP. 
4.1 Introduction ??????????????????????? .. 66 
4.2 Materials and Methods ???????????????????. 67 
4.3 Results and discussion ?????????????????? ?.  71 
CHAPTER V: ENUMERATION, PREVALENCE AND PULSED-FIELD GEL  
ELECTROPHORESIS ANALYSIS OF CAMPYLOBACTER ISOLATES 
OBTAINED FROM COMMERCIAL BROILER CARCASSES 
5.1 Introduction ??????????????????????? .. 84 
5.2 Materials and Methods ??????????????????... .. 86 
5.3 Results ????????????????????????? .. 87 
5.4 Discussion ??????????????????????? ? 89 
CHAPTER VI: MULTIPLEX POLYMERASE CHAIN REACTION ASSAYS FOR  
SCREENING VIRULENCE GENES OF CAMPYLOBACTER JEJUNI 
ISOLATED FROM PROCESSED BROILERS 
6.1 Introduction ???????????????????????  109 
6.2 Materials and Methods ??????????????????...  111 
6.3 Results ????????????????????????? 113 
6.4 Discussion ??????????????????????? .. 115 
 
   
xii 
CHAPTER VII: REDUCTION OF CAMPYLOBACTER JEJUNI AND 
CAMPYLOBACTER COLI ON RETAIL BROILER MEAT BY COMMERCIAL, 
LEMON-BASED MARINADES 
7.1 Introduction ????????????????????.?? ... 128 
7.2 Materials and Methods ?????????????????? ... 130 
7.3 Results ?????????????????????????  135 
7.4 Discussion ???????????????????????..  137 
DISSERTATION CONCLUSIONS ??????????????????? .. 149 
BIBLIOGRAPHY ???????????????????????? ?.. ?  151 
 
 
   
xiii 
LIST OF TABLES 
Table 2.1. Phenotypic and Biochemical tests for detection of Campylobacter .......  35 
Table 2.2. Composition of different plate media  ?????????.? .?? ?3 6 
Table 2.3. Advantages and disadvantages of various genotyping methods? ........... 37 
Table 2.4. New and old set of multiplex PCR primers ?? ????????. ?  38 
Table 3.1. Plate media, mCC (Bolton) vs mCC (Bolton Oxyrase) ............................57 
Table 3.2. Plate media, mCC vs mCC + Bolton Oxyrase in an OxyDish ????.5 8 
Table 3.3. Plate media, mCC vs mCC + Bolton Oxyrase in a Petri Plate .................59 
Table 3.4. Results after BLAST analysis of the sequences? ????????? 60 
Table 4.1. Bolton Broth with microaerobic gas vs without gas mix ??..?? ?...  76 
Table 4.2. Results after BLAST analysis of the sequences ????? ????.. 77 
Table 5.1. Primer sets used in the multiplex PCR for confirmation ??????. 97 
Table 5.2. Counts and prevalence (%) of Campylobacter spp. per plant ???..... 98 
Table 5.3. Campylobacter positive samples organized by plant ...........................? 9 9 
Table 6.1. Primer sets used in the mPCR for detection of virulence genes ???. 121 
Table 6.2. Thermocycler conditions for 30 cycles?????????????12 2 
Table 6.3. Primer pairs that can be used in a various mPCRs ?? ?????? 123 
Table 6.4.  Campylobacter strains isolated from poultry processing plants ???.1 24 
Table 6.5.        Campylobacter isolated from poultry processing plants-Puerto Rico.....125 
Table 7.1. Reduction of C. jejuni numbers under different marinades ???...? 144 
 
   
xiv 
Table 7.2. Reduction of C. jejuni and C. coli numbers on different marinades?? 145 
Table 7.3. Detection of naturally occurring Campylobacter spp. in retail meat .?.14 6 
Table 7.4. pH of the different marinades and the retail broiler meat ?????.. 147 
 
   
xv 
 
LIST OF FIGURES 
Figure 2.1. The movement of C. jejuni in the environment ??. ???????.   39 
Figure 2.2. Depiction C. jejuni virulence determinants ???????????. 40 
Figure 2.3. Cytochrome electron transport system (ETC) ? ????????... .. 41 
Figure 2.4. Principle of Pulsed-Field Gel Electrophoresis ????????....... .. 42 
Figure 2.5. Flow diagram ? Denaturing Gradient Gel Electrophoresis procedure ..... 43 
Figure 3.1 DGGE band patterns ????????????????? ??? 61 
Figure 3.2        Dendrogram ? Pearson?s correlation???????????? ?.... 62  
Figure 3.3        Dendrogram ? Dice?s correlation????????????.??.... 63  
Figure 3.4. Multiplex PCR results ??????????????????... ... 64 
Figure 3.5. RFLP gel picture ????????????????????.. ? 65 
Figure 4.1. Flow Chart ? Experimental procedure ????????????... .. 78 
Figure 4.2. DGGE band patterns ????????????????????.7 9 
Figure 4.3        Dendrogram ? Pearson?s correlation?????????????.... 80 
Figure 4.4        Dendrogram ? Dice?s correlation?????????? ????..... 81  
Figure 4.5. Multiplex PCR results ????????????????...??? 82 
Figure 4.6. RFLP gel picture ???????.??????????????..8 3 
Figure 5.1. Average count of Campylobacter spp.,single/ combination plating ?. ..100 
Figure 5.2. Multiplex PCR for confirmation of Campylobacter spp?????? .101 
Figure 5.3. C. coli strains from different poultry production plants??????..10 2 
 
   
xvi 
Figure 5.4. Same poultry production plant but different plate comparison??..? 10 3 
Figure 5.5. Same carcass different plate comparison????? ???????.10 4 
Figure 5.6. PFGE data analysis using the BioNumerics software??????... .. 105 
Figure 5.7. Dendrogram-subset of Campylobacter jejuni ???????? ? .... 106 
Figure 5.8. Dendrogram-subset of C.  jejuni isolated on various plate media ? ..?10 7 
Figure 5.9. Dendrogram-subset of Campylobacter coli ?????????? ?10 8 
Figure 6.1. Multiplex PCR for the screening of virulence genes-237 Line ??..? 126 
Figure 6.2. Multiplex PCR showing unspecific amplification ..???????? 127 
Figure 7.1. PFGE profiles of C. jejuni and C. coli ????? ????????148  
 
 
 
1 
CHAPTER I: INTRODUCTION 
 
Campylobacter jejuni and Campylobacter coli are Gram negative, motile bacteria 
that multiply under microaerobic conditions. Campylobacteriosis is a common intestinal 
disorder in humans, and the infection is endemic worldwide, with highest incidence of 
this disease in summer. In the U.S., over 2.5 million persons are estimated to be affected 
annually. Nearly 80% of these infections are due to food-borne transmission (Mead et al., 
1999). The reservoirs of Campylobacter spp. are domestic and wild animals. Outbreaks 
of campylobacteriosis can be caused by the handling and consumption of uncooked 
poultry meat, although the largest outbreaks have been associated with contaminated 
water and unpasteurized milk (Fahey et al., 1995; Palmer et al., 1983; Vogt et al., 1982; 
Vogt et al., 1984) . Thus, the most important way to control campylobacteriosis depends 
on the prevention of the transmission from animal reservoirs to humans. 
It is also very important to differentiate the strains in order to identify the source 
of contamination and to determine routes of transmission. This valuable information is 
useful to accurately detect outbreaks and control Campylobacter infections. Various 
molecular typing techniques, such as pulsed-field gel electrophoresis (PFGE) (Michaud 
et al., 2001; Yan et al., 1991), multi locus sequence typing (MLST) (Dingle et al., 2001), 
and restriction fragment length polymorphism (RFLP) (Harrington et al., 2003; 
Nachamkin et al., 1993), have been used to assess the genomic variations of 
Campylobacter spp.
 
 
 
2 
There is also a need to develop a quick method for screening the presence or 
absence of Campylobacter spp. that may carry pathogen city genes and that may be of 
higher concern for food safety. The polymerase chain reaction (PCR) technique is a quick 
method that can be used to identify an isolate and to screen for the presence of pathogen 
city genes. 
Campylobacter spp. require low oxygen concentrations, which has been estimated 
to be approximately 5%. This is usually achieved by replacing the atmosphere within the 
enrichment broth or the plate media with a gas mix consisting of 5% O2, 10% CO2, and 
85% N2 (Veron and Chatelain, 1973; Kiggins and Plastridge, 1956). However, there is no 
current information of how high the oxygen concentration should be for campylobacters 
to grow and to isolate them from retail broiler meat. 
 The main reason for the use of marinades is to tenderize the meat. The 
antibacterial effects, as preservatives of the food to extend shelf life, are thus secondary 
functions. It is because of their low pH, high NaCl concentration, and various spices that 
marinades may have an antimicrobial effect (Perko-Makela, 2000). Few studies have 
assessed the effects of marination on the survival of C. jejuni on broiler meat stored at 
4oC (Perko-Makela, 2000).   
 
The objectives of our studies were: 
a) Evaluation of Oxyrase? for the isolation of Campylobacter spp. from retail broiler 
meat and microbial population analysis of enrichment media by denaturing 
gradient gel electrophoresis (DDGE) and Campylobacter strain comparison using 
restriction fragment length polymorphism (RFLP). 
 
 
 
3 
b) Evaluation of enrichment media without the microaerobic gas mixture for 
isolation of Campylobacter spp. from retail broiler meat. 
c) Comparison of Campylobacter spp. prevalence in commercial processing plants 
and molecular characterization of isolates using pulsed-field gel electrophoresis 
(PFGE) analysis. 
d) Development of multiplex polymerase chain reaction (mPCR) assays for the 
screening of virulence genes of C. jejuni isolated from processed broilers. 
e) Evaluation of the efficacy of commercial, lemon-based marinades for the 
reduction of C. jejuni and C. coli on retail broiler meat. 
 
 
 
 
4 
References 
 
Dingle, K. E., F. M. Colles, D. R. Wareing & other authors. 2001. Multilocus sequence 
typing system for Campylobacter jejuni. J. Clin. Microbiol. 39: 14-23. 
Fahey, T., D. Morgan, C. Gunneburg, G. K. Adak, F. Majid, and E. Kaczmarski. 1995. 
An outbreak of Campylobacter jejuni enteritis associated with failed milk 
pasteurisation. J. Infect. 31: 137-143. 
Mead, P. S., L. Slutsker, V. Dietz, L. F. Mccaig, J. S. Bresee, C. Shapiro, P. M. Griffin, 
and R. V. Tauxe. 1999. Food-related illness and death in the United States. 
Emerg. Infect. Dis. 5: 607-625. 
Michaud, S., R. D. Arbeit, and C. Gaudreau. 2001. Molecular strain typing of 
Campylobacter jejuni by pulsed-field gel electrophoresis in a single day. Can. J. 
Microbiol. 47: 667-669. 
Palmer, S. R., P. R. Gully, J. M. White, A. D. Pearson, W. G. Suckling, D. M. Jones, J. C. 
Rawes, and J. L. Penner. 1983. Water-borne outbreak of Campylobacter 
gastroenteritis. Lancet 1: 287-290. 
Perko-Makela, P., M. Koljonen, M. Mietttnen, and M. Hannien. 2000. Survival of 
Campylobacter jejuni in marinated and non-marinated chicken products. Journal 
of Food Safety 20: 209-216. 
Vogt, R. L., H. E. Sours, T. Barrett, R. A. Feldman, R. J. Dickinson, and L. Witherell. 
1982. Campylobacter enteritis associated with contaminated water. Ann. Intern. 
Med. 96: 292-296.
 
 
 
5 
Vogt, R. L., A. A. Little, C. M. Patton, T. J. Barrett, and L. A. Orciari. 1984. Serotyping 
and serology studies of campylobacteriosis associated with consumption of raw 
milk. J. Clin. Microbiol. 20: 998-1000. 
Yan, W., N. Chang, and D. E. Taylor. 1991. Pulsed-field gel electrophoresis of 
Campylobacter jejuni and Campylobacter coli genomic DNA and its 
epidemiologic application. J. Infect. Dis. 163: 1068-1072. 
 
 
 
 
 
6 
CHAPTER II: LITERATURE REVIEW 
 
2.1. The History of Campylobacter 
Theodor Escherich observed and described non-culturable spiral-shaped bacteria 
in 1886 (Escherich, 1989).  The very first successful isolation of Campylobacter was 
done around the beginning of this century. McFadyean and Stockman in 1913 isolated 
Vibrio-like bacteria from aborted ovine fetuses (McFadyean, 1913) and proposed the 
name Vibrio fetus (Smith, 1919). Vinzent and coworkers in the late 1940s described V. 
fetus strains isolated from blood cultures from women who underwent abortions 
(Vinzent, 1949; Vinzent, 1947). Later Florent in 1959 showed two similar vibrios caused 
fertility problems in cows and ewes (Florent, 1957). Today these two similar vibrios are 
known as Campylobacter fetus subsp. venerealis and Campylobacter fetus subsp. fetus. In 
1963 Sebald and Veron proposed a new genus, Campylobacter came into being (Sebald 
& Veron, 1963). Ten years after that Veron and Chatelain published a taxonomy 
describing four distinct species in the genus Campylobacter: Campylobacter fetus, 
Campylobacter jejuni, Campylobacter coli and Campylobacter sputorum (Veron, 1973). 
 
2.2. Campylobacter ? General Description 
The phylum Protobacteria, class Epsilonproteobacteria, order 
Campylobacterales, family Campylobacteraceae, genus Campylobacter includes 18 
species and sub-species. 
 
 
 
7 
The different species and sub-species can be identified by various phenotypic and 
biochemical tests (Table 2.1). 
The Campylobacteraceae family members consist primarily of commensals or 
parasites in domestic animals and humans. Campylobacter is known to colonize the 
gastrointestinal tracts of a variety of host species like birds and other meat producing 
animals like pig and cattle. Campylobacter is a part of the normal gut flora in many 
animals. Though some of them are commensals C. jejuni and C. coli are pathogens of 
humans and some of the domestic animals. Campylobacter is a thermotolerant spiral, S-
shaped, gram negative, non-spore forming rod. It is 0.2 to 0.8 ?m wide and 0.5 to 5 ?m 
long. It has a single polar unsheathed flagellum at one or on either ends of the cell which 
facilitates in its typical corkscrew movement. Old cultures usually form spherical or 
coccoid bodies. They are slow growing microaerobic organisms that require the oxygen 
concentration to be 5% to grow. It takes around 24 ? 48 h at 42oC for them to grow. They 
are intolerant to freezing and drying. 
The genome size is 1.6 ? 1.7 Mb except in the case of C.upsaliensis where it is 
2.0Mb. The G-C content is around 30%  (Owen, 1981) .  Extrachromosomal elements 
like bacteriophages and plasmids have been found in Campylobacter spp. (Bacon et al., 
2000; Bradbury et al., 1983) 
 
2.3. Campylobacter and Food ? Campylobacteriosis  
C. jejuni and C. coli are the major causes of the diarrheal disease 
campylobacteriosis which is acute bacterial enteritis. In United States an estimated 2.4 
million cases of campylobacteriosis per year are recorded (Allos & Blaser, 1995; Allos, 
 
 
 
8 
2001; Altekruse et al., 1999). Infections are higher in summer and early fall in 
comparison to the rest of the year (Allos & Blaser, 1995). C. jejuni infections are seen in 
all age groups but infants and young adults seem more susceptible (Allos & Blaser, 
1995). Symptoms include cramps and abdominal pain, diarrhea, malaise, myalgia, 
headache, fever, and/or the presence of blood and leukocytes in stool. Patients range from 
asymptomatic to severely ill and the symptoms last several days to more than a week.  
Campylobacteriosis is principally a food borne disease (Figure 2.1) and is spread 
by handling and consumption of contaminated poultry meat (Butzler & Oosterom, 1991). 
Campylobacter infections are sporadic events, while some of the larger outbreaks have 
been associated with consumption of unpasteurized milk and/ or contaminated water 
(Fahey et al., 1995; Vogt et al., 1982; Vogt et al., 1984).  
Long term infections of C. jejuni lead to Guillian-Barre? syndrome (GBS) 
(Nachamkin et al., 1998), an acute demyelinating polyneuropathy. Guillian, Barre?, and 
Strohl in 1961 first described this syndrome defined by flaccid paralysis (Guillain, 1916).  
GBS is an autoimmune-mediated disorder of the peripheral nervous system. This 
condition leads to rapid muscle weakness which leads to weakness of limbs and of the 
respiratory muscles.  
 
2.4. Campylobacter ? Virulence Determinants 
 Campylobacter virulence determinants and their role in disease is one of the 
subjects important to research. The availability of the whole genome sequence of 
Campylobacter (Parkhill et al., 2000) and the development of new ways to genetically 
manipulate this organism (Golden et al., 2000) have contributed a lot to understanding 
 
 
 
9 
virulence factors and their role in causing the disease (Figure 2.2). Some of the important 
factors are discussed below: 
 
Flagella and Motility 
 The ability of campylobacter to be a motile bacterium because of the presence of 
a polar flagellum plays an important role in its colonization and subsequently its disease 
causing ability. The C. jejuni flagellum is made of a basal body, hook, and filament. Both 
in Campylobacter jejuni and Campylobacter coli  the flagellar filament is comprised of 
FlaA and FlaB proteins. Studies have shown that the flaA (Nuijten et al., 1990; Nuijten et 
al., 1991) is expressed at much greater levels than flab (Hendrixson et al., 2001). 
Wassenaar et al. in there studies found that Campylobacter expressing flaA gene 
facilitated maximal colonization (Wassenaar et al., 1993). Other researchers have also 
shown that motility is important and promotes colonization of Campylobacter jejuni in 
animal hosts (Nachamkin et al., 1993; Pavlovskis et al., 1991). In another study it was 
observed that the flagellar structure played an essential role in internalization process of 
C. jejuni and it was independent of motility (Grant et al., 1993). 
 
Adhesins and Adherence 
 Molecules that are surface exposed and that facilitate a pathogen?s attachment to 
the host cell receptors are called adhesins. C. jejuni has been found to synthesize 
adhesins. Some studies showed C. jejuni binding to cultured cells at levels comparable to 
metabolically active organisms (Konkel & Cieplak, 1992). Four outer membrane proteins 
(omps) playing an important role in mediating C. jejuni binding to host cells using 
 
 
 
10 
ligand-binding assay with molecular masses of 28, 32, 36, and 42 kDa were identified by 
De Melo and Pechere (de Melo & Pechere, 1990). The 28 kDa omp, was termed as PEB1 
and mediates the binding of C. jejuni to epithelial cells (Pei et al., 1998). A 37 kDa omp 
from C. jejuni was cloned and partially characterized by Konkel et al (Konkel et al., 
1997). This is termed as CadF, and it mediates the binding of C. jejuni to fibronectin (Fn) 
which is a component of extracellular matrix of the host cell. Studies have shown that 
CadF is conserved among all C. jejuni and C. coli isolated tested to date (Konkel et al., 
1999a).  
 
Secretion 
 Campylobacter invasion antigens (Cia proteins) are a set of proteins secreted by 
Campylobacter jejuni. To date only one secreted protein CiaB has been completely 
identified (Konkel et al., 1999b). The ciaB gene encodes a protein of mass 73 kDa. 
Confocal microscopic studies of C. jejuni-infected cells have shown the translocation of 
CiaB protein into the host cell cytoplasm. Some preliminary studies by Konkel et al have 
shown that Cia proteins may be secreted via the flagellar type III secretion apparatus.   
 
Cytolethal Distending Toxin (CDT) 
 Johnson and Lior in 1988 first reported the production of CDT by Campylobacter 
isolates. CDT is produced by number of Campylobacter strains like C. jejuni, C. coli, C. 
lari, C. fetus, and C. upsaliensis (Johnson & Lior, 1988; Mooney et al., 2001). Actively 
proliferation eukaryotic cells die when treated with CDT. Variable sensitivity to CDT in 
different cell lines has been reported, which may be because of differences in their 
 
 
 
11 
surface receptors (Pickett & Whitehouse, 1999). The CDT toxin was first cloned by 
Pickett et al (Pickett et al., 1996). The toxin was found to be encoded by three adjacent 
genes, cdtA, cdtB, cdtC (Pickett et al., 1996). CDT is heat-labile and sensitive to trypsin 
treatment (Johnson & Lior, 1988). Even though CdtB is the active subunit of the toxin 
(Lara-Tejero & Galan, 2000) all the three components of the toxin are important for its 
activity and delivery (Hickey et al., 2000; Lara-Tejero & Galan, 2001). The effects of 
CDT on a eukaryotic cell are as follows, progressive cell distention by causing cells to 
irreversibly arrest in G2/M phase of cell cycle; CDT prevents the dephosphorylation of 
CDC2 which is a catalytic subunit of the cyclin-dependent kinase which causes the cells 
to arrest in G2 phase (Lara-Tejero & Galan, 2000; Whitehouse et al., 1998). 
 
2.5. Campylobacter Enrichment and Growth Conditions 
 The presence of other bacteria in a sample is always a competition for 
Campylobacter spp. which is a fastidious, slow growing organism that require complex 
media to grow (Corry et al., 1995). That is why it is important to include an enrichment 
step when trying to isolate Campylobacter from a sample that contains other micro-
organisms. Most of the Campylobacter species require a microaerobic atmosphere 
containing approximately 5% O2, 10% CO2, and 85% N2 for optimal recovery. 
 Several types of liquid enrichment media have been developed for isolation of 
Campylobacter from poultry meat (Corry et al., 1995; Doyle, 1981; Hunt, 2001) . 
Typically enrichment broths are composed of rich, basal medium, such as Brucella broth 
or nutrient broth (Bolton & Robertson, 1982; Corry et al., 1995), antimicrobials, and 
addition of lysed horse or sheep blood. Buffered Peptone Water (BPW) the recommended 
 
 
 
12 
medium by U. S. Department of Agriculture Food Safety and Inspection Services for 
collection of microbiological samples from broiler carcasses with rinse method 
(Anonymous, 1996) has been successfully used as an enrichment medium for isolation of 
campylobacter from retail broiler samples (Oyarzabal et al., 2007). 
 Primary plating on selective media in combination with a filtration method is the 
optional method for recovering Campylobacter species from food, environmental and 
clinical samples. To isolate C.jejuni and C.coli a number of selective media are 
recommended  (Table 2.2) which include the blood-containing Skirrow medium, the 
Campylobacter-cefoperazone-vancomycin-amphotericin (CVA) medium, the blood-free 
charcoal cefoperazone deoxycholate agar (CCDA), charcoal based selective medium 
(CSM). Most of these selective media have one or more antimicrobial agents, mainly 
cefoperazone, as the primary inhibitor of enteric bacterial flora. The incubation 
temperature is usually 42oC; this allows the growth of C.jejuni and C.coli on selective 
media. Campylobacter spp. produce grey, flat, irregular, swarming colonies, on freshly 
prepared plate media. 
 
2.6. Oxyrase 
 Several oxygen-quenching agents are traditionally added to agar plates for the 
isolation of Campylobacter spp. These agents neutralize the toxic effects of oxygen 
radicals, and include blood or alkaline hematin (Border et al., 1974) charcoal 
(Hutchinson & Bolton, 1984), iron salts and norepinephrine to brucella agar (Bowdre et 
al., 1976) and ferrous sulfate, sodium metabisulfite, and sodium pyruvate (FBP 
supplement) (George et al., 1978), among others. Oxyrase?, an enzyme system that 
 
 
 
13 
selectively removes oxygen from its surrounding environment, has also been tested for 
the isolation of Campylobacter spp. from food samples that have been artificially 
inoculated with Campylobacter (Wonglumsom et al., 2001). This enzyme is a sterile 
suspension of Escherichia coli membrane fragments and functions as an oxygen 
scavenger (Adler et al., 1981) in liquid and solid media. The cytochrome electron 
transport system located within the cytoplasmic membrane appears to be responsible for 
the oxygen-quenching activities of the membranes fragment (Schnaitman, 1970); (Adler 
et al., 1981). The Oxygen combines with the protons in the matrix of the mitochondrion 
and gets reduced to water (Figure 2.3). 
 
2.7. Detection and Characterization by Various Molecular Techniques  
At both the phenotypic and genotypic levels the diversity within species of 
Campylobacter has been well defined. The widely employed phenotypic classification 
method is serotyping. The two accepted and well-established methods are the Penner 
scheme (Penner & Hennessy, 1980) which is a passive hemagglutination technique based 
on heat-stable (HS) antigens and the Lior scheme which is based on bacterial 
agglutination of of heat-labile antigens (Lior et al., 1982). High numbers of untypeable 
strains, time consuming protocol and the cost has prevented the use of the above 
serological methods. 
Molecular identification methods exploit the DNA sequences which are 
conserved and specific to that particular species. These methods are quick, very 
discriminative and reliable, hence these days they have taken over most of the traditional 
methods of detection and identification. There are plenty of molecular methods available, 
 
 
 
14 
but some of them are advantageous over others, (Table 2.3) sometimes some methods are 
cheaper than the other. Hence, depending on a lab?s resources and requirements some 
methods are preferred over the others. 
 
Multiplex Polymerase Chain Reaction (mPCR) 
Multiplex PCR is similar to PCR except that there are more than one pair of 
primers in the reaction mixture. The very first use of PCR was to amplify the number of 
copies of a specific region of DNA, in order to produce enough DNA to be adequately 
tested. A PCR reaction mix is made up of one set primers (forward and reverse), a 
thermostable DNA polymerase the DNA template to be amplified and synthetic 
oligonucleotides. Usually, at least a million-fold increase of a specific section of a DNA 
molecule can be achieved in a single PCR reaction. The basic PCR reaction involves a 
denaturation step, annealing step and an elongation step, these three steps are repeated 
30-40 times to get the desired amplification. 
An example of multiplex PCR primers (Table 2.4): primers specific to the cadF 
gene region, for Campylobacter genus identification; primers specific to an unidentified 
gene for C. jejuni identification; and primers specific to ceuE gene for C.coli 
identification (Cloak & Fratamico, 2002) . A second multiplex reaction (Table 2.3) 
consists primers for 16S rDNA gene for Campylobacter genus, hippuricase gene primers 
for C. jejuni and aspartokinase gene primers for C. coli identification respectively 
(Oyarzabal et al., 2005) . Both the above multiplex reactions have been successfully used 
to identify Campylobacter genus, and C. jejuni, C. coli species. 
  
 
 
 
15 
In recent years, PCR has been successfully applied to detect Campylobacter spp. 
in water, dairy products, and diarrheic samples (Linton et al., 1997). PCR can be used to 
not only detect but also to differentiate various Campylobacter species (Al Rashid et al., 
2000; Oyarzabal et al., 1997). It has been proven to be one of the quick and discrete 
methods for species and genus identification (Oyarzabal et al., 2007). This technique 
allows the detection not only of viable bacteria but also of the non-culturable forms of 
Campylobacter.  In the case of Campylobacter specific sequences like fragments of 16S 
or 23S rRNA genes and their intervening sequences, or parts of regions of the flagellin 
genes (fla) or part of gene encoding binding-protein-dependent transport system for 
sidephore enterochelin (ceuE) (Gonzalez et al., 1997) can be targets for species 
identification. For example, PCR primers specific to16S rRNA gene or 23S rRNA gene 
(Eyers et al., 1993) are used to detect Campylobacter, primers specific to hippuricase 
(HipO) gene are be used to detect C. jejuni, primers specific to the enterochelin uptake 
system (ceuE) gene are used for detection of C. coli. 
 
Pulsed-Field Gel Electrophoresis (PFGE) 
One of the significant advances in technology related to mapping of genomes of 
organisms over the past 25 years has been Pulsed-Field Gel Electrophoresis (PFGE). The 
new way to separate large fragments of DNA, PFGE was 1st introduced by Schwartz and 
Cantor in 1984 (Schwartz & Cantor, 1984). Conventional electrophoresis, a well 
established technique by the early 1970?s permits the separation of DNA fragments up to 
30kbp, thus fragments greater than 40-50kbp which are important for whole genome 
analysis or genome mapping cannot be separated. The ability of this technique to resolve 
 
 
 
16 
DNA fragments ranging from 6000kb (Gardiner, 1991) to very large fragments with size 
limit to over 10,000kb (10Mb). That?s why it is often considered the "gold standard" of 
molecular typing methods. 
PFGE is one of the most discriminating methods for sub-typing Campylobacter 
spp. (Michaud et al., 2001; On et al., 1998; Yan et al., 1991). It can be used to establish 
the degree of relatedness among different strains of the same species based on the DNA 
band patterns at the end of the elecrophoresis gel run. 
PFGE works by periodically altering the electric field orientation. The large 
extended coiled DNA fragments are forced to change orientation and size dependent 
separation is re-established because the time taken for the DNA to reorient is size 
dependent (Figure 2.4). Two factors that influence DNA migration rates through 
conventional gels are charge differences between DNA fragments & ?molecular sieve? 
effect of DNA pores. 
For PFGE, bacterial isolates grown, either in broth or on solid media are 
combined with molten agarose and poured into small molds. The results are agarose plugs 
containing the whole bacteria. The embedded bacteria are then subjected to in situ 
detergent-enzyme lysis and digestion with an infrequently cutting restriction enzyme. The 
digested bacterial plugs are then inserted into an agarose gel and subjected to 
electrophoresis in an apparatus in which the polarity of the current is changed at 
predetermined intervals. The pulsed field allows clear separation of DNAs from a few 
kilobases (kb) to over 10 megabase pairs (Mb).  
 
 
 
17 
The electrophoretic patterns are visualized following staining of the gels with a 
fluorescent dye such as ethidium bromide. Gel results can be photographed, and the data 
can be stored by using one of the commercially available digital systems. 
For subtyping of Campylobacter spp. PFGE is one of the most discriminatory 
method currently available (On et al., 1998). The PulseNet, the National Molecular 
SUbtyping Network for Foodborne Diseases, Center for Disease Control and Prevention 
(CDC), in 1996 introduced a system where standardized PFGE protocols by PulseNet 
were used to compare DNA fingerprints of various pathogens between different 
laboratories. A protocol has also been developed for molecular sub-typing 
Campylobacter jejuni and other Campylobacter species (Ribot et al., 2001). 
One of the factors that have limited the use of PFGE is the time involved in 
completing the analysis. While the procedural steps are straightforward, the time needed 
to complete the procedure can be 2 to 3 days. This can reduce the laboratory's ability to 
analyze large numbers of samples. 
 
Restriction Fragment Length Polymorphism (RFLP) 
Restriction Fragment Length Polymorphism (RFLP) is a molecular technique in 
which organisms may be differentiated by analysis of patterns derived from restriction of 
their DNA. If two organisms differ in the distance between sites of restriction of a 
particular restriction endonuclease, the length of the fragments produced will differ when 
the DNA is digested with a restriction enzyme. The similarity of the patterns generated 
can be used to differentiate species (and even strains) from one another. The regions 
amplified are usually between 150-3,000 base pairs in length. The slight differences 
 
 
 
18 
between organisms of different species sometimes can cause the addition or removal of a 
restriction endonuclease recognition site. DNA can be processed by RFLP either directly 
or by using PCR product. 
In the case of Campylobacter the restriction fragment length polymorphism of an 
amplified segment of the flaA gene (PCR-RFLP) is a common approach (Harrington et 
al., 2003; Nachamkin et al., 1993), when one is looking for polymorphisms within the 
same PFGE patterns, or the strains that fail to give a PFGE pattern. Methodology 
includes PCR amplification, restriction of the amplicons with DdeI and separation of 
different fragments on the agarose gel and then analysis. 
Some advantages of RFLP are, results are consistent and can be used for future 
comparison work and it is relative easy to perform. Limitations are its less sensitive in 
phylogenetic resolution (in comparison to sequencing). 
 
Denaturing Gradient Gel Eectrophoresis (DGGE) 
Denaturing Gradient Gel Electrophoresis (DGGE) is a powerful genetic analysis 
technique that can be used for detecting single base changes and polymorphisms in 
genomic, cloned, and PCR amplified DNA. It is an important genetic fingerprinting 
technique used when there is a need to separate individual sequences from a complex 
mixture. It is one of the fast molecular sub-typing methods which facilitates separation of 
equal lengths of DNA fragments that have differences in base sequences (Myers et al., 
1985; Orita et al., 1989). The DGGE technique was originally formulated for detecting 
DNA polymorphisms and single base changes. In the present day DGGE has evolved to 
become a very important molecular tool in the area of microbial ecology. It is useful for 
 
 
 
19 
analyzing and characterize a bacterial community (Dabert et al., 2001; Muyzer & Smalla, 
1998; Simpson et al., 1999). It is also useful to subtype bacterial species within a large 
population (Bennasar et al., 1998; Farnleitner et al., 2000a; Farnleitner et al., 2000b; 
Manzano et al., 1997). DGGE is particularly advantageous when a metagenomic 
approach is used to determine the population of microorganisms that are difficult to 
culture. 
The basic principle of DGGE is the electrophoretic separation of amplified PCR 
products of equal length in a sequence specific way. The sequence-specific separation of 
DNA molecule of similar size is based on melting temperature Tm of the double stranded 
(ds) DNA (Figure 2.5).  
The DGGE gel is made up of a denaturing gradient consisting of varying 
concentrations of urea and formamide. Thus when the double stranded DNA is exposed 
to the increasing denaturant environment it melts in distinct segments, called the melting 
domains. The Tm of individual domains is sequence specific and is based on the G-C 
content of that DNA molecule. Thus in the presence of a denaturing environment a DNA 
molecule may have different melting domains determined by the nucleotide sequence.  
The mobility of the DNA molecules is slowed down at the point where DNA strands 
dissociate forming a partially single stranded molecule with no further movement in the 
gel. The GC clamp that is artificially incorporated during the amplification step of the 
sample of interest before the DGGE gel run prevents the complete denaturation of the 
DNA strands thus creating a ?Y? structured molecule (Myers et al., 1985). This branched 
molecule sharply reduces the mobility in a polyacrylamide gel. 
 
 
 
20 
Universal primers 338 F, containing the G + C clamp at its 5? end, and 518R are 
commonly used for the amplification of the 16S rRNA gene (Muyzer et al., 1993; 
Sheffield et al., 1989). The amplicon size is around 180 bases long. Subtyping of C. 
jejuni and C. coli without culturing the sample has been done using DGGE. A variable 
region of approximately 170-210 base pairs from the 3V end of flaA to the 3V end of the 
intergenic region that separates the tandemely oriented flaA and flaB genes was used 
(Studer E., 1998). 
Applications of DGGE include a rapid and effective method for screening 
samples for genetic mutations and variantions. Also, DNA fragment melting points can 
be determined using perpendicular DGGE. Denaturing gradient gels are used to detect 
non-RFLP polymorphisms. Limitations of this technique are it?s not easy to work with 
and works well only for short (<500 bp) fragments of DNA. 
 
2.8. Marination of Meat for Control of Campylobacter spp. 
 Marination is an age old method used to preserve foods. Various organic acid 
based marinades have been in use to prevent the growth of microorganisms in meat 
products. Applying marinade to meat or poultry enhances its flavor (Chen, 1982), 
increases its moisture retention and tenderness (Ang, 1987), preserves its color (Cassidy, 
1977), and inhibits the warmed over flavor (Mahon, 1963). The spices and extracts that 
are added to the marinades also have preservative and antioxidant properties which are 
antifungal, antibacterial and antiviral (Farag, 1989; Larrondo, 1995). The antibacterial 
activity is based on low pH, high NaCl concentration, and various spices added to the 
marinade (Perko-Makela, 2000). If the marination of meat is done for a long time there 
 
 
 
21 
may be a possibility in reduction in its antimicrobial activity. Some researchers have 
concluded that the buffering capability of meat may neutralize the acidic marinade and 
thus the marinade may become less acidic and less antimicrobial (Bjorkroth et al., 2005). 
In one of the studies (Perko-Makela, 2000) of effects of marination on Campylobacter 
jejuni, the survival of C. jejuni on marinated chicken drumsticks and sliced breasts strips 
stored at 4oC was studied. There was no significant difference in C. jejuni numbers in 
between the marinated and non-marinated chicken meat. The marinade that was used was 
an emulsion of vegetable oil, water, spices and salt. 
 
 
 
 
 
 
 
22 
References 
 
Adler, H. I., A. Carrasco, W. Crow, and J. S. Gill. 1981. Cytoplasmic membrane fraction 
that promotes septation in an Escherichia coli lon mutant. J. Bacteriol. 147: 326- 
332. 
Al Rashid, S. T., I. Dakuna, H. Louie, D. Ng, P. Vandamme, W. Johnson, and V. L. 
Chan. 2000. Identification of Campylobacter jejuni, C. coli, C. lari, C. 
 upsaliensis, Arcobacter butzleri, and A. butzleri-like species based on the glyA 
 gene. J. Clin. Microbiol. 38: 1488-1494. 
Allos, B. M., and M. J. Blaser. 1995. Campylobacter jejuni and the expanding spectrum 
of related infections. Clin. Infect. Dis. 20: 1092-1099; quiz 1100-1091. 
Allos, B. M. 2001. Campylobacter jejuni Infections: update on emerging issues and 
trends. Clin. Infect. Dis. 32: 1201-1206. 
Altekruse, S. F., N. J. Stern, P. I. Fields, and D. L. Swerdlow. 1999. Campylobacter 
jejuni-an emerging foodborne pathogen. Emerg. Infect. Dis. 5: 28-35. 
Ang, C. Y. W., and L. L. Young. 1987. Effect of marination with sodium pyrophosphate 
solution on oxidative stability of frozen cooked broiler leg meat. Poultry Science. 
 66: 676-678. 
Anonymous (1996). Pathogen reduction: hazard analysis and critical control point 
(HACCP) systems. 
Bacon, D. J., R. A. Alm, D. H. Burr, L. Hu, D. J. Kopecko, C. P. Ewing, T. J. Trust, and 
P. Guerry. 2000. Involvement of a plasmid in virulence of Campylobacter jejuni 
 81-176. Infect. Immun. 68: 4384-4390. 
 
 
 
23 
Bennasar, A., C. Guasp, M. Tesar, and J. Lalucat. 1998. Genetic relationships among 
Pseudomonas stutzeri strains based on molecular typing methods. J. Appl. 
 Microbiol. 85: 643-656. 
Bjorkroth, J., M. Ristiniemi, P. Vandamme, and H. Korkeala. 2005. Enterococcus species 
dominating in fresh modified-atmosphere-packaged, marinated broiler legs are 
 overgrown by Carnobacterium and Lactobacillus species during storage at 6 
 degrees C. Int. J. Food Microbiol. 97: 267-276. 
Bolton, F. J., and L. Robertson. 1982. A selective medium for isolating Campylobacter 
jejuni / coli. J. Clin. Pathol. 35: 462-467. 
Border, M. M., B. D. Firehammer, and L. L. Myers. 1974. Tube culture method for viable 
counts of Campylobacter fetus (Vibrio fetus). Appl. Microbiol. 28: 730-732. 
Bowdre, J. H., N. R. Krieg, P. S. Hoffman, and R. M. Smibert. 1976. Stimulatory effect 
of dihydroxyphenyl compounds on the aerotolerance of Spirillum volutans and 
Campylobacter fetus subspecies jejuni. Appl. Environ. Microbiol. 31: 127-133. 
Bradbury, W. C., M. A. Marko, J. N. Hennessy, and J. L. Penner. 1983. Occurrence of 
plasmid DNA in serologically defined strains of Campylobacter jejuni and 
Campylobacter coli. Infect. Immun. 40: 460-463. 
Butzler, J. P., and J. Oosterom. 1991. Campylobacter: pathogenicity and significance in 
foods. Int. J. Food Microbiol. 12: 1-8. 
Cassidy, J. P. 1977. Phosphates in meat processing. Food Prod. Dev. 11: 74-77. 
Chen, T. C. 1982. Studies on the marination of chicken parts for deep fat frying. Journal 
of Food Science. 47: 1016-1019. 
 
 
 
24 
Cloak, O. M., and P. M. Fratamico. 2002. A multiplex polymerase chain reaction for the 
differentiation of Campylobacter jejuni and Campylobacter coli from a swine 
 processing facility and characterization of isolates by pulsed-field gel 
 electrophoresis and antibiotic resistance profiles. J. Food Prot. 65: 266-273. 
Corry, J. E., D. E. Post, P. Colin, and M. J. Laisney. 1995. Culture media for the isolation 
of campylobacters. Int. J. Food Microbiol. 26: 43-76. 
Dabert, P., B. Sialve, J. P. Delgenes, R. Moletta, and J. J. Godon. 2001. Characterization 
of the microbial 16S rDNA diversity of an aerobic phosphorus-removal 
 ecosystem and monitoring of its transition to nitrate respiration. Appl. Microbiol. 
 Biotechnol. 55: 500-509. 
De Melo, M. A., and J. C. Pechere. 1990. Identification of Campylobacter jejuni surface 
proteins that bind to Eukaryotic cells in vitro. Infect. Immun. 58: 1749-1756. 
Doyle, M. P., and D. J. Roman. 1981. Growth and survival of Campylobacter fetus 
subsp. jejuni as a function of temperature and of pH. J. Food Prot. 44: 596-601. 
Ercolini, D. 2004. PCR-DGGE fingerprinting: novel strategies for detection of microbes 
in food. J. Microbiol. Methods 56: 297-314. 
Escherich, T. 1989. The intestinal bacteria of the neonate and breast-fed infant. 1885. 
Rev. Infect. Dis. 11: 352-356. 
Eyers, M., S. Chapelle, G. Van Camp, H. Goossens, and R. De Wachter. 1993. 
Discrimination among thermophilic Campylobacter species by polymerase chain 
 reaction amplification of 23S rRNA gene fragments. J. Clin. Microbiol. 31: 
 3340-3343. 
 
 
 
25 
Fahey, T., D. Morgan, C. Gunneburg, G. K. Adak, F. Majid, and E. Kaczmarski. 1995. 
An outbreak of Campylobacter jejuni enteritis associated with failed milk 
 pasteurisation. J. Infect. 31: 137-143. 
Farag, R. S., Z. Y. Daw, and S. H. Abo-Rays. 1989. Influence of some essential oils on 
Aspergillus parasiticus growth and production of aflatoxin in a synthetic medium. 
 Journal of Food Science. 54: 74-76. 
Farnleitner, A. H., N. Kreuzinger, G. G. Kavka, S. Grillenberger, J. Rath, and R. L. 
Mach. 2000a. Simultaneous detection and differentiation of Escherichia coli  
populations from environmental freshwaters by means of sequence variations in a  
fragment of the beta-D-glucuronidase gene. Appl. Environ. Microbiol. 66: 1340- 
1346. 
Farnleitner, A. H., N. Kreuzinger, G. G. Kavka, S. Grillenberger, J. Rath, and R. L. 
Mach. 2000b. Comparative analysis of denaturing gradient gel electrophoresis  
and temporal temperature gradient gel electrophoresis in separating Escherichia  
coli uidA amplicons differing in single base substitutions. Lett. Appl. Microbiol. 
 30: 427-431. 
Florent, A. 1957. [Analogical characteristics of certain strains of Vibrio coli and Vibrio 
fetus; bovine intestinal adapation of V. coli.]. C. R. Seances Soc. Biol. Fil. 151: 
1055-1057. 
Gardiner, K. 1991. Pulsed field gel electrophoresis. Anal. Chem. 63: 658-665. 
George, H. A., P. S. Hoffman, R. M. Smibert, and N. R. Krieg. 1978. Improved media for 
growth and aerotolerance of Campylobacter fetus. J. Clin. Microbiol. 8: 36-41. 
 
 
 
26 
Golden, N. J., A. Camilli, and D. W. Acheson. 2000. Random transposon mutagenesis of 
Campylobacter jejuni. Infect. Immun. 68: 5450-5453. 
Gonzalez, I., K. A. Grant, P. T. Richardson, S. F. Park, and M. D. Collins. 1997. Specific 
identification of the enteropathogens Campylobacter jejuni and Campylobacter 
 coli by using a PCR test based on the ceuE gene encoding a putative virulence 
 determinant. J. Clin. Microbiol. 35: 759-763. 
Grant, C. C., M. E. Konkel, W. Cieplak, Jr., and L. S. Tompkins. 1993. Role of flagella in 
adherence, internalization, and translocation of Campylobacter jejuni in 
 nonpolarized and polarized epithelial cell cultures. Infect. Immun. 61: 1764-1771. 
Guillain, G., G. Barre', and A. Strohl. 1916. Sur un syndrome de radiculonebrite avec 
hyperalbuminose du liquide cephalo-rachidien sans reaction cellulaire. Remarques 
 sur les caracters cliniques et graphiques des reflexes tendineux. Bull. Soc. Med. 
 Hop. Paris 40: 1462. 
Harrington, C. S., L. Moran, A. M. Ridley, D. G. Newell, and R. H. Madden. 2003. Inter- 
laboratory evaluation of three flagellin PCR/RFLP methods for typing 
 Campylobacter jejuni and C. coli: the CAMPYNET experience. J. Appl. 
 Microbiol. 95: 1321-1333. 
Hendrixson, D. R., B. J. Akerley, and V. J. Dirita. 2001. Transposon mutagenesis of 
Campylobacter jejuni identifies a bipartite energy taxis system required for 
 motility. Mol. Microbiol. 40: 214-224. 
 
 
 
27 
Hickey, T. E., A. L. Mcveigh, D. A. Scott, R. E. Michielutti, A. Bixby, S. A. Carroll, A. 
L. Bourgeois, and P. Guerry. 2000. Campylobacter jejuni cytolethal distending 
 toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect. 
 Immun. 68: 6535-6541. 
Hunt, J. M., C. Abeyta, and T. Tran. 2001. Isolation of Campylobacter species from food 
and water. Chapter 7. In: Food and Drug Administration Bacteriological 
 Analytical Manual, 8th ed, Revision A/1998. Association of Official Chemists 
 International, Arlington, VA. edn. 
Hutchinson, D. N., and F. J. Bolton. 1984. Improved blood free selective medium for the 
isolation of Campylobacter jejuni from fecal specimens. J. Clin. Pathol. 37: 956- 
957. 
Johnson, W. M., and H. Lior. 1988. A new heat-labile cytolethal distending toxin 
(CLDT) produced by Campylobacter spp. Microb. Pathog. 4: 115-126. 
Konkel, M. E., and W. Cieplak, Jr. 1992. Altered synthetic response of Campylobacter 
jejuni to co cultivation with human epithelial cells is associated with enhanced 
 internalization. Infect. Immun. 60: 4945-4949. 
Konkel, M. E., S. G. Garvis, S. L. Tipton, D. E. Anderson, Jr., and W. Cieplak, Jr. 1997. 
Identification and molecular cloning of a gene encoding a fibronectin-binding 
 protein (CadF) from Campylobacter jejuni. Mol. Microbiol. 24: 953-963. 
Konkel, M. E., S. A. Gray, B. J. Kim, S. G. Garvis, and J. Yoon. 1999a. Identification of 
the enteropathogens Campylobacter jejuni and Campylobacter coli based on the 
 cadF virulence gene and its product. J. Clin. Microbiol. 37: 510-517. 
 
 
 
28 
Konkel, M. E., B. J. Kim, V. Rivera-Amill, and S. G. Garvis. 1999b. Bacterial secreted 
proteins are required for the internaliztion of Campylobacter jejuni into cultured 
 mammalian cells. Mol. Microbiol. 32: 691-701. 
Konkel, M. E., M. R. Monteville, V. Rivera-Amill, and L. A. Joens. 2001. The 
pathogenesis of Campylobacter jejuni-mediated enteritis. Curr Issues Intest 
 Microbiol 2: 55-71. 
Lara-Tejero, M., and J. E. Galan. 2000. A bacterial toxin that controls cell cycle 
progression as a deoxyribonuclease I-like protein. Science 290: 354-357. 
Lara-Tejero, M., and J. E. Galan. 2001. CdtA, CdtB, and CdtC form a tripartite complex 
that is required for cytolethal distending toxin activity. Infect. Immun. 69: 4358- 
4365. 
Larrondo, J. V., M. Agut, and M. A. Calvo-Toms. 1995. Antimicrobial activity of 
essences from Labiates. . Microbios. 82: 171-172. 
Linton, D., A. J. Lawson, R. J. Owen, and J. Stanley. 1997. PCR detection, identification 
to species level, and fingerprinting of Campylobacter jejuni and Campylobacter 
 coli direct from diarrheic samples. J. Clin. Microbiol. 35: 2568-2572. 
Lior, H., D. L. Woodward, J. A. Edgar, L. J. Laroche, and P. Gill. 1982. Serotyping of 
Campylobacter jejuni by slide agglutination based on heat-labile antigenic factors. 
 J. Clin. Microbiol. 15: 761-768. 
Mahon, J. H. 1963. U. S. Patent No. 3. 104, 170. Food Tech. 18: 101-102. 
 
 
 
29 
Manzano, M., L. Cocolin, C. Pipan, E. Falasca, G. A. Botta, C. Cantoni, and G. Comi. 
1997. Single-strand conformation polymorphism (SSCP) analysis of Listeria 
 monocytogenes iap gene as tool to detect different serogroups. Mol. Cell. Probes 
 11: 459-462. 
Mcfadyean, J., and S. Stockman. 1913. Report of the departmental committee appointed 
by the board of agriculture and fisheries to enquire into epizootic abortion. 
 Appendix to part II. Abortion in Sheep: 1-64. His Majesty's stationery office, 
 London, United Kingdom. 
Michaud, S., R. D. Arbeit, and C. Gaudreau. 2001. Molecular strain typing of 
Campylobacter jejuni by pulsed-field gel electrophoresis in a single day. Can. J. 
 Microbiol. 47: 667-669. 
Mooney, A., M. Clyne, T. Curran, D. Doherty, B. Kilmartin, and B. Bourke. 2001. 
Campylobacter upsaliensis exerts a cytolethal distending toxin effect on HeLa  
cells and T lymphocytes. Microbiology 147: 735-743. 
Muyzer, G., E. C. De Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial 
populations by denaturing gradient gel electrophoresis analysis of polymerase  
chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol.  
59: 695-700. 
Muyzer, G., and K. Smalla. 1998. Application of denaturing gradient gel electrophoresis 
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial 
 ecology. Antonie Van Leeuwenhoek 73: 127-141. 
 
 
 
30 
Myers, R. M., S. G. Fischer, L. S. Lerman, and T. Maniatis. 1985. Nearly all single base 
substitutions in DNA fragments joined to a GC-clamp can be detected by  
denaturing gradient gel electrophoresis. Nucleic Acids Res 13: 3131-3145. 
Nachamkin, I., K. Bohachick, and C. M. Patton. 1993. Flagellin gene typing of 
Campylobacter jejuni by restriction fragment length polymorphism analysis. J. 
 Clin. Microbiol. 31: 1531-1536. 
Nachamkin, I., B. M. Allos, and T. Ho. 1998. Campylobacter species and Guillain-Barre 
syndrome. Clin. Microbiol. Rev. 11: 555-567. 
Nuijten, P. J., F. J. Van Asten, W. Gaastra, and B. A. Van Der Zeijst. 1990. Structural 
and functional analysis of two Campylobacter jejuni flagellin genes. J. Biol. 
 Chem. 265: 17798-17804. 
Nuijten, P. J., B. A. Van Der Zeijst, and D. G. Newell. 1991. Localization of 
immunogenic regions on the flagellin proteins of Campylobacter jejuni 81116. 
 Infect. Immun. 59: 1100-1105. 
On, S. L., E. M. Nielsen, J. Engberg, and M. Madsen. 1998. Validity of SmaI-defined 
genotypes of Campylobacter jejuni examined by SalI, KpnI, and BamHI 
polymorphisms: evidence of identical clones infecting humans, poultry, and 
cattle. Epidemiol. Infect. 120: 231-237. 
Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya. 1989. Detection of 
polymorphisms of human DNA by gel electrophoresis as single-strand 
 conformation polymorphisms. Proc. Natl. Acad. Sci. U. S. A. 86: 2766-2770. 
 
 
 
31 
Owen, R. J., and S. Leaper. 1981. Base composition, size and nucleotide sequence 
similarities of genome deoxyribonucleic acids from species of the genus 
 Campylobacter. FEMS Microbiol. Lett. 12: 395-400. 
Oyarzabal, O. A., I. V. Wesley, K. M. Harmon, L. Schroeder-Tucker, J. M. Barbaree, L. 
H. Lauerman, S. Backert, and D. E. Conner. 1997. Specific identification of 
Campylobacter fetus by PCR targeting variable regions of the 16S rDNA. Vet. 
 Microbiol. 58: 61-71. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
 rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A. 
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
 isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
 Microbiol. Methods 69: 129-136. 
Parkhill, J., B. W. Wren, K. Mungall & other authors. 2000. The genome sequence of the 
food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. 
 Nature 403: 665-668. 
Pavlovskis, O. R., D. M. Rollins, R. L. Haberberger, Jr., A. E. Green, L. Habash, S. 
Strocko, and R. I. Walker. 1991. Significance of flagella in colonization resistance 
 of rabbits immunized with Campylobacter spp. Infect. Immun. 59: 2259-2264. 
 
 
 
32 
Pei, Z., C. Burucoa, B. Grignon, S. Baqar, X. Z. Huang, D. J. Kopecko, A. L. Bourgeois, 
J. L. Fauchere, and M. J. Blaser. 1998. Mutation in the peb1A locus of 
 Campylobacter jejuni reduces interactions with epithelial cells and intestinal 
 colonization of mice. Infect. Immun. 66: 938-943. 
Penner, J. L., and J. N. Hennessy. 1980. Passive hemagglutination technique for 
serotyping Campylobacter fetus subsp. jejuni on the basis of soluble heat-stable 
 antigens. J. Clin. Microbiol. 12: 732-737. 
Perko-Makela, P., M. Koljonen, M. Mietttnen, and M. Hannien. 2000. Survival of 
Campylobacter jejuni in marinated and non-marinated chicken products. Journal 
 of Food Safety 20: 209-216. 
Pickett, C. L., E. C. Pesci, D. L. Cottle, G. Russell, A. N. Erdem, and H. Zeytin. 1996. 
Prevalence of cytolethal distending toxin production in Campylobacter jejuni and 
 relatedness of Campylobacter spp. cdtB gene. Infect. Immun. 64: 2070-2078. 
Pickett, C. L., and C. A. Whitehouse. 1999. The cytolethal distending toxin family. 
Trends Microbiol. 7: 292-297. 
Ribot, E. M., C. Fitzgerald, K. Kubota, B. Swaminathan, and T. J. Barrett. 2001. Rapid 
pulsed-field gel electrophoresis protocol for subtyping of Campylobacter jejuni. J. 
 Clin. Microbiol. 39: 1889-1894. 
Schnaitman, C. A. 1970. Protein composition of the cell wall and cytoplasmic membrane 
of Escherichia coli. J. Bacteriol. 104: 890-901. 
Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs 
by pulsed field gradient gel electrophoresis. Cell 37: 67-75. 
 
 
 
33 
Sebald, M., and M. Veron. 1963. [Base DNA Content and Classification of Vibrios.]. 
Ann. Inst. Pasteur (Paris). 105: 897-910. 
Sheffield, V. C., D. R. Cox, L. S. Lerman, and R. M. Myers. 1989. Attachment of a 40- 
base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the 
 polymerase chain reaction results in improved detection of single-base changes. 
 Proc. Natl. Acad. Sci. U. S. A. 86: 232-236. 
Simpson, J. M., V. J. Mccracken, B. A. White, H. R. Gaskins, and R. I. Mackie. 1999. 
Application of denaturant gradient gel electrophoresis for the analysis of the 
porcine gastrointestinal microbiota. J. Microbiol. Methods 36: 167-179. 
Smith, T., and M. S. Taylor. 1919. Some morphological and biochemical characters of 
the spirilla (Vibrio fetus n. sp.) associated with disease of the fetal membranes in 
 cattle. J. Exp. Med. 30: 299-312. 
Studer E., B. W., M. Domke, J. Luthy, S. Schmid, and U. Candrian. 1998. RFLP and 
sequence analysis of Campylobacter jejuni and Campylobacter coli products 
 amplified directly from environmental samples. Lebensm, -Wiss. u. Technol. 31: 
 537-545. 
Veron, M., and R. Chatelian. 1973. Taxonomic study of the genus Campylobacter Sebald 
and Veron designation of the neotype strain for the type species Campylobacter 
 fetus (Smith and Taylor) Sebald and Veron. Int. J. Syst. Bacteriol. 23: 122-134. 
Vinzent, R. 1949. Not Available. Presse Med. 57: 1230-1232. 
Vinzent, R., J. Dumas, and N. Picard. 1947. Septicemie grave eu cours de la grossesse, 
due a' un vibrion. Avortement consecutif. C. R. Acad. Med. 131: 90. 
 
 
 
34 
Vogt, R. L., H. E. Sours, T. Barrett, R. A. Feldman, R. J. Dickinson, and L. Witherell. 
1982. Campylobacter enteritis associated with contaminated water. Ann. Intern. 
 Med. 96: 292-296. 
Vogt, R. L., A. A. Little, C. M. Patton, T. J. Barrett, and L. A. Orciari. 1984. Serotyping 
and serology studies of campylobacteriosis associated with consumption of raw 
 milk. J. Clin. Microbiol. 20: 998-1000. 
Wassenaar, T. M., B. A. Van Der Zeijst, R. Ayling, and D. G. Newell. 1993. 
Colonization of chicks by motility mutants of Campylobacter jejuni demonstrates 
 the importance of flagellin A expression. J. Gen. Microbiol. 139 Pt 6: 1171-1175. 
Wassenaar, T. M., and D. G. Newell. 2000. Genotyping of Campylobacter spp. Appl. 
Environ. Microbiol. 66: 1-9. 
Whitehouse, C. A., P. B. Balbo, E. C. Pesci, D. L. Cottle, P. M. Mirabito, and C. L. 
Pickett. 1998. Campylobacter jejuni cytolethal distending toxin causes a G2- 
phase cell cycle block. Infect. Immun. 66: 1934-1940. 
Wonglumsom, W., A. Vishnubhatla, J. M. Kim, and D. Y. Fung. 2001. Enrichment 
media for isolation of Campylobacter jejuni from inoculated ground beef and 
 chicken skin under normal atmosphere. J. Food Prot. 64: 630-634. 
Yan, W., N. Chang, and D. E. Taylor. 1991. Pulsed-field gel electrophoresis of 
Campylobacter jejuni and Campylobacter coli genomic DNA and its 
 epidemiologic application. J. Infect. Dis. 163: 1068-1072. 
 
 
 
 
 
 
35 
Table 2.1. Phenotypic and Biochemical tests for detection of Campylobacter species 
Organism Catalase 
Nitrate 
reducti
on 
Hippura
te 
hydrolys
is 
Indoxyl 
acetate 
hydroly
sis 
Growth at Susceptibility to 
25o
C 
42o
C 
Nalidix
ic acid 
Cephalot
hin 
C.jejuni 
subsp.jeju
ni 
+ + + + - + Sensitive Resistant 
C.jejuni 
subsp. 
doylei 
Variabl
e - Variable + - - 
Sensitiv
e Sensitive 
C.coli + + - + - + Sensitive Resistant 
C.fetus 
subsp.fetus + + - - + - 
Variabl
e Sensitive 
C.lari + + - - - + Resistant Resistant 
C.upsalien
sis Weak + - + - + 
Sensitiv
e Sensitive 
 
 
 
 
 
36 
Table 2.2. Composition of different plate media 
Adaptation from (Oyarzabal et al., 2005) 
 
 
Medium Base Supplements 
Campy-
Cefex 
Brucella agara (43 g/l); ferrous sulfateb 
(0.5 g/l); sodium bisulfiteb (0.2 g/l); 
sodium pyruvateb (0.5 g/l); deionized 
water (1 l). 
Laked horse bloodc (50 ml); 
cefoperazoneb (33 mg); 
cycloheximideb (0.2 g). 
Modified 
Campy-
Cefex 
Brucella agar (43 g/l); ferrous sulfate 
(0.5 g/l); sodium bisulfite (0.2 g/l); 
sodium pyruvate (0.5 g/l); deionized 
water (1 l). 
Lysed horse bloodd (50 ml); 
cefoperazone (33 mg); amphotericin 
Bb (2 mg). 
CAMPY Brucella agar (43 g/l); deionized water (1 l). 
Lysed horse blood (70 ml); 
polymyxin B sulfatee (1 mg); 
trimethoprimb (0.01 g); vancomycinb 
(0.01 g); amphotericine B (2 mg); 
novobiocinb (0.05 g); sodium 
pyruvate (0.25 g); sodium 
metabisulfite (0.25 g); ferrous sulfate 
(0.25 g). 
Modified 
CCDAf 
Nutrient broth No.2 (25 g/l); 
bacteriological charcoal (4 g/l); casein 
hydrolysate (3 g/l); sodium 
desoxycholate (1 g/l); ferrous sulphate 
(0.25 g/l); sodium pyruvate (0.25 g/l); 
agar (12 g/l); deionized water (1 l). 
Cefoperazone (32 mg); amphotericin 
B (10 mg). 
Karmalig 
Columbia agar base (39 g/l); activated 
charcoal (4 g/l); hemin (0.032 g/l); 
deionized water (1 l). 
Sodium pyruvate (100 mg); 
cefoperazone (32 mg); vancomycin 
(20 mg); cycloheximide (100 mg). 
Campy- 
Line 
Brucella agar  (43 g/l); ferrous sulfate 
(0.5 g/l); sodium bisulfite (0.2 g/l); 
sodium pyruvate (0.5 g/l); alpha 
ketoglutaric acidb (1 g/l); sodium 
carbonateb (0.6 g/l); deionized water 
(1 l). 
Heminb (10 mg); polymyxin B 
sulfate (0.35 mg); trimethoprim (5 
mg); vancomycin (10 mg); 
cycloheximide (100 mg); 
cefoperazone (33 mg); 
triphenyltetrazolium chlorideb (200 
mg). 
a Acumedia, Lansing, MI 
b Sigma-Aldrich, St. Louis, MO 
c Oxoid Inc., New York, NY 
d College of Veterinary Medicine, Auburn University. 
e Alexis Corporation, Lausen, Switzerland. 
f Campylobacter Selective Blood Free Agar (CM0739), and CCDA selective supplement 
(SR0155, Oxoid) 
g Campylobacter agar base (CM0935), and Campylobacter selective supplement 
(SR0167, Oxoid) 
 
 
 
37
 
Table 2.3. Advantages and disadvantages of various genotyping methods and serotyping for sub-typing of campyobacters 
Adapted from (Wassenaar & Newell, 2000) 
 
aThe discriminatory power of a method is its ability to differentiated between genetically unrelated strains. 
bTypeability is 100% if all strains tested are typed by a given method. 
cThe reproducibility of a method is determined by its ability to identify duplicate samples. This is irrespective of external 
factors, such as genetic instability. 
dNA, not applicable.  
eWeak serological cross-reactions can complicate interpretation of data. Multiple passages may be required to fully 
express antigens.
Method Discriminatory Powera Typeability (%)b Reproducibilityc 
Sensitivity to 
Genetic 
Instability 
Time 
Required Cost  Availability 
PCR Good 100 Good Most of the times 4 - 5 h Low Good 
fla typing Reasonable 100 Good Yes < 1 day Low Good 
DGGE Very Good 100 Good Yes 3 - 4 days Average Limited 
PFGE Good 100 Good Yes 3 - 4 days Average Limited 
Sequencing Very Good 100 Good NAd 2 - 3 days Average Limited 
Serotyping Average ~80 Goode NA < 1 day Low Limited 
 
 
 
38 
Table 2.4. New and old set of multiplex PCR primers used for genus and species 
identification of Campylobacter 
 
 Primers Sequences (5'-3') 
Tm 
(oC) References 
500 CC18F GGTATGATTTCTACAAAGCGAG 51 Linton et 
al. 1997  CC519R ATAAAAGACTATCGTCGCGTG 50 
344 HipO-F GACTTCGTGCAGATATGGATGCTT 56 Persson 
and Olsen 
2005  HipO-R GCTATAACTATCCGAAGAAGCCATCA 56 
1062 16S-F GGAGGCAGCAGTAGGGAATA 55 Persson 
and Olsen 
2005  16S-R TGACGGGCGGTGAGTACAAG 56 
400 F2B TTGAAGGTAATTTAGATATG 44 Konkel et 
al. 1999  RIB CTAATACCTAAAGTTGAAAC 43 
894 COLI ATGAAAAAATATTTAGTTTTTGCA 54 Gonzalez 
et al. 1997  COL2 ATTTTATTATTTGTAGCAGCG 52 
160 C-I CAAATAAAGTTAGAGGTAGAATGT 51 Winters & 
Slavik 
1995  C-2 GGATAAGCACTAGCTAGCTGAT 55 
 
 
 
 
39 
 
Figure 2.1. The movement of C.jejuni in the environment involves animals, water and 
food. 
Adapted from (Konkel et al., 2001) 
 
 
 
40 
 
 
Figure 2.2. Depiction C.jejuni virulence determinants and their role in development of 
the disease. Adaptation from (Konkel et al., 2001)
 
 
 
41 
 
Figure 2.3. Cytochrome electron transport system (ETC) located in cytoplasmic 
membrane (Adaptation of figure from wikimedia.org) 
 
 
 
H2O 
Matrix 
Intermembrane space  
 
 
 
42 
 
Figure 2.4. Principle of Pulsed-Field Gel Electrophoresis:  Alternating electric current 
is applied to the field to move DNA fragments of 100 -1,000 kb. DNA molecules 
"squirm" through agarose and migrate parallel to the electric field. When the current is 
reversed; it takes more time (T) for large molecules to re-orient than smaller molecules. 
 
 
 
43 
 
  
Figure 2.5. Flow diagram ? Denaturing Gradient Gel Electrophoresis procedure. Adapted 
from (Ercolini, 2004) 
 
Total DNA from  
different species 
Mixture of DNA amplicons from  
different species 
Fingerprint specific  
to the sample 
Microbial species 
identified 
 
 
 
44 
CHAPTER III: EVALUATION OF OXYRASE? FOR THE ISOLATION OF 
CAMPYLOBACTER SPP. FROM RETAIL BROILER MEAT 
 
3.1. Introduction 
Campylobacter is a slow growing, Gram negative bacterium that requires 
microaerobic conditions, usually 5% oxygen, for growth. A standard gas mix containing 
5% oxygen, 10% carbon dioxide and 85% nitrogen mix is commonly used for isolation of 
C. jejuni and C. coli. However, the makeup of the gas mix varies because some 
Campylobacter spp. appear to need hydrogen for growth and some mixes contain seven 
to 10% hydrogen in their compositions (Skirrow, 1991).  
Different methods for the generating of microaerobic environments have been 
successfully used to grow Campylobacter. Some of these methods include the use of 
sachets (Oxoid BR56, Oxoid, UK) that generate carbon dioxide (Sails, 1998). Other 
systems include the evacuation-replacement system (Microbiology International, 
Frederick, MD), and microaerobic workstations (Don Whitley Scientific Ltd., West 
Yorkshire, UK). Gas-generating sachets and the evacuation-replacement systems have 
also been used with success with plastic bags used to freeze food products. In these cases, 
the bags have to have a strong closing system, usually a ?ziplock? type, to prevent air 
from leaking during incubation (Szalanski et al., 2004). 
 
 
 
 
45 
Several oxygen-quenching agents are traditionally added to all selective media to 
improve the isolation of Campylobacter spp. These agents neutralize the toxic effects of 
oxygen radicals and include lysed horse blood, defibrinated blood from various animals 
alkaline hematin ( Corry et al., 1995; Border et al., 1974; Solomon, 1999). Several agar 
media use a combination of ferrous sulfate, sodium metabisulfite and sodium pyruvate as 
oxygen-quenching agents (George et al., 1978). Charcoal and hematin are used in some 
charcoal based agar media (Hutchinson and Bolton, 1984), and iron salts and 
norepinephrine are added to Brucella agar to remove oxygen from the medium (Bowdre 
et al., 1976). 
Oxyrase?, an enzyme system that selectively removes oxygen from its 
surrounding environment, has also been tested for the isolation of Campylobacter spp. 
from inoculated food samples (Wonglumsom et al., 2001). This enzyme is a sterile 
suspension of Escherichia coli membrane fragments and functions as an oxygen 
scavenger in liquid and solid media (Adler et al., 1981). The cytochrome electron 
transport system located within the cytoplasmic membrane appears to be responsible for 
the oxygen-quenching activities of the membranes fragment (Adler et al., 1981; 
Schnaitman, 1970).  
Although this enzyme was tested for the growth of Campylobacter spp. in 
inoculated food samples, there are no publication evaluating the efficacy of Oxyrase 
addition to enrichment and plate media for the isolation of naturally occurring 
Campylobacter spp. in retail broiler meat. In this study we added Oxyrase to Bolton broth 
and to modified Campy-Cefex agar that were used to isolate naturally occurring 
Campylobacter spp. from commercial, retail broiler meat. Presumptive Campylobacter 
 
 
 
46 
spp. were identified with multiplex polymerase chain reaction assays and were analyzed 
using flaA-restriction fragment length polymorphism. In addition, denaturing gradient gel 
electrophoresis analysis was done to determine the microbial composition of Bolton broth 
with and without the addition of Oxyrase. The percentage of similar group of organisms 
growing in both Bolton and Bolton-Oxyrase broths was 85%. 
 
3.2. Materials and Methods 
Sample Preparation 
Retail broiler meat was purchased from local stores. Five to six samples of boneless 
breasts, breast tenders and boneless thighs were purchased per week, from January 2008 
to October 2008, for a total of 131 samples. 
From each individual meat package representing a sample, one inch pieces were cut 
aseptically and thoroughly mixing. Then, 25 g of meat was weighed two times (two 
subsamples) in individual, sterile Whirl-Pak? bags (Nasco, Fort Atkinson, WI). One of 
the sub-samples was enriched by the addition of 100 ml of Bolton?s broth supplemented 
with 5% (v/v) lysed horse blood (Oyarzabal et al., 2007). The other sub-sample was 
enriched with 100 ml Bolton?s broth supplemented with 5% (v/v) lysed horse blood and 
2% of Oxyrase for BrothTM (Oxyrase, Inc. Mansfield, Ohio). This enzyme was added 
after the medium was autoclaved and cooled. Samples were stomached for 1 min and the 
sub-samples enriched in Bolton?s broth were incubated under microaerobic conditions 
(85% nitrogen, 10% carbon oxidize, 5% oxygen; Airgas, Radnor, PA) using anaerobic 
jars gassed with a MACSmics Jar Gassing System (Microbiology International, 
Frederick, MD). The sub-samples containing Bolton?s broth with Oxyrase were not 
 
 
 
47 
gassed with the microerobic mix. These samples were just tightly closed leaving a reduce 
head space in the bags. 
All samples were incubated at 42oC for 48 h. At 24 and 48 h, samples were 
transferred with a  loop (~100 ?l) to modified Campy-Cefex (mCC) (Oyarzabal et al., 
2005) agar plates. To assess the efficacy of the addition of Oxyrase to agar plates for the 
isolation of Campylobacter spp., samples were also transferred to mCC supplemented 
with 10% of Oxyrase for AgarTM (Oxyrase, Inc.) The enzyme was mixed with the 
medium and poured into normal petri dishes (Fisher) and into OxyDishTM (Oxyrase, Inc.) 
plates as suggested by the manufacturer. All the plates, except the mCC plates 
supplemented with Oxyrase and OxyDish with Oxyrase, were incubated under 
microaerobic conditions. All plates were incubated at 42oC for up to 48 h. 
Presumptive Campylobacter colonies were observed under phase contrast microscopy 
(Optiphot-2, Nikon, Tokyo, Japan) for morphology and motility of Campylobacter cells. 
Presumptive isolates were stored at -80oC in tryptic soy broth (Difco, Detroit, MI) 
supplemented with 30% glycerol (v/v) and 5% (v/v) lysed horse blood for further 
analysis. 
 
Identification of Campylobacter Isolates 
Campylobacter isolates were recovered by depositing the stock cultures on a 0.65 
?m cellulose filters (Millipore, Billerica, MA, USA) that was placed on mCC agar plates. 
Plates were incubated for 24 h at 42oC under microaerobic conditions. Bacterial DNA 
was extracted using PrepMan? Ultra sample preparation reagent (Applied Biosystems, 
Foster City, CA).  
 
 
 
48 
All Campylobacter isolates were identified to the species level using two 
multiplex PCR (mPCR) assays described elsewhere (Oyarzabal et al., 2005; Oyarzabal et 
al., 2007). 
 
Subtyping of Campylobacter Isolates 
The restriction fragment length polymorphism of an amplified segment of the 
flaA gene (PCR-RFLP) was carried out as described elsewhere (Harrington et al., 2003; 
Nachamkin et al., 1993). Briefly, PCR amplification was done in 25 l aliquots in a PTC-
100 Programmable Thermal Controller (Bio-Rad Laboratories, Hercules, CA). 
Amplicons were restricted with DdeI and DNA bands were detected in 2.5% SeaKem? 
Gold Agarose (Lonza, Basel, Switzerland) that were stained with ethidium bromide. Gels 
were visualized using a UV transilluminator (Gel-Doc System, Syngene, Frederick, MD) 
and a TIFF file was created using a computer program (GeneSnap) for molecular analysis 
(Syngene, Frederick, MD). 
 
Denaturing Gradient Gel Electrophoresis (DGGE) Analysis 
Universal primers 338 F, containing the G + C clamp at its 5? end, and 518R were used 
for the amplification of the 16S region gene (Muyzer et al., 1993; Sheffield et al., 1989). 
The amplification consisted of 30 cycles of 5 min of denaturation at 94oC, 1 min of 
annealing at 55oC, and 1 min of extension at 72oC. The presence of PCR amplicons was 
confirmed by running the amplions on a 1.5% agarose gel. The denaturing gradient for 
the DGGE run in vertical polyacrylamide gels ranged from 45%-65%. Ingeny 
electrophoresis system (Ingeny phorU, Netherlands) at a voltage of 100V for 16-18 h was 
 
 
 
49 
used for separation of DGGE bands. Gels were stained in ethidium bromide and 
visualized under the UV imager. A marker strain was used in every DGGE gel run to 
have a standard for further analysis in Bionumerics version 4.50 (Applied Maths, Austin, 
TX) software program to analyze various strain and their genotypic profiles. 
 
Sequencing 
The primers used for sequencing were 338F, without the G + C clamp, and the 
518R (Muyzer et al., 1993; Sheffield et al., 1989). The amplification consisted of 30 
cycles of 5 min of denaturation at 94oC, 1 min of annealing at 55oC, and 1 min of 
extension at 72oC. The presence of amplions was confirmed by running the PCR-
amplified products on a 1.5% agarose gel. Amplicons were purified using the columns 
from Promega Wizard SV Gel (Madison, WI) and PCR clean-up system (Promega, 
Madison, WI). The purified amplicons along with the forward and reverse primers were 
sent out for sequencing to Lucigen (Middleton, WI), where the amplified products were 
sequenced using an ABI 3730 sequencer (Applied Biosystems). The assembly of the 
consensus sequence from the forward and reverse run was done with MultAlin 
(http://bioinfo.genotoul.fr/multalin/multalin.html) and ClustalW 
(http://www.ebi.ac.uk/Tools/clustalw2/index.html). The percentage similarity of the 
consensus sequences was calculated with the nucleotide Basic Local Alignment Search 
Tool (BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi). 
 
 
 
 
50 
Statistical Analysis 
Positive/negative data between treatments (Bolton versus Bolton with Oxyrase) 
were analyzed with the McNemar's Test (McNemar, 1947) and the Kappa coefficient 
(Cohen, 1960) using Proc Freq in SAS (SAS version 9.1; SAS Institute Incorporated, 
Cary, NC). A McNemar's test value ? 3.84 assumes the null hypothesis; that means that 
the test method (Oxyrase) and reference method (Bolton broth) are equivalent and cannot 
be rejected at the 5% level of confidence (P < 0.05). The Kappa coefficient is used to 
quantify the agreement between two raters in placing the sample of subjects into two 
categories. Therefore, Kappa is a chance-corrected measure of agreement between two 
raters. Each rater classifies each of a sample of subjects into one of two mutually 
exclusive categories (King, 2004). Kappa values are between 0 and 1. A Kappa value of 
1.0 implies a perfect agreement. In general, Kappa values of 0.20 and 0.40 are considered 
a ?fair agreement?, while values between 0.40 and 0.60 are considered ?moderate 
agreement? (McNemar, 1947). 
 
3.3. Results 
The isolation rate from Bolton (microaerobic) and Bolton Oxyrase (regular 
atmosphere) broths did not result in significant differences (chi-square = 0.46) (Table 
3.1). mCC + Oxyrase in OxyDish performed similarly to control plate media (chi-square 
value  1.39) (Table 3.2). However, mCC + Oxyrase in petri dishes (bagged) resulted in 
less number of isolates than the control plate media (P < 0.05) (Table 3.3). 
 
 
 
51 
The DGGE analysis and sequencing results from the enrichment broths, with and 
without the addition of Oxyrase showed that the majority of the bands (85%) were similar 
among the treatment (Figure 3.1), indicating the growth of similar kinds of microbial 
populations in both the control and test enrichment medium. 
DGGE analysis showed the presence of different bands in the same samples but 
different liquid enrichment media (Figure 3.1). The various groups of organisms in each 
enrichment broth that differed are listed in the table (Table 3.4). 
The multiplex PCR results (Figure 3.4) showed that in some cases different 
species were colonizing different sub-samples. In addition, some subsamples showed the 
presence of both C. jejuni and C. coli after enrichment (Figure 3.4, lanes 7 and 9). 
RFLP band patterns (Figure 3.5) of sub-samples showed that in most of the cases 
the same strain was present in both sub-samples. However, in some cases different strains 
from the same Campylobacter spp. were colonizying the subsamples (Figure 3.5, lanes 3 
and 4). 
 
3.4. Discussion 
As Bolton?s broth and Bolton?s broth with Oxyrase did not yielded significantly 
different numbers of positive samples, it may be concluded that Oxyrase works well in 
creating microaerobic environments in liquid enrichment media. However, Oxyrase in 
plate medium yielded significantly different results from the regular plating medium 
mCC, and it can be concluded that the use of Oxyrase in agar plates is not as efficient for 
the isolation of Campylobacter spp. from retail boiler meat. 
Even though Oxyrase in liquid enrichment medium and Oxyrase in OxyDish 
 
 
 
52 
perform as good as the control plating medium, the cost may be a limiting factor for the 
incorporation of these systems in food microbiology laboratories. 
One of the advantages of DGGE is that it is a culture-independent method and can 
be used to characterize and supervise the total microbial population in different niches. 
The basic principle of DGGE is the electrophoretic separation of amplified PCR products 
of equal length in a sequence specific way. The gel is made up of a denaturing gradient 
comprised of urea and formamide. The sequence-specific separation of DNA molecule of 
similar size is based on melting temperature Tm of the double stranded (ds) DNA. 
Thus when the dsDNA is exposed to the increasing denaturant environment it will melt in 
distinct segments, called the melting domains. The double stranded DNA will start 
becoming single stranded, thus DNA becomes partially melted at the Tm of lowest 
melting domain creating branched molecules. This branched molecule sharply reduces 
the mobility in a polyacrylamide gel thus allowing separation of amplicons which show 
even a single nucleotide substitution. 
We found that five bands were almost consistently appearing throughout the 
samples. These bands were named A through E and were used as a marker at the end of 
each DGGE gel to standardize the gels and create a fingerprinting profile in 
BioNumerics. This fingerprinting profile allowed us to make comparison on the 
electrophorectic mobility of a partially melted double-strand DNA to evaluate the number 
of similar bands among the different treatments. The first run of sequencing for these 
bands gave us identity values that varied from 96% to 82%, and the top band was similar 
to Acinetobacter sp. (accession number FJ216156.1) the lowest band similar to 
Lactobacillus sp. (accession number AF159000.1) (Table 4.2). 
 
 
 
53 
The calculation of the GC content of these sequences 
(http://www.genomicsplace.com/gc_calc.html) showed that Acinetobacter had a GC 
content of 54.2%, and Lactobacillus sp. had a GC content of 47.1%. Therefore the spread 
of the electrophoretic runs spanned approximately 7% in the GC content from the highest 
to the lowest band. 
DGGE analysis showed differences in bands patterns in the same samples but 
different liquid enrichment media indicating different set of organisms being selected in 
these two types of enrichment methods. The bands that were not common to both the 
media were processed and then sequenced. The percentage of similar group of organisms 
growing both in Bolton and Bolton oxyrase enrichment media was 85% and of the 
different group of organisms which were either present or absent in either Bolton or in 
Bolton Oxyrase enrichment media was 15%.  
 
 
 
 
54 
 References 
Adler, H. I., A. Carrasco, W. Crow, and J. S. Gill. 1981. Cytoplasmic membrane fraction 
that promotes septation in an Escherichia coli lon mutant. J. Bacteriol. 147: 326-
332. 
Border, M. M., B. D. Firehammer, and L. L. Myers. 1974. Tube culture method for viable 
counts of Campylobacter fetus (Vibrio fetus). Appl. Microbiol. 28: 730-732. 
Bowdre, J. H., N. R. Krieg, P. S. Hoffman, and R. M. Smibert. 1976. Stimulatory effect 
of dihydroxyphenyl compounds on the aerotolerance of Spirillum volutans and 
Campylobacter fetus subspecies jejuni. Appl. Environ. Microbiol. 31: 127-133. 
Cohen, J. 1960. A coefficient of agreement for nominal scales. Educational and 
Psychological Measurement 20: 37-46. 
Corry, J. E., D. E. Post, P. Colin, and M. J. Laisney. 1995. Culture media for the isolation 
of campylobacters. Int. J. Food Microbiol. 26: 43-76. 
George, H. A., P. S. Hoffman, R. M. Smibert, and N. R. Krieg. 1978. Improved media for 
growth and aerotolerance of Campylobacter fetus. J. Clin. Microbiol. 8: 36-41. 
Harrington, C. S., L. Moran, A. M. Ridley, D. G. Newell, and R. H. Madden. 2003. Inter- 
laboratory evaluation of three flagellin PCR/RFLP methods for typing 
Campylobacter jejuni and C. coli: the CAMPYNET experience. J. Appl. 
Microbiol. 95: 1321-1333. 
Hutchinson, D. N., and F. J. Bolton. 1984. Improved blood free selective medium for the 
isolation of Campylobacter jejuni from faecal specimens. J. Clin. Pathol. 37: 956-
957. 
 
 
 
55 
King, J. E. 2004. Software solutions for obtaining a Kappa-type statistic for use with 
multiple raters. In Annual meeting of the Southwest Educational Research 
Association. Dallas, Texas. 
Mcnemar, Q. 1947. Note on the sampling error of the difference between correlated 
proportions or percentages. Psychometrika 12: 153-157. 
Muyzer, G., E. C. De Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial 
populations by denaturing gradient gel electrophoresis analysis of polymerase 
chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 
59: 695-700. 
Nachamkin, I., K. Bohachick, and C. M. Patton. 1993. Flagellin gene typing of 
Campylobacter jejuni by restriction fragment length polymorphism analysis. J. 
Clin. Microbiol. 31: 1531-1536. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A. 
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
Microbiol. Methods 69: 129-136. 
Sails, A. D., D. R. A. Wareing, and F. J. Bolton. 1998. Evaluation of three microaerobic 
systems for the growth and recovery of Campylobacter spp., In A. J. Lastovica, D. 
G Newell and E. E. Lastovica (ed.) edn: The Rustica Press, Pinelands, South 
Africa. 
 
 
 
56 
Schnaitman, C. A. 1970. Protein composition of the cell wall and cytoplasmic membrane 
of Escherichia coli. J. Bacteriol. 104: 890-901. 
Sheffield, V. C., D. R. Cox, L. S. Lerman, and R. M. Myers. 1989. Attachment of a 40-
base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the 
polymerase chain reaction results in improved detection of single-base changes. 
Proc. Natl. Acad. Sci. U. S. A. 86: 232-236. 
Skirrow, M. B. 1991. Epidemiology of Campylobacter enteritis. Int. J. Food Microbiol. 
12: 9-16. 
Solomon, E. B., and D. G. Hoover. 1999. Campylobacter jejuni: A bacterial paradox. 
Journal of Food Safety 19: 121-136. 
Szalanski, A. L., C. B. Owens, T. Mckay, and C. D. Steelman. 2004. Detection of 
Campylobacter and Escherichia coli O157:H7 from filth flies by polymerase 
chain reaction. Med. Vet. Entomol. 18: 241-246. 
Wonglumsom, W., A. Vishnubhatla, J. M. Kim, and D. Y. Fung. 2001. Enrichment 
media for isolation of Campylobacter jejuni from inoculated ground beef and 
chicken skin under normal atmosphere. J. Food Prot. 64: 630-634. 
 
 
 
 
 
57 
Table 3.1. Plate media, mCC (Bolton) vs mCC (Bolton Oxyrase) 
 
 
mCC ( C ) 
Total 
+ - 
Bolton Oxy to 
mCC (CB) 
+ 20 15 35 
- 18 78 96 
Total  38 93 131 
 
Chi square, as defined by McNemar's Test = 0.46 
Kappa Coefficient is between 0 and 1 
 
 
 
58 
Table 3.2. Plate media, mCC vs mCC + Bolton Oxyrase in an OxyDish 
 
 
 
mCC ( C ) 
Total + - 
Oxydish + 
mCC oxy 
(COX) 
+ 6 12 18 
- 6 17 23 
Total  12 29 41 
 
Chi square, as defined by McNemar's Test = 1.39 
Kappa Coefficient is between 0 and 1 
 
 
 
 
 
 
 
59 
Table 3.3. Plate media, mCC vs mCC + Bolton Oxyrase in a Petri Plate 
 
 
  mCC ( C ) Total 
   + -  
Petri plates 
+ mCC oxy 
(COB) 
+ 7 5 12 
- 18 46 64 
Total  25 51 76 
 
Chi square, as defined by McNemar?s Test = 8.52 
Kappa Coefficient is between 0 and 1 
 
 
 
60 
Table 3.4. Results after BLAST analysis of the sequences 
 
Marker Number Bacterial strain % similarity Accession Number 
 A K 1 Uncultured Acinetobacter sp. 96% FJ216156.1 
B K 2 Uncultured Nitrospirae bacterium 85% AF540054.1 
C K 3 Lactobacillus sp. L21 87% AF159000.1 
D K 4 Lactobacillus saerimneri 95% AY255802.1 
E K 5 Lactobacillus sp. L21 82% AF159000.1 
Bolton Bolton oxyrase     
 Lane 6 K 6 Pseudomonas syringae 98% DQ512737.1 
 Lane 6 K 7 Uncultured bacterium 79% EU873625.1 
Lane 7  K 8 Campylobacter subantarcticus 97% AM933374.1 
Lane 9  K 9 Uncultured bacterium 87% FJ035391.1 
 Lane 10 K 10 Uncultured bacterium 94% EF089410.1 
 Lane 10 K 11 Campylobacter sp. 87/06 88% EU623475.1 
Lane 11  K 12 Uncultured Pantoea sp. 98% AM711573.1 
Lane 13  K 13 Lactobacillus saerimneri 98% AY255802.1 
 Lane 16 K 14 Uncultured Acinetobacter sp. clone SS1B08 90% FJ216156.1 
Lane 17  K 15 Lactobacillus sp. L21 96% AF159000.1 
 Lane 18 K 16 Campylobacter subantarcticus 96% AM933374.1 
 
 
 
61
 
                                         M     1      2     3      4     5      6     7     8      9    10   11    12    13   14    M 
  
Figure 3.1. DGGE band patterns, Lane M-marker; Lanes 1, 3, 5, 7, 9, 11, 13, = Bolton samples 13, 14, 15, 16, 17, 19, 20; 
Lanes 2, 4, 6, 8, 10, 12, 14 = Bolton + Oxyrase samples 13, 14, 15, 16, 17, 19, 20
 
 
 
62
 
 
Figure 3.2. Dendrogram, Bolton and Bolton Oxyrase ? Pearson?s correlation 
 
 
 
63
 
 
Figure 3.3. Dendrogram, Bolton and Bolton Oxyrase ? Dice?s correlation 
 
 
 
64 
                     M   C.jej C.coli  1     2        3      4      5      6       7      8     9      10 
  
 
Figure 3.4. Multiplex PCR results, Lane M - marker, Lanes 1, 3, 5, 7, 9 Bolton samples ; 
Lanes 2, 4, 6, 8, 10 corresponding Bolton oxyrase samples 
 
 
 
65 
                    M       1        2        3         4       5        6        7      8         9      10 
 
 
 
Figure 3.5. RFLP results, Lane M ? marker, Lanes 1, 3, 5, 7, 9 Bolton samples ; Lanes 2, 
4, 6, 8, 10 corresponding Bolton oxyrase samples 
 
 
 
66 
CHAPTER IV: MICROBIOLOGICAL AND MOLECUAR METHODS 
EVALUATION OF ENRICHMENT MEDIA WITHOUT THE MICROAEROBIC 
GAS MIXTURE FOR GROWTH OF CAMPYLOBACTER SPP. 
 
4.1. Introduction 
Campylobacter is a Gram negative bacterium that can grow at a concentration of 
5% or less of oxygen.  Hence the standard atmospheric mixture containing 5% oxygen, 
10% carbon dioxide and 85% nitrogen is commonly used in the isolation of C. coli and C. 
jejuni. However, the composition of the gas mix varies. Some Campylobacter spp. appear 
to need hydrogen for growth and some mixes contain 7 to 10% of hydrogen in their 
compositions (Skirrow, 1991).  
Originally, a candle placed in a jar was used for the generation microaerobic 
environment for the growth of Campylobacter spp. However, over the years different 
methods for the generating of microaerobic environments have been successfully used to 
grow Campylobacter from clinical or food samples. Some of these methods include the 
use of sachets (for instance Oxoid BR56, Oxoid, UK) that generate carbon dioxide from 
sodium bicarbonate and citric acid, and hydrogen from sodium borohydride, with a 
catalyst (palladium) that converts water from hydrogen and oxygen (Sails, 1998). Some 
newer sachets quench the oxygen in the jar and generate carbon dioxide without the 
production of hydrogen (for instance CampyGen?, Oxoid). Other systems include the 
 
 
 
67 
evacuation-replacement system (Microbiology International, Frederick, MD), which uses 
a standard 5% O2, 10% CO2 and 85% N2 gas mix, and microaerobic workstations, which 
usually include incubators, for the processing of large number of samples (Don Whitley 
Scientific Ltd., West Yorkshire, UK). Workstations have a modular atmosphere 
controlled system (MACS) that allows for a better control of the different concentrations 
of oxygen, carbon dioxide, nitrogen and hydrogen in the mix throughout incubation 
(Annable, 1998). Gas-generating sachets or envelops in jars do not usually maintain a 
constant atmosphere throughout incubation. Therefore the MACS technology is an 
important improvement; yet, these workstations are expensive and are not within the 
budget of many microbiology laboratories.  
 Gas-generating sachets and the evacuation-replacement systems have been also 
used with success with plastic bags used to freeze food products. In these cases, the bags 
have to have a strong closing system, usually a ?ziplock? type, to prevent air from 
leaking during incubation. 
 The objective of the present study is to examine if Campylobacter enrichment in 
Bolton?s broth from retail broiler samples really needs the microaerobic atmospheric mix. 
The microbial changes in the different media will be evaluated with Denaturing Gradient 
Gel Electrophoresis. 
 
4.2. Materials and Methods 
Sample Preparation 
Five to six samples of retail broiler retail meat consisting of breast tenders, boneless 
breasts and boneless thighs were purchased from local stores.  
 
 
 
68 
This was done every week for 20 weeks, from January 2008 to November 2008. A 
total of 96 samples were analyzed.  
From each individual meat package representing a sample, one inch pieces were cut 
aseptically and thoroughly mixed (Figure 4.1). Then 25 g of meat was weighed two times 
(two subsamples) in individual, sterile Whirl-Pak? bags (Nasco, Fort Atkinson, WI). 
Both the sub-samples was enriched with the addition of 100 ml of Bolton?s broth 
supplemented with 5% (v/v) lysed horse blood (Oyarzabal et al., 2007) into each bag. 
Samples were stomached for 1 min and one of the sub-samples enriched in Bolton?s broth 
was incubated under microaerobic condition (85% nitrogen, 10% carbon oxide, 5% 
oxygen; Airgas, Radnor, PA) using anaerobic jars gassed with a MACSmics Jar Gassing 
System (Microbiology International, Frederick, MD), while the second sub-sample 
containing Bolton?s broth was not gassed with the microerobic mix and was just tightly 
closed leaving a reduce head space in the bags. All samples were incubated at 42oC for 
48 h. At 24 and 48 h, samples were transferred (full loop, approximately 100 ?l) to 
modified Campy-Cefex (mCC) (Oyarzabal et al., 2005) agar plates. Modified Campy-
Cefex plates were gassed after plating in jars to create microaerobic conditions as 
previously described. All plates were incubated at 42oC for up to 48 h. Presumptive 
Campylobacter colonies were observed under phase contrast microscopy (Optiphot-2, 
Nikon, Tokyo, Japan) for morphology and motility of Campylobacter cells. Presumptive 
isolates were stored at -80oC in tryptic soy broth (Difco, Detroit, MI) supplemented with 
30% glycerol (v/v) and 5% (v/v) lysed horse blood.  
 
 
 
 
69 
Identification of Campylobacter Isolates 
Campylobacter isolates were recovered by transferring the stock cultures on a 
0.65 ?m cellulose filters (Millipore, Billerica, MA, USA) that was placed on mCC agar 
plates. After 10-15 m the filter was removed and the plates were incubated for 24 h to 48 
h at 42oC under microaerobic conditions. Campylobacter colonies were picked after 24 h 
? 48 h and bacterial DNA was extracted using PrepMan? Ultra sample preparation 
reagent (Applied Biosystems, Foster City, CA). All Campylobacter isolates were 
identified to the species level using two multiplex PCR (mPCR) assays described 
elsewhere (Oyarzabal et al., 2005; Oyarzabal et al., 2007). 
 
Subtyping of Campylobacter Isolates 
The restriction fragment length polymorphism of an amplified segment of the 
flaA gene (PCR-RFLP) was carried out as described elsewhere (Harrington et al., 2003; 
Nachamkin et al., 1993). Briefly, PCR amplification was done in 25 l aliquots in a PTC-
100 Programmable Thermal Controller (Bio-Rad Laboratories, Hercules, CA). 
Amplicons were restricted with DdeI and DNA bands were detected in 2.5% SeaKem? 
Gold Agarose (Lonza, Basel, Switzerland) that was stained with ethidium bromide. Gels 
were visualized using a UV transilluminator (Gel-Doc System, Syngene, Frederick, MD) 
and a TIFF file was created using a computer program (GeneSnap) for molecular analysis 
(Syngene, Frederick, MD). 
 
 
 
 
70 
Denaturing Gradient Gel Electrophoresis (DGGE) of Microbial Flora of Enriched 
Samples 
Universal primers 338 F, containing the G + C clamp at its 5? end, and 518R were 
used for the amplification of the 16S gene (Muyzer et al., 1993); (Sheffield et al., 1989). 
The amplification consisted of 30 cycles of 5 min of denaturation at 94oC, 1 min of 
annealing at 55oC, and 1 min of extension at 72oC. The presence of PCR amplicons was 
confirmed by running the amplions on a 1.5% agarose gel. The denaturing gradient for 
the DGGE run in vertical polyacrylamide gels ranged from 45%-65%. Ingeny 
electrophoresis system (Ingeny phorU, Netherlands) at a voltage of 100V for 16-18 h was 
used for separation of DGGE bands. Gels were stained in ethidium bromide and 
visualized under the UV imager. Bionumerics version 4.50 (Applied Maths, Austin, TX) 
software was used to analyze the band patterns. A marker strain was used in every DGGE 
gel that was run as a standard for Bionumerics analysis during the comparative analysis 
of genotype profiles of the strains. 
 
Sequencing 
The primers used for sequencing were 338F, without the G + C clamp, and the 
518R (Muyzer et al., 1993; Sheffield et al., 1989). The amplification cycle consisted of 5 
min of denaturation at 94oC and 1 min of annealing at 55oC and 1 min of extension at 
72oC for 30 cycles and the presence of PCR amplicons was confirmed by running the 
amplions on a 1.5% agarose gel. Amplicon was purified using the columns from Wizard 
SV Gel and PCR clean-up system by Promega (Madison, WI). The purified amplicons 
along with the forward and reverse primers were sent out for sequencing.  
 
 
 
71 
The sequencing of the amplified bands was done as described in Chapter III. 
 
Statistical Analysis 
Positive/negative data between treatments (Bolton with microaerobic gas mix 
versus Bolton without the gas mix) were analyzed with the McNemar's Test (McNemar, 
1947); and the Kappa coefficient (Cohen, 1960) using Proc Freq in SAS (SAS version 
9.1; SAS Institute Incorporated, Cary, NC). A McNemar's test value ? 3.84 assumes the 
null hypothesis; that means that the test method (Bolton without the gas mix) and 
reference method (Bolton with microaerobic gas mix) are equivalent and cannot be 
rejected at the 5% level of confidence (P < 0.05). The Kappa coefficient is used to 
quantify the agreement between two raters in placing the sample of subjects into two 
categories. Therefore, Kappa is a chance-corrected measure of agreement between two 
raters. Each rater classifies each of a sample of subjects into one of two mutually 
exclusive categories (King, 2004). Kappa values are between 0 and 1. A Kappa value of 
1.0 implies a perfect agreement. In general, Kappa values of 0.20 and 0.40 are considered 
a ?fair agreement?, while values between 0.40 and 0.60 are considered ?moderate 
agreement? (McNemar, 1947).  
 
4.3. Results and Discussion 
The isolation rate from Bolton (microaerobic) and Bolton (without microaerobic 
gas mix) broth did not result in significant differences (chi-square = 0.21) (Table 4.1). 
  
 
 
 
72 
The DGGE analysis of the two enrichment broths showed that the majority (85%) 
of the bands were similar among the treatment (Figure 4.1), indicating the growth of 
similar kinds of microbial populations in both the control and test enrichment medium. 
There was some amount of difference (20%) in presence or absence of certain 
bands in certain meat samples. A BLAST analysis gave us an insight into the type of 
microbial population that?s inhabiting with Campylobacter during its growth. Some of 
those microorganisms were unculturable organisms. 
DGGE analysis showed the presence of different bands in the same samples but 
different liquid enrichment media (Figure 4.2). After the assembly of the consensus 
sequence from the forward and reverse run was done with MultAlin and ClustalW the 
sequencing results of these bands was alignment in the Basic Local Alignment Search 
Tool (BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi) which gave the following results. 
The percentage of similar group of organisms growing both in Bolton under the 
microaerobic environment and Bolton without gas enrichment media was 80% and of the 
different group of organisms which were either present or absent in either Bolton with 
gas and in Bolton without enrichment media was 20% (Figure 4.2). 
In most of the comparisons of the multiplex PCR results (Figure 4.5), the 
presence of same species of Campylobacter was seen, but some comparisons showed the 
presence of different strains. In a sub-sample, Bolton broth showed the presence of both 
C. jejuni and C. coli, whereas the equivalent strains (lanes 14) isolated from the Bolton 
without gas showed the presence of only C.coli. 
 
 
 
 
 
73 
The RFLP band pattern (Figure 4.6) was same for most of the strains. However, 
few exceptions (Figure 4.6, lanes 3 and 4, 7 and 8) showed the presence of different band 
patterns indicating presence of different strains. 
Our results showed the presence of growth of Campylobacter without the 
presence of microaerobic gas mix. This suggests that the environment inside the 
enrichment bag may have oxygen concentration less than 5% which will enable the 
growth of Campylobacter.  
 
 
 
74 
References 
Annable, M. J., A. D. Marshall, and P. Silley. 1998. Optimization of incubation 
atmosphere for the growth of Campylobacter spp. and Helicobacter spp., In A. J. 
Lastovica, D. G Newell and E. E. Lastovica (ed.), edn: The Rustica Press, 
Pinelands, South Africa. 
Cohen, J. 1960. A coefficient of agreement for nominal scales. Educational and 
Psychological Measurement 20: 37-46. 
Harrington, C. S., L. Moran, A. M. Ridley, D. G. Newell, and R. H. Madden. 2003. Inter-
laboratory evaluation of three flagellin PCR/RFLP methods for typing 
Campylobacter jejuni and C. coli: the CAMPYNET experience. J. Appl. 
Microbiol. 95: 1321-1333. 
King, J. E. 2004.Software solutions for obtaining a Kappa-type statistic for use with 
multiple raters. In Annual meeting of the Southwest Educational Research 
Association. Dallas, Texas. 
Mcnemar, Q. 1947. Note on the sampling error of the difference between correlated 
proportions or percentages. Psychometrika 12: 153-157. 
Muyzer, G., E. C. De Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial 
populations by denaturing gradient gel electrophoresis analysis of polymerase 
chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 
59: 695-700. 
Nachamkin, I., K. Bohachick, and C. M. Patton. 1993. Flagellin gene typing of 
Campylobacter jejuni by restriction fragment length polymorphism analysis. J. 
Clin. Microbiol. 31: 1531-1536. 
 
 
 
75 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A. 
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
Microbiol. Methods 69: 129-136. 
Sails, A. D., D. R. A. Wareing, and F. J. Bolton. 1998. Evaluation of three microaerobic 
systems for the growth and recovery of Campylobacter spp., In A. J. Lastovica, D. 
G Newell and E. E. Lastovica (ed.) edn: The Rustica Press, Pinelands, South 
Africa. 
Sheffield, V. C., D. R. Cox, L. S. Lerman, and R. M. Myers. 1989. Attachment of a 40-
base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the 
polymerase chain reaction results in improved detection of single-base changes. 
Proc. Natl. Acad. Sci. U. S. A. 86: 232-236. 
Skirrow, M. B. 1991. Epidemiology of Campylobacter enteritis. Int. J. Food Microbiol. 
12: 9-16.
 
 
 
76 
Table 4.1. Liquid enrichment media, Bolton Broth with microaerobic gas mix vs Bolton 
Broth without gas mix 
 
 
  Bolton Broth  
  + - Total 
Bolton w/o gas 
+ 31 13 44 
- 14 38 52 
Total  45 51 96 
 
2 = 0.21  
 
 
 
77 
Table 4.2. Results after BLAST analysis of the sequences 
 
Marker Number Bacterial strain % similarity Accession Number 
Marker A K 1 Uncultured Acinetobacter sp. 96% FJ216156.1 
Marker B K 2 Uncultured Nitrospirae bacterium 85% AF540054.1 
Marker C K 3 Lactobacillus sp. L21 87% AF159000.1 
Marker D K 4 Lactobacillus saerimneri 95% AY255802.1 
Marker E K 5 Lactobacillus sp. L21 82% AF159000.1 
Bolton Bolton w/o gas     
Lane 15  K 17 Pseudomonas extremorientalis 99% EU982883.1 
Lane 17  K 18 Pseudomonas sp. tDp10 96% AJ971379.1 
Lane 21  K 19 Lactobacillus salivarius 85% FJ581418.1 
 Lane 22 K 20 Uncultured bacterium 88% EU469596.1 
Lane 23  K 21 Uncultured bacterium 80% DQ264456.1 
Lane 25  K 22 Pseudomonas sp. R-35702 97% AM886093.1 
 Lane 26 K 23 Lactobacillus sp. JN4 83% AF157041.1 
 
 
 
 
78
 
 
 
Figure 4.1. Flow Chart ? Experimental procedure 
 
Small 1 inch pieces cut, 
 mixed together 
 Enrichment broth added,  
samples stomached 
 Enriched samples plated on mCC,  
incubated at 42oC under microaerobic gas mix 
 25gm weighed into each 
of the two Whirl-pak? bag 
 One of the samples gassed,  
incubated at 42oC for 48h 
 Second sample incubated at  
42oC w/o microaerobic gas mix 
 
 
 
79
 
M     1      2      3      4      5     6      7     8      9     10     11   12    13   14    M 
 
 
Figure 4.2. DGGE band patterns, Lane M-marker; Lanes 1, 3, 5, 7, 9, 11, 13 - Bolton with microaerobic gas mix; samples 21, 
23, 31, 32, 33, 34, 35; Lanes 2, 4, 6, 8, 10, 12, 14 - Bolton without microaerobic gas mix; samples 21, 23, 31, 32, 33, 34, 35 
 
 
 
80
 
 
Figure 4.3. Dendrogram, Bolton and Bolton without gas ? Pearson?s correlation 
 
 
 
81
 
 
Figure 4.4. Dendrogram, Bolton and Bolton without gas ? Dice?s correlation 
 
 
 
82 
       M  C.jej C.coli  1     2      3      4     5     6      7     8       9    10   11    12     13    14 
 
 
Figure 4.5. Multiplex PCR results, Lane M - marker, Lanes 1, 3, 5, 7, 9,11, 13 Bolton 
samples ; Lanes 2, 4, 6, 8, 10, 12, 14 corresponding Bolton without gas samples 
 
 
 
 
83 
     M       1        2        3       4        5      6        7      8       9       10     11     12     13      14 
  
Figure 4.6. RFLP results, Lane M ? marker, Lanes 1, 3, 5, 7, 9, 11, 13 = Bolton samples; 
Lanes 2, 4, 6, 8, 10, 12, 14 = corresponding Bolton without gas samples 
 
 
 
84 
CHAPTER V: ENUMERATION, PREVALENCE AND PULSED-FIELD GEL 
ELECTROPHORESIS ANALYSIS OF CAMPYLOBACTER ISOLATES 
OBTAINED FROM COMMERCIAL BROILER CARCASSES 
 
5.1. Introduction 
Campylobacter jejuni and Campylobacter coli are two important thermotolerant 
bacteria which are pathogenic to humans. Most of the campylobacteriosis cases are 
sporadic and the exact modes of infections are not well understood (Rodrigues et al., 
2001).   
The number of Campylobacter spp. in poultry carcasses have been reduced over 
the last 10 years due to the implementation of the hazard analysis and critical control 
Points (HACCP) systems (Anonymous, 1996). From the changes brought about by 
HACCP, the increase in the water usage (Sellers, 2001), the incorporation of carcass 
washers (Bashor et al., 2004) and the implementation of antimicrobial intervention 
strategies (Oyarzabal et al., 2005) can be indirectly correlated to the reduction in the 
number of foodborne pathogens in general. Recent publications reporting prevalence of 
Campylobacter spp. in broiler carcasses have used direct plating media. However, the 
number of Campylobacter spp. per carcass is low enough that it requires an enrichment 
step  
 
 
 
85 
To better understand the epidemiology of Campylobacter spp. molecular methods 
for sub-typing are used to track the sources of Campylobacter pulsed-field gel 
electrophoresis (PFGE) is one of the most discriminating methods for subtyping of 
Campylobacter spp (On et al., 1998). This method allows for the separation of large 
fragments of DNA (30 kbp or above), and was first introduced by Schwartz and Cantor in 
1984 (Schwartz & Cantor, 1984). The ability of this technique to resolve very large 
fragments was initially used to map the genomes of microorganisms, after that this 
technique was used to compare genomes from different microorganism or different 
strains of the same organism.  
In a previous study, six different plate media were evaluated for direct 
enumeration of Campylobacter spp. from broiler carcasses collected from four 
commercial broiler processing facilities (Oyarzabal et al., 2005). In this article, we 
analyzed the data by plant to determine variations in the prevalence of Campylobacter 
spp. among plants. We also compare the efficacy of a combination of plate media versus 
individual plates for enumeration, and analyzed the isolates from different plants and 
from the same sample, same plates but different samples, same plates but different plants, 
and same plates and same plants with PFGE to determine the DNA variability among 
plants and within isolates from the same sample. 
 
 
 
 
86 
5.2. Materials and Methods 
 
Sample Collection and Identification of the Isolates 
Four commercial processing plants (A through D) were sampled three times. 
Twenty post-chill carcasses were collected, rinsed with 400ml of buffered peptone water 
and analyzed for the presence of Campylobacter spp. Carcass rinses were plated on six 
different plate media (Campy-Cefex, modified Campy-Cefex, mCCDA, Karmali, 
CAMPY, Campy-Line) for enumeration of Campylobacter spp.  
Presumptive Campylobacter colonies were observed under a phase contrast 
microscope for morphology and motility. A multiplex polymerase chain reaction (PCR) 
assay that targets the cadF gene (C. jejuni and C. coli), the ceuE gene (C. coli only) and 
an unknown DNA fragment (C. jejuni only) was used to confirm the identity of 
Campylobacter isolates (Table 5.1) (Cloak & Fratamico, 2002). 
 
Pulsed-Field Gel Electrophoresis (PFGE) Analysis 
Fifty eight isolates, 20 from plant A, 23 isolates from plant B, seven from plant C 
and eight from plant D, were analyzed  following a  standardized PFGE protocol for 
subtyping Campylobacter isolates. This protocol is a slight modification of the protocol 
by the Centers for Disease Control and Prevention (Atlanta, GA) and has been published 
elsewhere (Ribot et al., 2001). DNA was restricted with SmaI and analyzed with a 
contour-clamped homogeneous electric field (CHEF, Bio-Rad, Hercules, CA) in 1% 
agarose gel stained with ethidium bromide. Gels were visualized with a UV 
transilluminator (Gel-Doc System, Bio-Rad) and a digital pictured was recorded using 
 
 
 
87 
GeneSnap (Syngene, Frederick, MD). A lambda marker (50-kb-1,000kb; Promega, 
Madison, WI) was included as the reference lanes in the PFGE gels.  
PFGE types were analyzed as follows: different plates but same carcass, same 
plates but different carcass, same plates but different plants, and same plates and same 
plants. Cluster comparison was done with the Dice correlation coefficient and the 
unweighted pair group mathematical average (UPGMA) clustering algorithm from 
Bionumerics version 4.50 (Applied Maths, Austin, TX). The optimization and position 
tolerance for band analysis were set at 4%, and a cutoff of 90% was used to determine 
PFGE types and subtypes. 
 
Statistical Analysis of Plate Results 
Colony counts were converted to log10 CFU/ml and analyzed using the general 
lineal model procedure of SAS (SAS Release 9.1, SAS Institute Incorporated, Cary, NC). 
Means were analyzed for differences using Duncan test (SAS), and percentage values 
analyzed by a qualitative, McNemar chi-square (?2) analyses using one degree of 
freedom. Chi-square values less than 3.84 indicated that percentages were equivalent and 
therefore the null hypothesis (similar percentages) could not be rejected at the 5% level of 
confidence.   
 
5.3. Results 
Plant Prevalence 
Variations in the number of Campylobacter positive carcasses were found during 
the different visits to the plant. However, the average prevalence of Campylobacter spp. 
 
 
 
88 
calculated by direct plating showed that three plants had similar percentages of 
Campylobacter positive carcasses while the fourth one exhibited lowered Campylobacter 
counts (Table 5.2). The mean log of CFU/ml or carcass rinse was similar for all the four 
plants, and was less than 1CFU/ml.  
When the results from one plate, mCC, were compared with the results of the 
combination of all plates; plants A and B exhibited and significant increase (P < 0.05) in 
the number of positive samples. However, plants C and D did not showed any significant 
differences between mCC and the results from the combination of all plates (Table 5.2). 
The analysis of all positive samples, from all plants, resulted in 63% positive samples, 
which was significantly different (P < 0.05) from the results of only mCC plates (50%). 
Therefore, the increase in the number of plate media used for the analysis of the results 
resulted in an increase in the frequency of positive samples, but generated a slight, non-
significant decrease in the average number of Campylobacter spp. (Figure 5.1). 
 
PCR Testing 
 From 152 positive samples, the multiplex PCR (Cloak & Fratamico, 2002) 
identified 143 isolates as C. jejuni (98 %), three as C. coli (2 %) and six containing both 
C. jejuni and C. coli (Table 5.1) (Figure 5.2). These mixed cultures were re-isolated using 
a 0.65 ?m cellulose filter (Millipore Corp., Billerica, MA) on mCC plates. One isolated 
colony was then tested with the PCR protocol, and all isolates resulted as C. jejuni.  
 
 
 
 
89 
PFGE Analysis 
Twenty isolates from plant A, 23 isolates from plant B, seven isolates from plant 
C and eight isolates from plant D resulted in nearly twenty different sets of PFGE band 
patterns when a 90% cutoff and a position tolerance of 4% were used to determine 
relatedness in BioNumerics (Figure 5.7).  
Both C. jejuni and C. coli isolates were tested with PFGE. These results suggest 
an occurrence of different fingerprinting patterns from among Campylobacter strains 
collected from the rinse of the same carcass (Figure 5.6) confirming the presence of more 
than one strain subtype in a single carcass. The C. coli strains interestingly showed 
similar PFGE patterns (Figure 5.10) even though they were isolated from different 
carcasses and different plants (Figure 5.4). 
 
5.4. Discussion 
The prevalence of Campylobacter spp. varied with plants. In three plants, we 
found an incidence of more than 50% of Campylobacter spp. Plant C exemplifies the 
extreme variations that can be found in the prevalence of Campylobacter spp. in broiler 
carcasses when using only direct plating for identification. In this case, prevalence data 
should be reported with caution because no enrichment was used and samples that 
contained a low number of cells could have been misidentified as negatives.  
The mean log CFU per ml of Campylobacter was less than 1 log CFU/ml and 
correlates with previous reports summarizing the current number of Campylobacter spp. 
in commercial broiler carcass in the US (Oyarzabal et al., 2005).  
 
 
 
 
90 
Direct plating is useful to enumerate Campylobacter in carcasses that have more 
than 4000 CFU per carcass rinse. Yet, our prevalence results are in agreement with the 
findings reported by (Bashor et al., 2004), in a study performed in four commercial 
processing plants. The authors in this report spread plated the carcass rinse onto ten agar 
plates, two plates were spread with 0.1 ml and eight plates were spread each with 0.25 
ml. There was an overall prevalence of 68% of carcasses positive for Campylobacter spp. 
and a higher number of log CFU per ml of carcass rinse (3.1 up to 4.1). These differences 
may be due to the fact that samples were collected from post-evisceration, post-carcass 
wash, before the chiller, and because only 100 ml of buffered peptone water was used for 
rinsing of the carcasses.  
The amount of rinse solution, in the form of buffered peptone water or other rinse 
solutions (Stern & Robach, 2003), and different transportation and storage times and 
temperatures make it difficult for the current published results to be comparable. In 
addition, we do not have reliable information on the survival of Campylobacter spp. in 
buffered peptone water for extended times at refrigeration temperature and under regular 
atmospheric conditions. Therefore, the influence of these variables should be minimized 
when developing experimental protocols.  
Variables such as the amount of ml of rinse used the time of shaking of the 
carcasses and the transportation time and temperature before samples are processed may 
influence the final result when using direct plating to isolate Campylobacter spp. from 
processed carcasses. The chances for detection and enumeration increases when more 
rinse is spread-plated and the samples have large number of Campylobacter spp. per ml 
of rinse.  
 
 
 
91 
Table 5.3 shows the results obtained by each plating medium organized by plant. 
All plates except one exhibited a similar performance. In our laboratories, we have found 
that colonies are easier to collect from a blood-based medium than from a charcoal-based 
medium. Yet, the differentiation of colonies in any given plate is still subjective and the 
use of a phase-contrast or dark-field microscope for the identification of presumptive 
Campylobacter-like organisms can not be replaced by personal experience. 
Statistical differences were found between the prevalence on m Campy-Cefex and 
the prevalence based on the results from all plates (Table 5. 2). An increase in the number 
of plates slightly decreased the average counts of Campylobacter spp. but significantly 
increased the overall number of positive (Figure 5.1). These findings highlight the fact 
that the number of Campylobacter spp. found in carcass is usually less than 1 log CFU 
per ml of rinse, or ~4000 CFU per carcass, and therefore direct plating may not be 
reliable to consistently detect thee number, of Campylobacter spp. present in carcasses 
(Oyarzabal et al., 2005), Enrichment of the carcass rinses should be used when pursuing 
the collection of prevalence data in broiler carcasses.  
In 2001, a study was published that compared the recovery of three enumeration 
methods in 24 post-chill broiler carcasses: a 3-tube MPN (most probable number) in 
which the enrichment was Hunt (Hunt, 1992), a 3-tube MPN in which the enrichment 
was Rosef?s (Rosef, 1981) and direct plating on Campy-Cefex (0.1 ml in duplicate) with 
a 1:1 dilution of 25 ml the samples in 2X Bolton enrichment broth (Line et al., 2001). 
The same study compared the efficacy of three agar plates, Campy-Cefex, mCCDA and 
Muller-Hinton agar supplemented with blood and antibiotics (0.1 ml induplicate), for the 
enumeration of Campylobacter from 36 freshly processed carcasses. Similarly to our 
 
 
 
92 
results, the authors in this study found that Campy-Cefex and mCCDA recovered a 
similar number of positive samples, 66.7% and 63.9%, respectively, but reported that the 
sum of all positive using three plates was 94.4%. These results underline, again, the fact 
that direct plating is a good method when several plates are used and a high number of 
Campylobacter spp. are found in the rinse (more than 1 log CFU per ml). The limitations 
of drawing conclusions on prevalence data from analyses performed using only 0.1 ml of 
the sample, in duplicate, for direct plating should not be underestimated.  
The more we reduce the number of Campylobacter spp. on broiler carcasses, the 
more we will need to incorporate enrichment procedures to determine the real prevalence 
on the samples. Presently, the number of Campylobacter spp. in broiler carcass rinses is 
at the lowest limit of detection by direct plating. A semi-quantitative determination, 
where result is given in intervals according to pre-established tables and where a 
detection limit of 0.1 CFU/g requires analysis of 10 g (or ml) of sample, has been 
established by The Nordic Committee on Food analysis (Anonymous, April 2005). 
Until a solid, validated methodology is developed to enumerate these low number 
of Campylobacter spp. in samples, we may have to rely on the enrichment of the samples.  
The results from the PCR protocol used in this study were quite robust to identified 
mixed cultures, and were easy to interpret. The prevalence of C. coli was lower than the 
prevalence of C. jejuni. This difference in the prevalence of these two species is 
commonly found in process broiler carcasses, and it is similar to the rate of C. jejuni/C. 
coli found live, commercial broilers, (Genigeorgis, 1986; Johannessen et al., 2007; 
Potturi-Venkata et al., 2007). The analysis of selected C. jejuni isolates with PFGE 
suggested a high variability in the DNA patters of Campylobacter strains among the four 
 
 
 
93 
plants, and during different visits (Figure 5.5). Considerable amount of PFGE patterns 
were also seen in the profiles of different isolates within the same production plant, 
(Figure 5.9) and even with isolates collected from the same sample (Figure 5.8). PFGE 
patterns for C. coli strains were same even though the samples were from different 
carcasses and sometimes from different plants (Figure 5.10). This DNA diversity within 
C. jejuni strains has been found for strains isolated from retail meat samples (Dickins et 
al., 2002; Oyarzabal et al., 2007), from live broilers (Potturi-Venkata et al., 2007) and for 
other Campylobacter spp. (Bourke et al., 1996). 
 
 
 
94 
References 
 
Anonymous. 1996. Pathogen reduction: hazard analysis and critical control point 
(HACCP) systems. 
Anonymous. April 2005. Thermotolerant Campylobacter. Detection and enumeration in 
foods: Nordic Committee on Food Analysis. 
Bashor, M. P., P. A. Curtis, K. M. Keener, B. W. Sheldon, S. Kathariou, and J. A. 
Osborne. 2004. Effects of carcass washers on Campylobacter contamination in  
large broiler processing plants. Poult. Sci. 83: 1232-1239. 
Bourke, B., P. M. Sherman, D. Woodward, H. Lior, and V. L. Chan. 1996. Pulsed-field  
gel electrophoresis indicates genotypic heterogeneity among Campylobacter 
upsaliensis strains. FEMS Microbiol. Lett. 143: 57-61. 
Cloak, O. M., and P. M. Fratamico. 2002. A multiplex polymerase chain reaction for the  
differentiation of Campylobacter jejuni and Campylobacter coli from a swine 
processing facility and characterization of isolates by pulsed-field gel 
electrophoresis and antibiotic resistance profiles. J. Food Prot. 65: 266-273. 
Dickins, M. A., S. Franklin, R. Stefanova, G. E. Schutze, K. D. Eisenach, I. Wesley, and  
M. D. Cave. 2002. Diversity of Campylobacter isolates from retail poultry 
carcasses and from humans as demonstrated by pulsed-field gel electrophoresis. J. 
Food Prot. 65: 957-962. 
Genigeorgis, C., M. Hassuneh, and P. Collins. 1986. Campylobacter jejuni infection on  
poultry farms and its effect on poultry meat contamination during slaughtering. 
Journal of Food Protection. 49: 895?903. 
 
 
 
95 
Hunt, J. M. 1992. Campylobacter. In FDA Bacteriological Analytical Manual, 7th edn.  
pp: 77?94. Arlington , VA : Association of Official Analytical Chemists. 
Johannessen, G. S., G. Johnsen, M. Okland, K. S. Cudjoe, and M. Hofshagen. 2007.  
Enumeration of thermotolerant Campylobacter spp. from poultry carcasses at the 
end of the slaughter-line. Lett. Appl. Microbiol. 44: 92-97. 
Line, J. E., N. J. Stern, C. P. Lattuada, and S. T. Benson. 2001. Comparison of methods  
for recovery and enumeration of Campylobacter from freshly processed broilers. 
J. Food Prot. 64: 982-986. 
On, S. L., E. M. Nielsen, J. Engberg, and M. Madsen. 1998. Validity of SmaI-defined  
genotypes of Campylobacter jejuni examined by SalI, KpnI, and BamHI 
polymorphisms: evidence of identical clones infecting humans, poultry, and 
cattle. Epidemiol. Infect. 120: 231-237. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of  
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A.  
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
Microbiol. Methods 69: 129-136. 
Potturi-Venkata, L. P., S. Backert, A. J. Lastovica, S. L. Vieira, R. A. Norton, R. S.  
Miller, S. Pierce, and O. A. Oyarzabal. 2007. Evaluation of different plate media 
for direct cultivation of Campylobacter species from live broilers. Poult. Sci. 86: 
1304-1311. 
 
 
 
96 
Ribot, E. M., C. Fitzgerald, K. Kubota, B. Swaminathan, and T. J. Barrett. 2001. Rapid  
pulsed-field gel electrophoresis protocol for subtyping of Campylobacter jejuni. J. 
Clin. Microbiol. 39: 1889-1894. 
Rodrigues, L. C., J. M. Cowden, J. G. Wheeler and other authors. 2001. The study of  
infectious intestinal disease in England: risk factors for cases of infectious 
intestinal disease with Campylobacter jejuni infection. Epidemiol. Infect. 127: 
185-193. 
Rosef, O. 1981. Isolation of Campylobacter fetus subsp. jejuni from the gall bladder of  
normal slaughter pigs, using an enrichment procedure. Acta Vet. Scand. 22: 149-
151. 
Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs  
by pulsed field gradient gel electrophoresis. Cell 37: 67-75. 
Sellers, J., and B. Kiepper (2001).U.S. Egg and Poultry Association.A survey of  
wastewater treatment practices and experiences in the poultry processing industry. 
In Completed Research project #562. 
Stern, N. J., and M. C. Robach. 2003. Enumeration of Campylobacter spp. in broiler  
feces and in corresponding processed carcasses. J. Food Prot. 66: 1557-1563. 
 
 
 
 
 
97 
Table 5.1. Primer sets used in the multiplex PCR for confirmation of Campylobacter spp.  
 
 
Product 
(bp) 
Primers Sequences (5'-3') 
Tm 
(oC) 
References 
400 
F2B TTGAAGGTAATTTAGATATG 44 Konkel et al. 
1999 RIB CTAATACCTAAAGTTGAAAC 43 
894 
COLI ATGAAAAAATATTTAGTTTTTGCA 54 Gonzalez et al. 
1997 COL2 ATTTTATTATTTGTAGCAGCG 52 
160 
C-I CAAATAAAGTTAGAGGTAGAATGT 51 Winters and 
Slavik 1995 C-2 GGATAAGCACTAGCTAGCTGAT 55 
 
 
 
98
 
Table 5.2. Counts and prevalence (%) of Campylobacter spp. per plant and comparison of counts and prevalence data between 
mCampy-Cefex and all six plating media used in the study. 
 
 
1 Different letters within column indicate significant difference (P < 0.05). 
2 SEM = standard error of the mean. 
3 Chi-square values  3.84 indicate significance at P < 0.05. 
Plant 
Mean 
log 
CFU/ml1 
Total 
Positive 
(%) 
Positive per 
Sampling Time LOG CFU/ml Positive (%) 
Min. 
(%) 
Max. 
(%) 
mCampy-
Cefex 
Total 
Plating 
Media SEM2 
mCampy-
Cefex 
Total 
Plating 
Media ?3 
A 0.57C 47 (78.3)B 9 (45) 19 (95) 0.5A 0.5A 0.05 34 (57) 47 (78) 6.41 
B 0.74B 47 (78.3)B 12 (60) 20 (100) 0.8A 0.7A 0.06 37 (62) 47 (78) 3.96 
C 0.74B 37 (61.7)B 0 20 (100) 0.8A 0.6B 0.04 33 (55) 37 (62) 0.54 
D 0.10A 20 (33.3)A 0 19 (95) 0.2A 0.1B 0.03 14 (23) 20 (33) 1.47 
 
 
 
99 
Table 5.3. Campylobacter positive samples organized by plant and plating medium. 
 Mean (log CFU/ml) per Plant 1 
Plate A B C D 
Campy-Cefex 0.64A 0.99A 0.92A 0.10A,B 
mCampy-Cefex 0.62A 0.91A 0.88A,B 0.18A 
mCCDA 0.59A,B 0.86A 0.92A 0.15A,B 
Karmali 0.63A 0.81A 0.60C 0.08A,B 
CAMPY 0.40B 0.86A 0.73B,C 0.07A,B 
Campy-Line 0.52A,B 0.02B 0.38D 0.03B 
 
1 Different letters within column indicate significant difference (P < 0.05). 
 
 
 
 
100
 
0.2
0.4
0.6
0.8
1.0
m Ca m py - Cef ex m Ca m py - Cef ex  +  m CCDA m Ca m py - Cef ex  +  Ca m py -
Cef ex  +  m CCDA
m Ca m py - Cef ex  +  Ca m py -
Cef ex  +  CCDA  +  CAM P Y
T o t a l ( s ix  pla t es)
Si ng l e P l a te or  P l a te C o m bi na ti o n
Lo
g
 CFU/
m
l
45
47
49
51
53
55
57
59
61
63
65
P
ercenta
g
e P
o
s
i
ti
v
e
A
B
 
Figure 5.1. Average count of Campylobacter spp. (?) and percentage positive (?) for single plate or for a combination of 
plating media. A and B are statistically significant (?2 = 9.20) 
 
 
 
101 
M         1           2              3 
 
Figure 5.2. Multiplex PCR for confirmation of Campylobacter spp.: Lane M, 100bp 
ladder; Lane 1, C.jejuni; Lane 2, C.coli; Lane 3, Mixed (C.jejuni + C.coli) 
 
 
 
 
 
102 
1       2       3      M 
 
Figure 5.3. C. coli strains from different poultry production plants: Lane 1, 136 FDA; 
Lane 2, 137 FDA; Lane 3, 137 FDA; Lane M, Lambda marker 
 
 
 
 
103 
M       1      2       3       4       5       6       7 
 
Figure 5.4. Same poultry production plant but different plate comparison: Lane M, 
Lambda marker; Lane 1, 17 Line (A); Lane 2, 17 CC (A); Lane 3, 119 Kar (A); 
Lane 4, 237 Line (D); Lane 5, 113 Kar (A); Lane 6, 24 CC (B); Lane 7, 137 mCC 
(B) 
 
 
 
104 
M       1       2       3          4        5 
 
 
Figure 5.5. Same carcass different plate comparison: Lane M, Lambda marker; Lane 1, 
216 Kar; Lane 2, 216 FDA; Lane 3, 215 Kar;  Lane 4, 212 FDA; Lane 5, 215 CC 
 
 
 
 
105 
 
 
Figure 5.6. PFGE data analysis using the BioNumerics software, dendrogram of all the 
strains analyzed 
 
 
 
106 
 
Figure 5.7. Dendrogram showing the relatedness of a subset of Campylobacter jejuni 
 
 
 
107
 
  
Figure 5.8. Dendrogram showing the relatedness of a subset of Campylobacter jejuni isolated on various plate media 
 
 
 
108
 
 
Figure. 5.9. Dendrogram showing the relatedness of a subset of Campylobacter coli isolated on various plate media 
 
 
 
 
109 
CHAPTER VI: MULTIPLEX POLYMERASE CHAIN REACTION ASSAYS FOR 
SCREENING VIRULENCE GENES OF CAMPYLOBACTER JEJUNI ISOLATED 
FROM PROCESSED BROILERS 
 
6.1. Introduction 
The complete understanding of mechanism of campylobacteriosis, human 
diarrheal illness caused by Campylobacter infection is still an ongoing work and has not 
been completely determined. Various determinants of virulence, which are the result of 
the expression of various virulent genes, have been demonstrated for Campylobacter 
spp., including colonization, adhesion, invasion, and cytotoxin/ enterotoxin production 
(Bang et al., 2003); (Ketley, 1997). Grouping Campylobacter spp. based on their genetic 
profiles in combination with their virulence abilities can be an important step towards 
understanding their epidemiology; such a study can also contribute to more 
understanding of the pathogenicity pattern of this bacterium.  
Many protocols for isolation of Campylobacter from broiler carcasses have used 
direct plating media, but these are not comparable to each other, nor have they undergone 
full validation to warrant consistency with traditional techniques that include an 
enrichment step (Bashor et al., 2004); (Line et al., 2001; Stern & Robach, 2003); (Stern 
et al., 2001).  
 
 
 
110 
A recent study conducted in our laboratories evaluated different plate media for 
direct enumeration of Campylobacter spp. on broiler carcasses (Oyarzabal et al., 2005). 
Four commercial broiler processing facilities were sampled three times each. Twenty post 
chill carcasses were collected, rinsed and analyzed for the presence of Campylobacter 
spp. per visit (Oyarzabal et al., 2005).  
Among the virulence genes flagellin gene is the most studied and well 
characterized one (Nuijten et al., 1990). There is evidence of involvement of the flaA in 
the colonization of Campylobacter (Nachamkin et al., 1993); (Wassenaar et al., 1993). 
CadF, has been identified as an adhesion which is a 37-kD outer membrane protein 
(Konkel et al., 1997), and its participation in Campylobacter infection has been proven 
using animal models (Ziprin et al., 1999). Cytolethal Distending Toxin (CDT) is one of 
the cytotoxin that has been well characterized (Pickett et al., 1996); (Pickett & 
Whitehouse, 1999). CDT toxin is shown to be responsible for the cellular detention, and 
then death in cell lines (Johnson & Lior, 1988); (Pickett et al., 1996); (Bang et al., 2001). 
It has also been found that CDT blocks cell cycle in different phases (Whitehouse et al., 
1998). Another gene that has been associated with virulence of Campylobacter is wlaN 
gene. It is a ?-1, 3-galactosyltransfarase responsible for synthesis of Lipooligosaccharide 
(LOS) (Linton et al., 2000). Mutations in docA, encoding a periplasmic cytochrome C 
peroxidase reduced the colonization power of C. jejuni indicating its role in virulence 
(Hendrixson & DiRita, 2004). Studies have also shown mutations in the fliM, flagellar 
motor switch protein resulted in reduced in reduced motility (Bleumink-Pluym et al., 
1999); (Golden & Acheson, 2002). 
 
 
 
111 
The main objectives of the present work are as follow, to develop multiplex PCR 
assays to detect the following virulence genes: cdtA (blocking of eukaryotic genes in 
G2/early M phase), cadF (adhesion related), docA (colonization and infectivity), and 
several genes related to the flagella: flgB (basal body protein synthesis), flgE2 (hook 
protein), flhB (protein biosynthesis and export),  fliM (flagellar switch protein), wlaN 
(involved in LOS biosythensis) (Bang et al., 2003); (On & Jordan, 2003) in the same 
samples obtained on the different plate medias which were used for PFGE analysis. Test 
the validity of these multiplex reactions to detect virulence genes from other samples like 
retail samples and human samples that are positive for the presence of Campylobacter. 
 
6.2. Materials and Methods 
Sources of Samples 
Samples isolated from carcasses from poultry processing plants from US and 
Puerto Rico were analyzed for the presence of virulence genes. Nearly 90 samples from 
the poultry plants in the US and thirty samples from processing plants in Puerto Rico 
were screened. 
Sample Collection 
Twenty post-chill carcasses were collected, rinsed with 400ml of buffered 
peptone water and analyzed for the presence of Campylobacter spp. Carcass rinses were 
plated on six different plate media (Campy-Cefex, mCampy-Cefex, mCCDA, Karmali, 
CAMPY, Campy-Line) for enumeration. PFGE patterns of the isolates from different 
plates, same carcass; same kind of plate, different plants; and same kind of plate, same 
plant were compared.  
 
 
 
112 
 
Identification of Isolates 
Colonies obtained on Campy-Cefex, mCampy-Cefex, mCCDA, Karmali, 
CAMPY, Campy-Line were observed under a phase contrast microscope (1000x) for 
morphology and motility. 
DNA Extraction and PCR Confirmation 
Strains were grown from frozen stock cultures stored at -80oC in cryovials (65% 
TSB, 30% glycerol and 5% lysed horse blood). Cultures were streaked onto modified 
Campy-Cefex plates and were incubated at 42oC for 36-48 h. Colonies growing on plate 
medium were used for the DNA extraction. DNA was extracted using Prepman UltraTM 
(Applied Biosystems).  
A multiplex PCR targeting the cadF gene (C. jejuni and C. coli), the ceuE gene 
(C. coli only) and an unknown DNA fragment (C. jejuni only) was used to confirm the 
campylobacter spp. and genus (Cloak & Fratamico, 2002). 
 
Statistical Analysis 
Colony counts were converted to log10CFU/ml and analyzed using the general 
lineal procedure of SAS (SAS Institute Incorporated, Cary, NC). Means were analyzed 
for differences using Duncan test (SAS), and percentage values analyzed by a qualitative, 
McNemar chi-square (?2) analyses (one degree of freedom). Chi-square values less than 
3.84 indicated that percentages were equivalent and could not be rejected at the 5% level 
of confidence. 
 
 
 
 
113 
 
Multiplex PCR for Virulence Gene Identification 
Primers: (Table 6.1) shows the published primers that were used in this study 
(Bang et al., 2003; Konkel et al., 1999; Muller, 2006 ) A PTC-100 Programmable 
thermal control (MJ Research, Inc.) was used for all the PCRs. The steps of a single 
amplification cycle (Table 6.2) were: 95oC for 2 min (Denaturation), 50oC for 1 min 
(Annealing)*, 72oC for 2 min (Extension). 
*Annealing temperatures varied according to the primer sets being used (Table 6.3). Gels 
were stained in 0.1% etidium bromide solution, and the image captured in a SyngeneTM 
image cabinet. The Gene SnapTM program was used for further analysis of the gel. 
 
Sequencing of the Virulence Genes 
The PCR amplicons from the PCR reactions of eight virulence genes were 
purified and sent for amplification to the Auburn University Genomics & Sequencing 
Lab using an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City,CA). The 
sequences were BLASTed to obtain nucleotide-nucleotide sequence similarities 
(http://ncbi.nih.gov/BLAST/). 
 
6.3. Results 
Multiplex PCR & Virulence Gene Analysis 
The pre-made mix from PromegaTM was used for all the mPCRs. The use of 
OmniMix? (Cepheid, Sunnyvale, CA) did not give similar results. Many extra unspecific 
bands were seen at the end of a PCR when Omnimix was used. The four multiplex assays 
 
 
 
114 
developed have primers for genes fliM and docA (53oC); flgE2 and iamA (52oC); cdtA and 
flhB (50oC); and cadF and flgB (48oC). It was difficult to standardize a multiplex PCR for 
more than two pairs of primer set. Figure 6.1 shows how the addition of the third primer 
set started giving errors in the amplification reaction. 
Figure 6.2 shows the respective amplified product on a gel after it has been 
stained with ethidium bromide. The iamA gene did not appear in the multiplex PCR. 
Howerver, when used in individually in a PCR reaction with just the primers specific to 
the iamA gene it gave a positive result for most of the samples tested. 
Fifty-eight C. jejuni isolates obtained from one poultry processing plant were 
positive for flhB, flgB, flgE2, cdtA and docA. Thirty-six C. jejuni isolates from another 
processing plant were positive for the presence of these mentioned genes, except for docA 
gene. 
Another set of isolates obtained from these poultry processing plants, which are 
being used for PFGE studies, were also screened for virulence genes. Twenty samples of 
this set of seventy have been analyzed for presence of virulence genes whose results are 
shown in (Table 6.4). The only genes that were found in all isolates were flgB, flgE2, and 
flhB. 
Out of the thirty samples from Puerto Rico that were analyzed (Table 6.4) all 
were negative for the presence of iamA genes, 2 were negative for docA and 1 was 
negative for flhB gene. All the thirty samples showed the presence of flgB, cdtA and 
flgE2. 
 
 
 
 
 
115 
Sequencing Results 
Selected sequneces from the amplicons obtained by PCR were sequenced. A 
Multalin analsysis of these sequences with the specific genes sequences downloaded 
from the NCBI database showed that the amplified products for cdtA gene, and docA 
gene aligned well but the sequences for flhB, flgE2, flgB didn?t align well.  
 
6.4. Discussion 
Our results showed that some primer pairs worked better at annealing 
temperatures different from the ones mentioned by the previous researchers. This was 
checked because some of the products of the multiplex reactions upon confirmation of 
sequence alignment didn?t align well with the BLAST sequences and hence the primers 
that were used by previous researchers were used aligned with the corresponding genes 
from the BLAST sequences and the alignment was not very good. New primers will be 
designed and be used instead of these primers in future multiplex reactions. 
It has also been observed that the amplification works with PromegaTM master 
mix alone. The pre-made mix from PromegaTM was used for all the mPCRs as the use of 
OmniMix? (Cepheid, Sunnyvale, CA) did not give good results. One reason might be 
varying levels of stringencies of the two mixes because of presence of different 
concentration of enzymes, MgCl2, and dNTPs, which resulted in extra, unspecific bands 
when using Omnimix. Use of other mix (OmnimixTM) gave many extra unspecific bands; 
the reason may be varying levels of sensitivities between the two mixes. 
Even though primers with close melting temperatures (Tms) were used, more than 
four or six primers in a single multiplex reaction gave unspecific products; this may be 
 
 
 
116 
because of binding of primers at sites other than the targeted genes, bases pairing of 
different primers even before they go and bind the DNA for amplification. The use of 
these multiplex reactions can be extrapolated for rapid screening of Campylobacter 
strains with virulent genes.                                                                                          
 
 
 
 
 
117 
References 
 
Bang, D. D., F. Scheutz, P. Ahrens, K. Pedersen, J. Blom, and M. Madsen. 2001. 
Prevalence of cytolethal distending toxin (cdt) genes and CDT production in 
Campylobacter spp. isolated from Danish broilers. J. Med. Microbiol. 50: 1087-
1094. 
Bang, D. D., E. M. Nielsen, F. Scheutz, K. Pedersen, K. Handberg, and M. Madsen. 
2003. PCR detection of seven virulence and toxin genes of Campylobacter jejuni 
and Campylobacter coli isolates from Danish pigs and cattle and cytolethal 
distending toxin production of the isolates. J. Appl. Microbiol. 94: 1003-1014. 
Bashor, M. P., P. A. Curtis, K. M. Keener, B. W. Sheldon, S. Kathariou, and J. A. 
Osborne. 2004. Effects of carcass washers on Campylobacter contamination in 
large broiler processing plants. Poult. Sci. 83: 1232-1239. 
Bleumink-Pluym, N. M., F. Verschoor, W. Gaastra, B. A. Van Der Zeijst, and B. N. Fry. 
1999. A novel approach for the construction of a Campylobacter mutant library. 
Microbiology 145 ( Pt 8): 2145-2151. 
Cloak, O. M., and P. M. Fratamico. 2002. A multiplex polymerase chain reaction for the 
differentiation of Campylobacter jejuni and Campylobacter coli from a swine 
processing facility and characterization of isolates by pulsed-field gel 
electrophoresis and antibiotic resistance profiles. J. Food Prot. 65: 266-273. 
Golden, N. J., and D. W. Acheson. 2002. Identification of motility and autoagglutination 
Campylobacter jejuni mutants by random transposon mutagenesis. Infect. Immun. 
70: 1761-1771. 
 
 
 
118 
Hendrixson, D. R., and V. J. Dirita. 2004. Identification of Campylobacter jejuni genes 
involved in commensal colonization of the chick gastrointestinal tract. Mol. 
Microbiol. 52: 471-484. 
Johnson, W. M., and H. Lior. 1988. A new heat-labile cytolethal distending toxin 
(CLDT) produced by Campylobacter spp. Microb. Pathog. 4: 115-126. 
Ketley, J. M. 1997. Pathogenesis of enteric infection by Campylobacter. Microbiology 
143 ( Pt 1): 5-21. 
Konkel, M. E., S. G. Garvis, S. L. Tipton, D. E. Anderson, Jr., and W. Cieplak, Jr. 1997. 
Identification and molecular cloning of a gene encoding a fibronectin-binding 
protein (CadF) from Campylobacter jejuni. Mol. Microbiol. 24: 953-963. 
Konkel, M. E., S. A. Gray, B. J. Kim, S. G. Garvis, and J. Yoon. 1999. Identification of 
the enteropathogens Campylobacter jejuni and Campylobacter coli based on the 
cadF virulence gene and its product. J. Clin. Microbiol. 37: 510-517. 
Line, J. E., N. J. Stern, C. P. Lattuada, and S. T. Benson. 2001. Comparison of methods 
for recovery and enumeration of Campylobacter from freshly processed broilers. 
J. Food Prot. 64: 982-986. 
Linton, D., M. Gilbert, P. G. Hitchen, A. Dell, H. R. Morris, W. W. Wakarchuk, N. A. 
Gregson, and B. W. Wren. 2000. Phase variation of a beta-1,3 
galactosyltransferase involved in generation of the ganglioside GM1-like lipo-
oligosaccharide of Campylobacter jejuni. Mol. Microbiol. 37: 501-514. 
Muller, J., F. Schulze, W. Muller, and I. Hanel. 2006 PCR detection of virulence-
associated genes in Campylobacter jejuni strains with differential ability to invade 
Caco-2 cells and to colonize the chick gut. Vet. Microbiol. 113: 123-129. 
 
 
 
119 
Nachamkin, I., K. Bohachick, and C. M. Patton. 1993. Flagellin gene typing of 
Campylobacter jejuni by restriction fragment length polymorphism analysis. J. 
Clin. Microbiol. 31: 1531-1536. 
Nuijten, P. J., F. J. Van Asten, W. Gaastra, and B. A. Van Der Zeijst. 1990. Structural 
and functional analysis of two Campylobacter jejuni flagellin genes. J. Biol. 
Chem. 265: 17798-17804. 
On, S. L., and P. J. Jordan. 2003. Evaluation of 11 PCR assays for species-level 
identification of Campylobacter jejuni and Campylobacter coli. J. Clin. 
Microbiol. 41: 330-336. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Pickett, C. L., E. C. Pesci, D. L. Cottle, G. Russell, A. N. Erdem, and H. Zeytin. 1996. 
Prevalence of cytolethal distending toxin production in Campylobacter jejuni and 
relatedness of Campylobacter sp. cdtB gene. Infect. Immun. 64: 2070-2078. 
Pickett, C. L., and C. A. Whitehouse. 1999. The cytolethal distending toxin family. 
Trends Microbiol. 7: 292-297. 
Stern, N. J., P. Fedorka-Cray, J. S. Bailey & other authors. 2001. Distribution of 
Campylobacter spp. in selected U.S. poultry production and processing 
operations. J. Food Prot. 64: 1705-1710. 
Stern, N. J., and M. C. Robach. 2003. Enumeration of Campylobacter spp. in broiler 
feces and in corresponding processed carcasses. J. Food Prot. 66: 1557-1563. 
 
 
 
120 
Wassenaar, T. M., B. A. Van Der Zeijst, R. Ayling, and D. G. Newell. 1993. 
Colonization of chicks by motility mutants of Campylobacter jejuni demonstrates 
the importance of flagellin A expression. J. Gen. Microbiol. 139 Pt 6: 1171-1175. 
Whitehouse, C. A., P. B. Balbo, E. C. Pesci, D. L. Cottle, P. M. Mirabito, and C. L. 
Pickett. 1998. Campylobacter jejuni cytolethal distending toxin causes a G2-
phase cell cycle block. Infect. Immun. 66: 1934-1940. 
Ziprin, R. L., C. R. Young, L. H. Stanker, M. E. Hume, and M. E. Konkel. 1999. The 
absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not 
expressing bacterial fibronectin-binding protein. Avian Dis. 43: 586-589.
 
 
 
121 
Table 6.1. Primer sets used in the multiplex PCR for detection of virulence genes 
of Campylobacter spp. (Bang et al., 2003; Konkel et al., 1999; Muller, 2006 ) 
 
Target 
gene 
Primers Sequence(5'-3') 
PCR-product 
(bp) 
fliM 
CjfliM1 TCATCCTCCTCTTCAGGCTC 
1011 
CjfliM2 CACCGACACACCCATAGCCTC 
docA 
docA1 ATAAGGTGCGGTTTTGGC 
725 
docA2 GTCTTTGCAGTAGATATG 
flgE2 
flgE2-q-F CATCTCACCACGACCTCCTGTTC  
132 flgE2-q-R GCAAAAATCGCAATGGCTTCA 
 
cdtA 
GNW GGAAATTGGATTTGGGGCTATACT  
165 IVH ATCACAAGGATAATGGACAAT 
 
flhB 
flhB-q-F CAGGTGCGGATGTGGTGATC  
101 flhB-q-R CACTCCTTTGGCAACAACCCT 
 
cadF 
cadF2B TTGAAGGTAATTTAGATATG  
400 cadR1B CTAATACCTAAAGTTGAAAC 
 
flgB 
flgB-q-F GCACGATTTACCAAAGCTGTTTCAA  
123 flgB-q-R CACTGGTGCTTTAGCGGGTAGA 
 
 
 
122 
Table 6.2. Thermocycler conditions for 30 cycles 
 
 
Steps Temperature Time 
Denaturation 
95oC 2 min 
95oC 30 sec 
Annealing * 50oC 1 min 
Extension 
72oC 2 min 
72oC 5 min 
4oC unlimited 
 
*Annealing temperatures may vary depending upon the primer set being used 
 
 
 
 
123 
Table 6.3. Primer pairs that can be used in a various multiplex Polymerase chain 
reactions 
Genes Primers 
Annealing 
Temperatures 
fliM + docA CjfliM1, CjfliM2, docA1, docA2 53oC 
flgE2 flgE2-q-F, flgE2-q-R 52oC 
cdtA + flhB GNW, IVH, flgB-q-F, flgB-q-R 50oC 
cadF + flgB cadF2B, cadR1B, flgB-q-F, flgB-q-R 48oC 
 
 
 
 
124 
Table 6.4. Campylobacter strains isolated from poultry processing plants screened for the 
presence and absence of virulence genes 
Isolate ID fliM docA cadF flgB flgE2 cdtA flhB 
34 mCC + + - + + + + 
119 CCDA + + + + + + + 
237 line + + + + + + + 
34 CCDA + + + + + + + 
119 Kar + + + + + + + 
122 CCDA - - + + + - + 
137 mCC + + + + + + + 
24 Kar + + + + + + + 
24 FDA + + + + + + + 
17 CC + + + + + + + 
34 FDA + + + + + + + 
113 Kar + + + + + + + 
34 Kar + + + + + + + 
24 CCDA + + + + + + + 
17 mCC + + + + + + + 
24 CCDA + + + + + + + 
215 FDA + + - + + + + 
225 mCC + + + + + + + 
172 mCC + + + + + + + 
89 CC - + + + + + + 
 
 
 
 
 
 
 
 
 
 
 
 
 
125 
Table 6.5. Campylobacter strains isolated from poultry processing plants in Puerto Rico 
screened for the presence and absence of virulence genes 
 
P.rico samples flgB docA iamA flhB  cdtA flgE2 
PR11-4 + + - +  + + 
PR8 + + - +  + + 
PR(10)8 + + - +  + + 
PR7(6) + + - +  + + 
PR5(8) + + - +  + + 
PR4(7) + + - +  + + 
PR3(6) + + - +  + + 
PR2(5) + + - +  + + 
PR17-1 + + - +  + + 
PR14-5 + + - +  + + 
PR14-4 + + - +  + + 
PR14-2 + + - +  + + 
PR14-1 + + - +  + + 
PR13-4 + - - +  + + 
PR13-3 + + - +  + + 
PR13-2 + + - +  + + 
PR13-1 + + - +  + + 
PR12-4 + + - +  + + 
PR11-3 (21) + + - +  + + 
PR 11-3 + + - +  + + 
PR 10-5 + + - +  + + 
PR10-4 + + - +  + + 
PR10-3 + + - +  + + 
PR10-2 + - - +  + + 
PR1-4 + + - +  + + 
PR1 + + - +  + + 
PR + + - -  + + 
 
 
 
126 
 
 
Figure 6.1. Multiplex PCR showing unspecific amplification on use of more than 2 
primers for strain 34 Kar at 50oC : Lanes 1 = 100bp marker, 2 = flgB + docA, 3 = cdtA + 
flhB, 4 = flgB + docA + cdtA, 5 = flgB + docA + flhB, 6 = cdtA + flhB + flgB, 7 = cdtA + 
flhB + docA, 8 = flgB + docA + cdtA + flhB. 
M      1         2       3       4       5        6        7  
 
 
 
127 
 
 
Figure 6.2. Multiplex PCR for the screening of virulence genes of Sample 237 Line: 
Lanes 1 = 100 bp marker, 2 = fliM + docA (53oC), 3 = flgE2 + iamA (52oC), 4 = cdtA + 
flhB (50oC), 5 = cadF + flgB (48oC). 
 
M       1        2       3       4 
 
 
 
128 
CHAPTER VII: REDUCTION OF CAMPYLOBACTER JEJUNI AND 
CAMPYLOBACTER COLI ON RETAIL BROILER MEAT BY COMMERCIAL, 
LEMON-BASED MARINADES 
 
7.1. Introduction 
The prevalence of broiler retails samples contaminated with Campylobacter spp. 
is still high in the US (Oyarzabal et al., 2007); (Wong et al., 2007). Although several 
antimicrobial interventions strategies are currently used to reduce the number of 
Campylobacter spp. during the processing of broiler carcasses, the prevalence of 
contaminated carcasses and the number of Campylobacter cells in contaminated 
carcasses is still high (Oyarzabal et al., 2005) Few interventions are available before 
cooking to further increase the number of Campylobacter in retail broiler meat. A process 
that may have an impact on bacterial foodborne pathogens in meat is the marinade 
process done to tenderizers and/or increase flavors in meats.  
Marination is an age old method used to preserve foods. Various organic acid 
based marinades have been in use to prevent the growth of microorganisms in meat 
products. Applying marinade to meat or poultry enhances its flavor (Chen, 1982), 
increases its moisture retention and tenderness (Ang, 1987), preserves its color (Cassidy, 
1977), and inhibits the warmed over flavor (Mahon, 1963). The spices and extracts that 
are added to the marinades also have preservative and antioxidant properties which are 
 
 
 
129 
antifungal, antibacterial and antiviral (Farag et al., 1989; Larrondo et al., 1995). The 
antibacterial activity is based on low pH, high NaCl concentration, and various spices 
added to the marinade (Perko-Makela et al., 2000). A commercial marinade usually 
contains oil, salt, sugar, acids, antimicrobial substances, such as sorbic and benzoic acids, 
and additives to reduce the hardness and change the rheological properties (elasticity and 
viscosity) of the meat. The acid used in commercial marinades is usually acidic or citric 
acid, provided usually by the addition of vinegar or lemon juice, respectively. Marinades 
are used to soak food products (meat or vegetables) before cooking. The consumption of 
marinated meat has been increasing in the last decade. In Finland, for instance, it has 
been estimated that around 80% of the retail poultry are sold marinated (Bj?rkroth, 
2005). Additionally, marinades have been suggested to increase product safety and shelf 
life, although the limited research dealing with the impact of marinades on the microbial 
profile of meats suggests otherwise (Bj?rkroth, 2005). 
The objectives of this work were to evaluate the reduction of C. jejuni and C. coli 
in retail broiler meat by the addiction of commercial marinades. In the first series of 
experiments, meat was artificially inoculated with C. jejuni or C. coli strains and was 
marinated for 0.5, 6 or 24 h. Direct plating was used to count the surviving 
Campylobacter cells and a multiplex polymerase chain reaction assays (mPCR) and 
pulsed-field gel electrophoresis (PFGE) were used to identify and type the strains 
recovered after the experiments. In the second series of experiments, we tested the 
efficacy of three commercial marinades in 28 meat samples that were found to be 
naturally contaminated with Campylobacter spp. For these experiment, we used a 
marination time of 4 h. 
 
 
 
130 
 
7.2. Materials and Methods 
 
Marinades  
The marinades used in these studies were Baja Chipotle, which contains lime 
juice, vinegar, salt, and spices like chipotle, chili pepper, onion, and oregano; Herb and 
Garlic, which contains lime juice, vinegar, dried garlic and spices; and Mesquite, which 
contains lime juice, garlic powder, paprika, onion powder, spices and citric acid. These 
marinades are manufactured by Lawry?s Foods, Inc. (Fremont, CA). We also tested a 
lemon juice marinade containing 100% lemon juice made from concentrate (ReaLemon; 
Dr Pepper Snapple Group, Inc., Plano, TX). All marinades were purchased from a local 
food store. We also tested sterile water adjusted to pH 3 with 1N hydrochlorous acid. 
The composition of each of the marinade is as follow: 
 Real Lemon ? Contains 100% lemon juice made from concentrate. 
 Baja Chipotle ? Contains lime juice, vinegar, salt, and spices like chipotle, chilli 
pepper, onion, and oregano. 
 Herb and Garlic ? Contains lime juice, vinegar, dried garlic and spices. 
 Mesquite ? Contains lime juice, garlic powder, paprika, onion powder, spices and 
citric acid. 
 
Artificial inoculation of meat samples  
The Campylobacter strains used in these studies were C. jejuni 1065 and PR-13-4, 
and C. coli 947 and 956. Strains 947, 946 and 1065 have been isolated from retails, 
 
 
 
131 
broiler meat (Oyarzabal et al., 2007), while strain PR-13-4 has been isolated from fecal 
material of live broilers (Oyarzabal et al., 2008). Strains were started from freezer stocks 
and were cultured twice in modified Campy-Cefex (mCC) agar plates (Oyarzabal et al., 
2005) at 42oC for 24 h. Growth from three agar plates was dissolved into 4.5 ml 
phosphate buffer solution (PBS) and were adjusted to an OD600 nm value of 1.6 to 1.8. 
This inoculum was then diluted into 20 ml of PBS in a plastic, spray bottle for a final 
concentration of approximately 7 log CFU/ml. This inoculum was used to spray skinless, 
boneless breast meat that was purchased from local stores. The meat was cut in 16 pieces 
of square-shape (approximately 50 g each) breast meat that were spray (all sides) in a 
BLS II flow laminar cabinet. The pieces of meat were left to dry in the laminar flow 
cabinet for 1 h. The inoculated pieces of meat were then placed in plastic zip-lock bags 
(Glad) which were stored at ~4oC for 24 h.  
 
Marination of broiler meat 
 After 24 h, two inoculated pieces of breast fillet were placed in disinfected, 
plastic containers (The Glad Products Company, Oakland, CA) and were covered with 
300 ml of the marinade. The volume of marinade allowed for the complete coverage of 
the two pieces of breast fillets. Each marination experiment with artificially inoculate 
meat included the following treatments: two samples that were not marinated (control 
without marination), two samples marinated in sterile distilled water adjusted to pH 3, 
and two samples marinated in each of the following marinades: Baja Chipotle, Herb & 
Garlic, Mesquite and ReaLemon. All samples were marinated in 300 ml of the marinade 
and in plastic containers that were closed and placed at 4oC for the duration of the 
 
 
 
132 
marination. Three independent replicates were done for each inoculated strain. These 
replicates included the preparation of a new inoculation and the marination experiments. 
Samples inoculated with C. jejuni were marinated for 0.5, 6 or 24 h, while samples 
inoculated with C. coli were marinated for 6 h.  
 
Enumeration of Campylobacter spp. after marination 
At the end of the marination, meat portions were removed from the marinades, the 
excess of marinade was cleaned and each piece was weighed and place in sterile bags 
(Whirl-Pak?, Nasco, Fort Atkinson, WI). Bolton broth supplemented with 10% lysed 
horse blood was added at a volume of twice the weight amount of the meat. Samples 
were stomached for 1 minute and a 10-fold serial dilution was made in PBS tubes. 
Duplicate plates were made on mCC plates for enumeration of surviving Campylobacter 
cells. Agar plates were incubated under a microaerobic gas mix (10% CO2, 5% O2, and 
85% N2; Airgas, Radnor, PA) that was added into anaerobic jars by the 
evacuation/replacement methods using a MACSmics Jar Gassing System (Microbiology 
International, Frederick, MD). Presumptive Campylobacter colonies were counted on 
plates after incubation at 42oC for 42 h. Average counts from each marination were 
subtracted from the average count from the meat that were not marinated (control without 
marination).  
The meat samples were also enriched in Bolton broth under microaerobic 
conditions at 42oC for 24 h. A loopful of broth (~ 100 ml) was transferred to mCC plates, 
which were incubated under similar conditions for 48 h. Positive samples were 
determined by phase contrast analysis of presumptive colonies. In selected experiments, 
 
 
 
133 
presumptive colonies were stored at -80oC for further analysis as described under 
Identification and Typing of isolates. If no colonies were found on enumeration plates but 
the enriched sample was positive, a value of 10 CFU per g of meat was assigned for that 
sample. Samples were considered negative if no growth was found on enumeration plate 
or after the enrichment of the samples.  
 
Marination of meat naturally contaminated with Campylobacter spp.  
Forty-six breast (skinless, boneless) meat samples were screened for the presence 
of Campylobacter spp. from April 2008 to October 2008. Fourteen positive samples were 
used for these marination trails. Two independents marination runs were performed with 
each sample for a total of 28 experiments. Samples were screened for Campylobacter 
spp. by cutting 25 g of meat and enriching it in sterile plastic bags (Whirl-Pak?, Nasco, 
Fort Atkinson, WI) with 100 ml of Bolton broth (Oyarzabal et al., 2007). Samples were 
incubated at 42oC under microaerobic conditions for 48 h. Enriched samples were 
transferred to mCC plates that were incubated at at 42oC under microaerobic conditions 
for 48 h. Phase contrast microscopy was used to determine presumptive Campylobacter 
spp. 
Fifty g pieces were cut from samples that were found to be positive for 
Campylobacter spp. for the marination experiment with naturally occurring 
campylobacters. Meat samples were marinated with Real Lemon, Baja Chipotle, and 
Herb and Garlic at 4oC for 4 h, using 300 ml of each marinade per container. Two 50-g 
pieces were marinated per container. The pH of the different marinades was recorded 
before marination and at the end of the marination. After marination, the meat was 
 
 
 
134 
transferred into a sterile whirl pack bag using sterile forceps. Samples were enriched with 
200 ml of Bolton at 42oC for 48 h. Analysis of the enriched samples under phase contrast 
microscopy was used to determine presumptive positives. Enriched samples were also 
streaked onto mCC plates to confirm the presence of Campylobacter. Plates were 
incubated at 42oC for 48 h. Presumptive colonies under phase contrast microscopy were 
stored at -80oC in Brucella broth supplemented with 30% glycerol for further analysis. 
 
Identification and characterization of isolates 
Stock cultures were started on mCC paltes and bacterial DNA was extracted using 
Prepman UltraTM (Applied Biosystems, Foster City, CA). For selected inoculation 
experiments and for all naturally-occurring isolates, bacterial DNA was tested with a 
multiplex polymerase chain reaction (mPCR) assay that specifically reacts with C. jejuni 
and C. coli (Oyarzabal et al., 2007). To validate that the inoculated strain was the one 
recovered from the experiments when artificial inoculation was employed, we analyzed 
the isolates with pulsed-field gel electrophoresis (PFGE). This technique was selected 
because it provides a fingerprinting pattern for each isolate. These isolates can then be 
compared for relatedness to assure that the inoculated and the recovered strains are the 
same. PFGE was performed as described elsewhere (Oyarzabal et al., 2008). Briefly, A 
digestion of Salmonella choleraesuis ss. Choleraesuis serotype Braenderup H9812 
(ATCC BAA-664) was used as the DNA marker. Campylobacter DNA was digested with 
SmaI and restricted DNA fragments were separated with a contour-clamped 
homogeneous electric field (CHEF Mapper, Bio-Rad, Hercules, CA) in 1% agarose gel 
stained with ethidium bromide. The gels were visualized with a UV transilluminator 
 
 
 
135 
(Gel-Doc System, Bio-Rad), and a picture recorded using GeneSnap (Syngene, Frederick, 
MD). PFGE profiles were visually compared. 
 
Statistical analysis 
The reduction by each marinade treatment was calculated by subtracting the 
counts after the treatment with marinades from the inoculated samples that were not 
treated (control without marination). In the case of samples tested for reduction in 
naturally occurring Campylobacter also the Chi square analysis ( 2) or the McNemar's 
Test (McNemar, 1947) was used to calculate if there was any significant difference or not 
. A McNemar's test value ? 3.84 assumes the null hypothesis; that means that the test 
method (marination) and reference method (control) are equivalent and cannot be 
rejected at the 5% level of confidence (P < 0.05). 
 
7.3. Results 
Artificial inoculation of meat samples 
The average weight of the pieces that were artificially inoculated with 
Campylobacter strains was 56.7 g (? 2.5 SEM). Table 2 show the counts of C. jejuni after 
marination times of 0.5 and 24 h. A 0.5 h marination time showed a minimal reduction, 
of 0.07 to 0.23 log10 CFU per g for Baja Chipotle; Herb & Garlic, Mesquite and Water at 
pH 3. ReaLemon showed a higher decreased compared to tcontrols, but the reduction was 
not more than 1 log10 CFU per g of meat. 
A 24 h marination showed a higher reduction compared to non-marinated controls 
(Table 7.1). Water at pH 3 and Mesquite yielded a reduction of 0.24 and 0.79 log10 CFU 
 
 
 
136 
per g of meat, respectively. Baja Chipotle and Herb & Garlic resulted in a higher 
reduction, with 1.14 and 1.15 log10 CFU per g of meat, respectively. ReaLemon again 
showed the highest reduction with 3.59 log10 CFU per g of meat less than the non-
marinated control.  
A marination time of 6 h resulted in reductions of C. jejuni that were similar for 
Baja Chipotle, Herb & Garlic, Mesquite (0.45, 0.60 and 0.41 log10 CFU per g, 
respectively). Water did not result in any reduction. ReaLemon yielded the highest 
reduction (1.66 log10 CFU per g). This reduction was significant (P < 0.05) when 
compared to the reductions produced by the other marinades.  
The pattern was similar for the reductions of C. coli by marindes, with the 
difference that the reductions were higher than the values recorded for C. jejuni (Table 
7.2). The reduction produced by Baja Chipotle, Herb & Garlic and Mesquite were similar 
and in the range of 0.92 to 1.10 log10 CFU per g. Again, water at pH 3 resulted in a 
modest reduction of 0.29 log10 CFU per g, and ReaLemon showed the largest reduction, 
with 2.02 log10 CFU per g. The reduction by ReaLemon was significant (P < 0.05) when 
compared to the reductions produced by the other marinades. 
 
Naturally occurring Campylobacter spp  
Fourteen positive samples were used for these marination trails, with two 
independent experiments run with each sample. Yet, from 28 positive samples, only 15 
samples yielded positive controls. The rest of the samples (13) yielded negative controls. 
When determining the effects of marinades in naturally-occurring Campylobacter spp., 
there was a significant (P < 0.05) reduction by the marinades in comparison to the control 
 
 
 
137 
(non-marinated). In the case of Herb and Garlic there were two Campylobacter positive 
samples after marination, while only one sample was Campylobacter positive after 
marination with for Baja Chipotle and one after marination with ReaLemon (Table 7.3).  
 
Marinades pH  
Table 7.4 shows the average pH value for each of the marinades and the broiler 
meat surface at the beginning and at the end of 4 h marination. These values were 
recorded from the experiments with naturally contaminated meat. The lowest pH values 
were recorded with ReaLemon. For all marinations, the pH increase by 0.2 units and was 
significant. The pH values for the surface of the meat before marination was 6.27 and 
after marination reduced to almost 3.53 (real lemon). 
 
Pulse Field Gel Electrophoresis 
PFGE comparisons between the inoculated strains and the strains collected after 
direct plating showed that only the inoculated strains were recovered in the experiments 
with the artificially inoculated meat (Figure 7.1). 
 
7.4. Discussion 
The high prevalence of Campylobacter spp. in broiler retails meat requires a 
continuous search for alternatives to reduce the incidence of these pathogens in retail 
meat products. Our work was aimed at determining the impact of marinations in the 
control of Campylobacter spp., mainly C. jejuni and C. coli, in retail broiler meat. We 
chose breast meat because this product is the most common broiler meat product 
 
 
 
138 
available in retail stores across the US. We also wanted to test commercial marinades and 
the choice of the tested marinades was done based on marinades that are commonly sold 
in the US (Baja Chipotle, Herb and Garlic and Mesquite). We also tested lemon juice-
based marinade (ReaLemon) and sterile water at pH 3 because of their lower pH.  
There are few studies evaluating the effect of marinades on the reduction of 
Campylobacter in poultry meat. Because direct contact is required for marinades to 
induce chemical reaction for the tenderization of meat, and to provide the antimicrobial 
effects, we soaked the meat in plastic containers to assure that all the surfaces of a meat 
were in contact with the marinade. In our studies, the marination of meat for 0.5 and 6 h 
resulted in a minimal reduction of Campylobacter spp. (less than 1 Log10 CFU per g of 
meat). The limited effect of marinades on the reduction of C. jejuni has been linked to the 
buffering capability of meat, which can quickly neutralize the pH of acidic marinades 
(Bj?rkroth, 2005). The change in the acidic pH towards neutrality results in dissociation 
of the lipophilic acids and limits the antimicrobial effect of marinades. Interestingly, at 6 
h marination, we observed that the reduction of C. coli was much higher than the 
reduction recorded for C. jejuni strains. We believe this is the first report on the impact of 
marinades on C. coli. This Campylobacter species has been found to be more susceptible 
to the effect of low pH than C. jejuni, and culture broth adjusted to pH 5 had a 5 Log10 
CFU/ml reduction of C. coli versus only 2.5 Log10 CFU/ml reduction of C. jejuni during 
a 12-h contact time (Shaheen et al., 2007). It is apparent that more research should be 
done to elucidate the physiological properties of C. coli that make this Campylobacter 
species more susceptible to lower pH. 
 
 
 
 
139 
The antimicrobial effects of Baja Chipotle, Herb and Garlic and Mesquite applied 
for 6 h were similar to the effect of sterile water adjusted to pH 3. These findings suggest 
that the actual pH of the marinades may have been responsible for the antimicrobial 
effect against Campylobacter. However, when comparing the effects of these marinades 
with ReaLemon, which has a pH similar to Baja Chipotle (Table 7.4), it is clear that the 
pH by itself does not account for the antimicrobial effect. Also when water at pH 3 was 
used to marinate, the pH at the end of 4 h of marination dramatically increased to 5.98. 
Even on the surface of the meat the pH after marination increased the most in the case of 
water at pH 3.  Thus pH alone doesn?t seem to play a role in the reduction in numbers of 
campylobacters. It has been suggested that the antibacterial activity of marinades is based 
on low pH, organic acids, high NaCl concentration, and various spices added to the 
marinade (Perko-Makela et al., 2000). The most stable pH of the marinade before and 
after marination was seen in the case of Baja Chipotle in whose case the pH increased 
from 3.11 to 3.18. Yet, to overcome the buffering capacity of meat a high concentration 
of these substances or longer contact times are needed. In our studies, a longer contact 
time (24 h) of the marinade with the meat did provide a higher numerical reduction. This 
reduction, however, was in the range of only 1.1 Log10 CFU per g of meat, and only for 
two marinades (Baja Chipotle and Herb & Garlic). ReaLemon did yield a reduction that 
was higher than 3 Log10 CFU g of meat. However this long contact time in a lemon juice 
marinade (high content of citric acid) resulted in meat that lost most of its organoleptic 
charactersitics and was undesirable for human consumption.  
The first series of experiments allowed us to decide on a more realistic marination 
time that could be used for the testing of naturally contamianted retal broiler meat.  
 
 
 
140 
A 4 h marination time was deccided and all retail meat samples that were used in 
these experiments were analyzed for the presence of naturally occurring Campylobacter 
spp. . We used 14 positive samples to run 28 independent experiments. From these 
experiments, 15 experiments had controls that were positive while 13 experiments had 
controls that were negative. Although the meat pieces were from the same package and 
were considered as one sample, we used different breast fillets and apparently 
Campylobacter was present on some fillets but absent on other fillets. These findings 
highlights the difficulties of testing for naturally occurring Campylobacter spp. in retail 
broiler meat. The distribution of Campylobacter is not uniform across the sample and 
tehrefore we could not garantee that the rest of the meat was positive. In addition, 
because Campylobacter spp. are usually present in low numbers in retail broiler meat 
(Oyarzabal et al., 2007), there was a need to enrich the samples and therefore a direct 
enumeration procedure was not employed. 
We did find a significant decrease of Campylobacter spp. with Baja Chipotle, 
Herb & Garlic and ReLemon by chi-square analysis. However, the Kappa values and the 
accuracy index calculated in these comparisons suggest that the analyzed set of data is 
not large enough to draw any further conclusions. We believe a much larger data set 
should be analyzed to determine if a 4-h marination can indeed provide a consistent 
reduction of Campylobacter spp. in retail broiler meat. Some researchers have concluded 
that the buffering capability of meat may neutralize acidic marinades and thus the 
marinades may have less antimicrobial effects against bacterial pathogens (Bj?rkroth et 
al., 2005). However, there are several substances that may have antimicrobial effects in a 
marinade.  
 
 
 
141 
Some of these substances may be impacted by pH changes while others may just 
have an effect based on concentrations and contact with the bacteria. 
Other studies have reported that marination did not result in significant reductions 
in the numbers of C. jejuni in boiler meat. One study (Perko-Makela et al., 2000) 
determined the survival of C. jejuni on marinated chicken drumsticks and sliced breasts 
strips stored at 4oC. There was no significant difference in C. jejuni numbers between the 
marinated and non-marinated chicken meats. The marinade that was used was an 
emulsion of vegetable oil, water, spices and salt. In another study with poultry products 
in Finland, the low pH of marinades selected for lactic acid bacteria (LAB) bacteria and 
marinated meat spoiled faster. Again, no reduction of C. jejuni was found by the use of 
marinades (Lundstr?m and Bj?rkroth 2007). 
In summary, commercial marination did not provide a consistently significant 
reduction of C. jejuni or C. coli in short contact times (0.5 h). A contact time of 6 h still 
provided inconsistent reductions that were less than 1 Log CFU/g of meat, except for 
ReaLemon which provided a higher reduction. However, the meat marinated in 
ReaLemon for 6 h lost most of its quality. C. coli exhibited a higher numerical reduction 
than C. jejuni by these marinades, suggesting that unique physiological properties may 
render C. coli more susceptible to low pH. Finally, the trials to assess the antimicrobial 
effect of marinades on retail broiler meat naturally contaminated with Campylobacter 
spp. suggested that a 4-h marination time may provide a significant reduction. Yet these 
findings should be corroborated with a larger number of samples, and perhaps with other 
commercial marinades, to withdraw any further conclusions. 
 
 
 
142 
References 
 
 
Ang, C. Y. W., and L. L. Young. 1987. Effect of marination with sodium pyrophosphate 
solution on oxidative stability of frozen cooked broiler leg meat. Poult. Sci. 
66:676-678. 
Bj?rkroth, J., M. Ristiniemi, P. Vandamme, and H. Korkeala. 2005. Enterococcus species 
dominating in fresh modified-atmosphere-packaged, marinated broiler legs are 
overgrown by Carnobacterium and Lactobacillus species during storage at 6 
degrees C. Int. J. Food Microbiol. 97:267-276. 
Bj?rkroth, J. 2005. Microbial ecology of marinated meat products. Meat Science. 70:477-
480. 
Cassidy, J. P. 1977. Phosphates in meat processing. Food Prod. Dev. 11: 74-77. 
Chen, T. C. 1982. Studies on the marination of chicken parts for deep fat frying. J. Food 
Sci. 47:1016-1019. 
Farag, R. S., Z. Y. Daw, and S. H. Abo-Rays. 1989. Influence of some essential oils on 
Aspergillus parasiticus growth and production of aflatoxin in a synthetic medium. 
Journal of Food Science. 54:74-76. 
Larrondo, J. V., M. Agut, and M. A. Calvo-Toms. 1995. Antimicrobial activity of 
essences from Labiates. . Microbios. 82:171-172. 
Lundstr?m, H.-S. and J. Bj?rkroth. 2007. Lactic acid bacteria in marinades used for 
modified atmosphere packaged broiler chicken meat products. J. Food Prot. 
70:766-770.  
 
 
 
143 
McNemar, Q. 1947. Note on the sampling error of the difference between correlated 
proportions or percentages. Psychometrika 12:153-157. 
Oyarzabal O. A., S. B., L. L. Williams, a, J. Lastovica, R. S. Miller, S. J. Pierce, S. L. 
Vieira, and F. Rebollo-Carrato. 2008. Molecular typing, serotyping and 
cytotoxicity testing of Campylobacter jejuni strains isolated from commercial 
broilers in Puerto Rico. Journal of applied microbiology. 105:800-812. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A. 
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
Microbiol. Methods 69:129-136. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71:3351-3354. 
Perko-Makela, P., M. Koljonen, M. Mietttnen, and M. Hannien. 2000. Survival of 
Campylobacter jejuni in marinated and non-marinated chicken products. Journal 
of Food Safety 20:209-216. 
Shaheen, B. W., M. E. Miller, and O. A. Oyarzabal 2007. In vitro survival at low pH and 
acid adaptation response of Campylobacter jejuni and Campylobacter coli. 
Journal of Food Safety. 27:326-343. 
Wong, T. L., L. Hollis, A. Cornelius, C. Nicol, R. Cook, and J. A. Hudson. 2007. 
Prevalence, numbers, and subtypes of Campylobacter jejuni and Campylobacter 
coli in uncooked retail meat samples. J. Food Prot. 70:566-573. 
 
 
 
 
144 
Table 7.1.  Reduction of C. jejuni numbers under different marinades under refrigeration 
and two marination times (0.5 and 24 h) on inoculated C. jejuni in broiler breast 
meat. 
Marinade 
Mean Log CFU/g (? SEM) a 
0.5 h 24 H 
Baja Chipotle 0.26 (0.17) A 1.13 (0.19) B 
Herb & Garlic 0.26 (0.21) A 1.15 (0.17) B 
Mesquite 0.40 (0.30) A 0.76 (0.32) B 
ReaLemon 0.96 (0.50) A 3.58 (0.45) A 
Water (pH 3) 0.30 (0.20) A 0.26 (0.15) B 
 
a Each value is the mean of there independent trials with C. jejuni strain B 1065 and three 
indent trials with C. jejuni strain PR-13-4. SEM = standard error of the mean. Means in 
a column followed by different letters are statistically different (P < 0.05) by Duncan?s 
test. 
 
 
 
145 
Table 7.2.  Reduction of C. jejuni and C. coli numbers on different marinades applied for 
six h under refrigeration on inoculated C. jejuni and C. coli in broiler breast meat. 
Marinade 
Mean Log CFU/g (? SEM) a 
C. jejuni b C. coli b 
Baja Chipotle 0.45 (0.11) Bc 1.08 (0.23) Bc 
Herb & Garlic 0.61 (0.20) B 1.00 (0.15) B 
Mesquite 0.41 (0.09) B 0.90 (0.23) B 
ReaLemon 1.66 (0.38) A 1.96 (0.25) A 
Water (pH 3) 0.66 (0.03) B 0.58 (0.24) B 
 
a Each value is the mean of six independent trials (three replicates per strain) for two C. 
jejuni and two C. coli strains. SEM = standard error of the mean. Means in a column 
followed by different letters are statistically different (P < 0.05) by Duncan?s test. 
b The reduction for C. jejuni and C. coli were not statistically similar for most marinades, 
except for Baja Chipotle, in which the reduction observed for C. coli (1.08) was 
statistically higher than the one recorded for C. jejuni (0.45). 
c The reduction of C. coly was higher (P < 0.05 by Duncan?s test) than the reduction of C. 
jejuni by Baja Chipotle. 
 
 
 
146 
Table 7.3.  Detection of naturally occurring Campylobacter spp. in retail meat after the 
marination of the meat with Herb and Garlic, Baja Chipotle or ReaLemon for 4 h. Chi-
square (McNemar) comparison between control (non-marinated) and marinated samples. 
 
Control Versus 
Herb and 
Garlic 
Baja 
Chipotle 
Lemon 
Juice 
Chi Square  15.1 17.1 17.1 
Kappa  0.13 0.00 0.00 
Sensitivity 0.13 0.00 0.00 
Specificity 1.00 1.00 1.00 
False-negative rate 0.87 1.00 1.00 
Negative predictive value 0.50 0.46 0.46 
Accuracy 0.54 0.46 0.46 
 
 
 
 
147 
Table 7.4.  pH of the different marinades and the retail broiler meat  used in these 
experiment before and after four hours of marination  
Product Time of Monitoring pH Value (? SEM) 
Meat Before marination 6.27 (0.040) A 
Water at pH 3 Before marination 3.19 (0.017) G,H 
 After marination 5.98 (0.039) B 
 Meat after marination 5.74 (0.134) C 
Baja Chipotle Before marination 3.11 (0.006) H,I 
 After marination 3.18 (0.009) H 
 Meat after marination 3.99 (0.017) E 
Herb & Garlic Before marination 3.36 (0.004) F,G 
 After marination 3.53 (0.045) F 
 Meat after marination 4.25 (0.021) D 
ReaLemon Before marination 2.66 (0.006) J 
 After marination 2.97 (0.026) I 
 Meat after marination 3.53 (0.157) F 
 
SEM = standard error of the mean. 
 
 
 
148 
 
Figure 7.1. PFGE profiles of C. jejuni and C. coli isolates used in these studies. Line 1-2: 
C. coli 947 before inoculation (L1) and collected from Mesquite after inoculation (L2); 
Line 3-5, C. coli 956 before inoculation (L3) and collected from Herb and Garlic after 
inoculation (L4-5); Line 6: DNA marker, a digestion of Salmonella choleraesuis ss. 
Choleraesuis serotype Braenderup H9812 (ATCC BAA-664) ; Line 7-9, C. jejuni 1065 
before inoculation (L7) and collected from Baja Chipotle after inoculation (L8-9).
 
 
 
149 
DISSERTATION CONCLUSIONS 
 
The Oxyrase study gave the following results. Oxyrase in Bolton broth performed 
similar to Bolton broth with microaerobic gas mix. mCC + Oxyrase in petri plate 
(bagged) performed poorly. mCC + Oxyrase in OxyDish performed well. DGGE analysis 
showed the presence of different microbiota in the two enrichment broths. RFLP analysis 
also showed that different strains were present. 
The Bolton without microaerobic gas mix gave the following results. Microscopy and 
Plate results comparison showed no differences between the sub-samples for 
Campylobacter (P > 0.05). Campylobacter enriched in Bolton broth may not need a 
microaerobic gas mix to multiply. DGGE indicated the occurrence of diverse microbial 
population. RFLP analysis showed the presence of different strains. 
The pulsed-field gel electrophoresis study gave the following results. PFGE data 
revealed a considerable amount of diversity in the genomic profile of isolates from a 
single carcass. More than one strain of Campylobacter spp. were isolated from the same 
carcass. High prevalence rates in the processing facilities (78%, 78% and 62%, for plants 
A, B and C, respectively). However, one plant D showed a lower percentage (33%). 
The multiplex PCR for virulence genes study gave the following results. Three 
multiplex assays for six virulence genes developed. More than six primers in one assay 
resulted in unspecific amplicons.  
 
 
150 
Multiplex assays successfully used to screen virulence genes of C. jejuni strains from 
broiler carcasses from the US and C. jejuni from commercial broilers from Puerto Rico. 
The marination of retail broiler meat studies gave the following results. Significant 
reduction in Campylobacter numbers in inoculated meat in the marination with real 
lemon for 24 h at 4oC. Significant reduction in naturally occurring Campylobacter in 
retail broiler meat wen marinated with all the marinades 4 h at 4oC. 
Thus in combination the following studies gave the following results. Growth of 
Campylobacter from retail meat enriched in Bolton broth may not need a microaerobic 
gas mix. Oxyrase can be used as a supplement in the media for the growth of 
Campylobacter. Enrichment in Bolton with oxyrase and Bolton without the gas mix 
indicates a possibility of diverse microbial niche. Single broiler carcass inhabits more 
than one strain of Campylobacter. Multiplex PCR assays can now be used for detection 
of pathogenicity genes. Marinades can significantly reduce numbers of naturally occuring 
campylobacters.
 
 
151 
BIBLIOGRAPHY 
 
Adler, H. I., A. Carrasco, W. Crow, and J. S. Gill. 1981. Cytoplasmic membrane fraction 
that promotes septation in an Escherichia coli lon mutant. J. Bacteriol. 147: 326-
332. 
Al Rashid, S. T., I. Dakuna, H. Louie, D. Ng, P. Vandamme, W. Johnson, and V. L. 
Chan. 2000. Identification of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, 
arcobacter butzleri, and A. butzleri-like species based on the glyA gene. J. Clin. 
Microbiol. 38: 1488-1494. 
Allos, B. M., and M. J. Blaser. 1995. Campylobacter jejuni and the expanding spectrum 
of related infections. Clin. Infect. Dis. 20: 1092-1099; quiz 1100-1091. 
Allos, B. M. 2001. Campylobacter jejuni Infections: update on emerging issues and 
trends. Clin. Infect. Dis. 32: 1201-1206. 
Altekruse, S. F., N. J. Stern, P. I. Fields, and D. L. Swerdlow. 1999. Campylobacter 
jejuni--an emerging foodborne pathogen. Emerg. Infect. Dis. 5: 28-35. 
Ang, C. Y. W., and L. L. Young. 1987. Effect of marination with sodium pyrophosphate 
solution on oxidative stability of frozen cooked broiler leg meat. Poultry Science. 
66: 676-678. 
 
 
 
 
152 
Annable, M. J., A. D. Marshall, and P. Silley 1998. Optimization of incubation 
atmosphere for the growth of Campylobacter spp. and Helicobacter spp., In A. J. 
Lastovica, D. G Newell and E. E. Lastovica (ed.), edn: The Rustica Press, 
Pinelands, South Africa. 
Anonymous 1996. Pathogen reduction: hazard analysis and critical control point 
(HACCP) systems. 
Anonymous 2005. Thermotolerant Campylobacter. Detection and enumeration in foods: 
Nordic Committee on Food Analysis. 
Bacon, D. J., R. A. Alm, D. H. Burr, L. Hu, D. J. Kopecko, C. P. Ewing, T. J. Trust, and 
P. Guerry. 2000. Involvement of a plasmid in virulence of Campylobacter jejuni 
81-176. Infect. Immun. 68: 4384-4390. 
Bang, D. D., F. Scheutz, P. Ahrens, K. Pedersen, J. Blom, and M. Madsen. 2001. 
Prevalence of cytolethal distending toxin (cdt) genes and CDT production in 
Campylobacter spp. isolated from Danish broilers. J. Med. Microbiol. 50: 1087-
1094. 
Bang, D. D., E. M. Nielsen, K. Knudsen, and M. Madsen. 2003a. A one-year study of 
campylobacter carriage by individual Danish broiler chickens as the basis for 
selection of Campylobacter spp. strains for a chicken infection model. Epidemiol. 
Infect. 130: 323-333. 
Bang, D. D., E. M. Nielsen, F. Scheutz, K. Pedersen, K. Handberg, and M. Madsen. 
2003b. PCR detection of seven virulence and toxin genes of Campylobacter jejuni 
and Campylobacter coli isolates from Danish pigs and cattle and cytolethal 
distending toxin production of the isolates. J. Appl. Microbiol. 94: 1003-1014. 
 
 
153 
Bashor, M. P., P. A. Curtis, K. M. Keener, B. W. Sheldon, S. Kathariou, and J. A. 
Osborne. 2004. Effects of carcass washers on Campylobacter contamination in 
large broiler processing plants. Poult. Sci. 83: 1232-1239. 
Bennasar, A., C. Guasp, M. Tesar, and J. Lalucat. 1998. Genetic relationships among 
Pseudomonas stutzeri strains based on molecular typing methods. J. Appl. 
Microbiol. 85: 643-656. 
Birk, T., H. Ingmer, M. T. Andersen, K. Jorgensen, and L. Brondsted. 2004. Chicken 
juice, a food-based model system suitable to study survival of Campylobacter 
jejuni. Lett. Appl. Microbiol. 38: 66-71. 
Birren, B. W., E. Lai, S. M. Clark, L. Hood, and M. I. Simon. 1988. Optimized 
conditions for pulsed field gel electrophoretic separations of DNA. Nucleic Acids 
Res 16: 7563-7582. 
Bjorkroth, J., M. Ristiniemi, P. Vandamme, and H. Korkeala. 2005. Enterococcus species 
dominating in fresh modified-atmosphere-packaged, marinated broiler legs are 
overgrown by Carnobacterium and Lactobacillus species during storage at 6 
degrees C. Int. J. Food Microbiol. 97: 267-276. 
Bj?rkroth, J. 2005. Microbial ecology of marinated meat products. Meat Science. 70: 
477-480. 
Bleumink-Pluym, N. M., F. Verschoor, W. Gaastra, B. A. Van Der Zeijst, and B. N. Fry. 
1999. A novel approach for the construction of a Campylobacter mutant library. 
Microbiology 145 ( Pt 8): 2145-2151. 
Bolton, F. J., and L. Robertson. 1982. A selective medium for isolating Campylobacter 
jejuni/coli. J. Clin. Pathol. 35: 462-467. 
 
 
154 
Border, M. M., B. D. Firehammer, and L. L. Myers. 1974. Tube culture method for viable 
counts of Campylobacter fetus (Vibrio fetus). Appl. Microbiol. 28: 730-732. 
Bourke, B., P. M. Sherman, D. Woodward, H. Lior, and V. L. Chan. 1996. Pulsed-field 
gel electrophoresis indicates genotypic heterogeneity among Campylobacter 
upsaliensis strains. FEMS Microbiol. Lett. 143: 57-61. 
Bowdre, J. H., N. R. Krieg, P. S. Hoffman, and R. M. Smibert. 1976. Stimulatory effect 
of dihydroxyphenyl compounds on the aerotolerance of Spirillum volutans and 
Campylobacter fetus subspecies jejuni. Appl. Environ. Microbiol. 31: 127-133. 
Bradbury, W. C., M. A. Marko, J. N. Hennessy, and J. L. Penner. 1983. Occurrence of 
plasmid DNA in serologically defined strains of Campylobacter jejuni and 
Campylobacter coli. Infect. Immun. 40: 460-463. 
Butzler, J. P., and J. Oosterom. 1991. Campylobacter: pathogenicity and significance in 
foods. Int. J. Food Microbiol. 12: 1-8. 
Cassidy, J. P. 1977. Phosphates in meat processing. Food Prod. Dev. 11: 74-77. 
Champion, O. L., E. L. Best, and J. A. Frost. 2002. Comparison of pulsed-field gel 
electrophoresis and amplified fragment length polymorphism techniques for 
investigating outbreaks of enteritis due to campylobacters. J. Clin. Microbiol. 40: 
2263-2265. 
Chen, T. C. 1982. Studies on the marination of chicken parts for deep fat frying. Journal 
of Food Science. 47: 1016-1019. 
 
 
 
 
 
155 
Cloak, O. M., and P. M. Fratamico. 2002. A multiplex polymerase chain reaction for the 
differentiation of Campylobacter jejuni and Campylobacter coli from a swine 
processing facility and characterization of isolates by pulsed-field gel 
electrophoresis and antibiotic resistance profiles. J. Food Prot. 65: 266-273. 
Cohen, J. 1960. A coefficient of agreement for nominal scales. Educational and 
Psychological Measurement 20: 37-46. 
Cools, I., M. Uyttendaele, C. Caro, E. D'haese, H. J. Nelis, and J. Debevere. 2003. 
Survival of Campylobacter jejuni strains of different origin in drinking water. J. 
Appl. Microbiol. 94: 886-892. 
Cools, I., M. Uyttendaele, J. Cerpentier, E. D'haese, H. J. Nelis, and J. Debevere. 2005. 
Persistence of Campylobacter jejuni on surfaces in a processing environment and 
on cutting boards. Lett. Appl. Microbiol. 40: 418-423. 
Corry, J. E., D. E. Post, P. Colin, and M. J. Laisney. 1995. Culture media for the isolation 
of campylobacters. Int. J. Food Microbiol. 26: 43-76. 
Dabert, P., B. Sialve, J. P. Delgenes, R. Moletta, and J. J. Godon. 2001. Characterisation 
of the microbial 16S rDNA diversity of an aerobic phosphorus-removal 
ecosystem and monitoring of its transition to nitrate respiration. Appl. Microbiol. 
Biotechnol. 55: 500-509. 
De Melo, M. A., and J. C. Pechere. 1990. Identification of Campylobacter jejuni surface 
proteins that bind to Eucaryotic cells in vitro. Infect. Immun. 58: 1749-1756. 
 
 
 
 
 
156 
Dickins, M. A., S. Franklin, R. Stefanova, G. E. Schutze, K. D. Eisenach, I. Wesley, and 
M. D. Cave. 2002. Diversity of Campylobacter isolates from retail poultry 
carcasses and from humans as demonstrated by pulsed-field gel electrophoresis. J. 
Food Prot. 65: 957-962. 
Dingle, K. E., F. M. Colles, D. R. Wareing & other authors. 2001. Multilocus sequence 
typing system for Campylobacter jejuni. J. Clin. Microbiol. 39: 14-23. 
Doyle, M. P., and D. J. Roman. . 1981. Growth and survival of Campylobacter fetus 
subsp. jejuni as a function of temperature and of pH. J. Food Prot. 44: 596-601. 
Endtz, H. P., C. W. Ang, N. Van Den Braak & other authors. 2000. Molecular 
characterization of Campylobacter jejuni from patients with Guillain-Barre and 
Miller Fisher syndromes. J. Clin. Microbiol. 38: 2297-2301. 
Ercolini, D. 2004. PCR-DGGE fingerprinting: novel strategies for detection of microbes 
in food. J. Microbiol. Methods 56: 297-314. 
Escherich, T. 1989. The intestinal bacteria of the neonate and breast-fed infant. 1885. 
Rev. Infect. Dis. 11: 352-356. 
Eyers, M., S. Chapelle, G. Van Camp, H. Goossens, and R. De Wachter. 1993. 
Discrimination among thermophilic Campylobacter species by polymerase chain 
reaction amplification of 23S rRNA gene fragments. J. Clin. Microbiol. 31: 3340-
3343. 
Fahey, T., D. Morgan, C. Gunneburg, G. K. Adak, F. Majid, and E. Kaczmarski. 1995. 
An outbreak of Campylobacter jejuni enteritis associated with failed milk 
pasteurisation. J. Infect. 31: 137-143. 
 
 
 
157 
Farag, R. S., Z. Y. Daw, and S. H. Abo-Rays. 1989. Influence of some essential oils on 
Aspergillus parasiticus growth and production of aflatoxin in a synthetic medium. 
Journal of Food Science. 54: 74-76. 
Farnleitner, A. H., N. Kreuzinger, G. G. Kavka, S. Grillenberger, J. Rath, and R. L. 
Mach. 2000a. Comparative analysis of denaturing gradient gel electrophoresis and 
temporal temperature gradient gel electrophoresis in separating Escherichia coli 
uidA amplicons differing in single base substitutions. Lett. Appl. Microbiol. 30: 
427-431. 
Farnleitner, A. H., N. Kreuzinger, G. G. Kavka, S. Grillenberger, J. Rath, and R. L. 
Mach. 2000b. Simultaneous detection and differentiation of Escherichia coli 
populations from environmental freshwaters by means of sequence variations in a 
fragment of the beta-D-glucuronidase gene. Appl. Environ. Microbiol. 66: 1340-
1346. 
Florent, A. 1957. [Analogical characteristics of certain strains of Vibrio coli and Vibrio 
foetus; bovine intestinal adapation of V. coli.]. C. R. Seances Soc. Biol. Fil. 151: 
1055-1057. 
Friedman, C. R., Neimann, J., Wegener, H.C., Tauxe, R.V. 2000. Epidemiology of 
Campylobacter jejuni infections in the United States and other industrialized 
nations., 2nd edn. Washington, D.C.: American Society for Microbiology Press. 
Gardiner, K. 1991. Pulsed field gel electrophoresis. Anal. Chem. 63: 658-665. 
Genigeorgis, C., M. Hassuneh, and P. Collins. 1986. Campylobacter jejuni infection on 
poultry farms and its effect on poultry meat contamination during slaughtering. 
Journal of Food Protection. 49: 895?903. 
 
 
158 
George, H. A., P. S. Hoffman, R. M. Smibert, and N. R. Krieg. 1978. Improved media for 
growth and aerotolerance of Campylobacter fetus. J. Clin. Microbiol. 8: 36-41. 
Golden, N. J., A. Camilli, and D. W. Acheson. 2000. Random transposon mutagenesis of 
Campylobacter jejuni. Infect. Immun. 68: 5450-5453. 
Golden, N. J., and D. W. Acheson. 2002. Identification of motility and autoagglutination 
Campylobacter jejuni mutants by random transposon mutagenesis. Infect. Immun. 
70: 1761-1771. 
Gonzalez, I., K. A. Grant, P. T. Richardson, S. F. Park, and M. D. Collins. 1997. Specific 
identification of the enteropathogens Campylobacter jejuni and Campylobacter 
coli by using a PCR test based on the ceuE gene encoding a putative virulence 
determinant. J. Clin. Microbiol. 35: 759-763. 
Grant, C. C., M. E. Konkel, W. Cieplak, Jr., and L. S. Tompkins. 1993. Role of flagella in 
adherence, internalization, and translocation of Campylobacter jejuni in 
nonpolarized and polarized epithelial cell cultures. Infect. Immun. 61: 1764-1771. 
Guillain, G., G. Barre', and A. Strohl. 1916. Sur un syndrome de radiculonebrite avec 
hyperalbuminose du liquide cephalo-rachidien sans reaction cellulaire. Remarques 
sur les caracters cliniques et graphiques des reflexes tendineux. Bull. Soc. Med. 
Hop. Paris 40: 1462. 
Harrington, C. S., L. Moran, A. M. Ridley, D. G. Newell, and R. H. Madden. 2003. Inter-
laboratory evaluation of three flagellin PCR/RFLP methods for typing 
Campylobacter jejuni and C. coli: the CAMPYNET experience. J. Appl. 
Microbiol. 95: 1321-1333. 
 
 
 
159 
Hendrixson, D. R., B. J. Akerley, and V. J. Dirita. 2001. Transposon mutagenesis of 
Campylobacter jejuni identifies a bipartite energy taxis system required for 
motility. Mol. Microbiol. 40: 214-224. 
Hendrixson, D. R., and V. J. Dirita. 2004. Identification of Campylobacter jejuni genes 
involved in commensal colonization of the chick gastrointestinal tract. Mol. 
Microbiol. 52: 471-484. 
Hickey, T. E., A. L. Mcveigh, D. A. Scott, R. E. Michielutti, A. Bixby, S. A. Carroll, A. 
L. Bourgeois, and P. Guerry. 2000. Campylobacter jejuni cytolethal distending 
toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect. 
Immun. 68: 6535-6541. 
Hook, H., M. B. Ekegren, H. Ericsson, I. Vagsholm, and M. L. Danielsson-Tham. 2004. 
Genetic and epidemiological relationships among Campylobacter isolates from 
humans. Scand. J. Infect. Dis. 36: 435-442. 
Hunt, J. M. 1992. Campylobacter. In FDA Bacteriological Analytical Manual, 7th edn. 
pp: 77?94. Arlington , VA : Association of Official Analytical Chemists. 
Hunt, J. M., C. Abeyta, and T. Tran 2001. Isolation of Campylobacter species from food 
and water. Chapter 7. In: Food and Drug Administration Bacteriological 
Analytical Manual, 8th ed, Revision A/1998. Association of Official Chemists 
International, Arlington, VA. edn. 
Hutchinson, D. N., and F. J. Bolton. 1984. Improved blood free selective medium for the 
isolation of campylobacter jejuni from faecal specimens. J. Clin. Pathol. 37: 956-
957. 
 
 
 
160 
Johannessen, G. S., G. Johnsen, M. Okland, K. S. Cudjoe, and M. Hofshagen. 2007. 
Enumeration of thermotolerant Campylobacter spp. from poultry carcasses at the 
end of the slaughter-line. Lett. Appl. Microbiol. 44: 92-97. 
Johnsen, G., H. Kruse, and M. Hofshagen. 2007. Genotyping of thermotolerant 
Campylobacter from poultry slaughterhouse by amplified fragment length 
polymorphism. J. Appl. Microbiol. 103: 271-279. 
Johnson, W. M., and H. Lior. 1988. A new heat-labile cytolethal distending toxin 
(CLDT) produced by Campylobacter spp. Microb. Pathog. 4: 115-126. 
Ketley, J. M. 1997. Pathogenesis of enteric infection by Campylobacter. Microbiology 
143 ( Pt 1): 5-21. 
Kiggins, E. M., and W. N. Plastridge. 1956. Effect of gaseous environment on growth 
and catalase content of Vibrio fetus cultures of bovine origin. J. Bacteriol. 72: 
397-400. 
King, J. E. 2004. Software solutions for obtaining a Kappa-type statistic for use with 
multiple raters. In Annual meeting of the Southwest Educational Research 
Association. Dallas, Texas. 
Konkel, M. E., and W. Cieplak, Jr. 1992. Altered synthetic response of Campylobacter 
jejuni to cocultivation with human epithelial cells is associated with enhanced 
internalization. Infect. Immun. 60: 4945-4949. 
Konkel, M. E., S. G. Garvis, S. L. Tipton, D. E. Anderson, Jr., and W. Cieplak, Jr. 1997. 
Identification and molecular cloning of a gene encoding a fibronectin-binding 
protein (CadF) from Campylobacter jejuni. Mol. Microbiol. 24: 953-963. 
 
 
 
161 
Konkel, M. E., S. A. Gray, B. J. Kim, S. G. Garvis, and J. Yoon. 1999a. Identification of 
the enteropathogens Campylobacter jejuni and Campylobacter coli based on the 
cadF virulence gene and its product. J. Clin. Microbiol. 37: 510-517. 
Konkel, M. E., B. J. Kim, V. Rivera-Amill, and S. G. Garvis. 1999b. Bacterial secreted 
proteins are required for the internaliztion of Campylobacter jejuni into cultured 
mammalian cells. Mol. Microbiol. 32: 691-701. 
Konkel, M. E., M. R. Monteville, V. Rivera-Amill, and L. A. Joens. 2001. The 
pathogenesis of Campylobacter jejuni-mediated enteritis. Curr Issues Intest 
Microbiol 2: 55-71. 
Lara-Tejero, M., and J. E. Galan. 2000. A bacterial toxin that controls cell cycle 
progression as a deoxyribonuclease I-like protein. Science 290: 354-357. 
Lara-Tejero, M., and J. E. Galan. 2001. CdtA, CdtB, and CdtC form a tripartite complex 
that is required for cytolethal distending toxin activity. Infect. Immun. 69: 4358-
4365. 
Larrondo, J. V., M. Agut, and M. A. Calvo-Toms. 1995. Antimicrobial activity of 
essences from Labiates. . Microbios. 82: 171-172. 
Line, J. E., N. J. Stern, C. P. Lattuada, and S. T. Benson. 2001. Comparison of methods 
for recovery and enumeration of Campylobacter from freshly processed broilers. 
J. Food Prot. 64: 982-986. 
Linton, D., A. J. Lawson, R. J. Owen, and J. Stanley. 1997. PCR detection, identification 
to species level, and fingerprinting of Campylobacter jejuni and Campylobacter 
coli direct from diarrheic samples. J. Clin. Microbiol. 35: 2568-2572. 
 
 
 
162 
Linton, D., M. Gilbert, P. G. Hitchen, A. Dell, H. R. Morris, W. W. Wakarchuk, N. A. 
Gregson, and B. W. Wren. 2000. Phase variation of a beta-1,3 
galactosyltransferase involved in generation of the ganglioside GM1-like lipo-
oligosaccharide of Campylobacter jejuni. Mol. Microbiol. 37: 501-514. 
Lior, H., D. L. Woodward, J. A. Edgar, L. J. Laroche, and P. Gill. 1982. Serotyping of 
Campylobacter jejuni by slide agglutination based on heat-labile antigenic factors. 
J. Clin. Microbiol. 15: 761-768. 
Mahon, J. H. 1963. U. S. Patent No. 3. 104, 170. Food Tech. 18: 101-102. 
Manzano, M., L. Cocolin, C. Pipan, E. Falasca, G. A. Botta, C. Cantoni, and G. Comi. 
1997. Single-strand conformation polymorphism (SSCP) analysis of Listeria 
monocytogenes iap gene as tool to detect different serogroups. Mol. Cell. Probes 
11: 459-462. 
Mcfadyean, J., and S. Stockman. 1913. Report of the departmental committee appointed 
by the board of agriculture and fisheries to enquire into epizootic abortion. 
Appendix to part II. Abortion in Sheep: 1-64. His Majesty's stationery office, 
London, United Kingdom. 
Mcnemar, Q. 1947. Note on the sampling error of the difference between correlated 
proportions or percentages. Psychometrika 12: 153-157. 
Mead, P. S., L. Slutsker, V. Dietz, L. F. Mccaig, J. S. Bresee, C. Shapiro, P. M. Griffin, 
and R. V. Tauxe. 1999. Food-related illness and death in the United States. 
Emerg. Infect. Dis. 5: 607-625. 
 
 
 
 
163 
Michaud, S., R. D. Arbeit, and C. Gaudreau. 2001. Molecular strain typing of 
Campylobacter jejuni by pulsed-field gel electrophoresis in a single day. Can. J. 
Microbiol. 47: 667-669. 
Mooney, A., M. Clyne, T. Curran, D. Doherty, B. Kilmartin, and B. Bourke. 2001. 
Campylobacter upsaliensis exerts a cytolethal distending toxin effect on HeLa 
cells and T lymphocytes. Microbiology 147: 735-743. 
Muller, J., F. Schulze, W. Muller, and I. Hanel. 2006 PCR detection of virulence-
associated genes in Campylobacter jejuni strains with differential ability to invade 
Caco-2 cells and to colonize the chick gut. Vet. Microbiol. 113: 123-129. 
Muyzer, G., E. C. De Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial 
populations by denaturing gradient gel electrophoresis analysis of polymerase 
chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 
59: 695-700. 
Muyzer, G., and K. Smalla. 1998. Application of denaturing gradient gel electrophoresis 
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial 
ecology. Antonie Van Leeuwenhoek 73: 127-141. 
Myers, R. M., S. G. Fischer, L. S. Lerman, and T. Maniatis. 1985. Nearly all single base 
substitutions in DNA fragments joined to a GC-clamp can be detected by 
denaturing gradient gel electrophoresis. Nucleic Acids Res 13: 3131-3145. 
Nachamkin, I., K. Bohachick, and C. M. Patton. 1993. Flagellin gene typing of 
Campylobacter jejuni by restriction fragment length polymorphism analysis. J. 
Clin. Microbiol. 31: 1531-1536. 
 
 
 
164 
Nachamkin, I., B. M. Allos, and T. Ho. 1998. Campylobacter species and Guillain-Barre 
syndrome. Clin. Microbiol. Rev. 11: 555-567. 
Nuijten, P. J., C. Bartels, N. M. Bleumink-Pluym, W. Gaastra, and B. A. Van Der Zeijst. 
1990a. Size and physical map of the Campylobacter jejuni chromosome. Nucleic 
Acids Res 18: 6211-6214. 
Nuijten, P. J., F. J. Van Asten, W. Gaastra, and B. A. Van Der Zeijst. 1990b. Structural 
and functional analysis of two Campylobacter jejuni flagellin genes. J. Biol. 
Chem. 265: 17798-17804. 
Nuijten, P. J., B. A. Van Der Zeijst, and D. G. Newell. 1991. Localization of 
immunogenic regions on the flagellin proteins of Campylobacter jejuni 81116. 
Infect. Immun. 59: 1100-1105. 
On, S. L., E. M. Nielsen, J. Engberg, and M. Madsen. 1998. Validity of SmaI-defined 
genotypes of Campylobacter jejuni examined by SalI, KpnI, and BamHI 
polymorphisms: evidence of identical clones infecting humans, poultry, and 
cattle. Epidemiol. Infect. 120: 231-237. 
On, S. L., and P. J. Jordan. 2003. Evaluation of 11 PCR assays for species-level 
identification of Campylobacter jejuni and Campylobacter coli. J. Clin. 
Microbiol. 41: 330-336. 
Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya. 1989. Detection of 
polymorphisms of human DNA by gel electrophoresis as single-strand 
conformation polymorphisms. Proc. Natl. Acad. Sci. U. S. A. 86: 2766-2770. 
 
 
 
 
165 
Owen, R. J., and S. Leaper. 1981. Base composition, size and nucleotide sequence 
similarities of genome deoxyribonucleic acids from species of the genus 
Campylobacter. FEMS Microbiol. Lett. 12: 395-400. 
Oyarzabal O. A., S. B., L. L. Williams, a, J. Lastovica, R. S. Miller, S. J. Pierce, S. L. 
Vieira, and F. Rebollo-Carrato. . 2008. Molecular typing, serotyping and 
cytotoxicity testing of Campylobacter jejuni strains isolated from commercial 
broilers in Puerto Rico. Journal of applied microbiology. 105: 800-812. 
Oyarzabal, O. A., I. V. Wesley, K. M. Harmon, L. Schroeder-Tucker, J. M. Barbaree, L. 
H. Lauerman, S. Backert, and D. E. Conner. 1997. Specific identification of 
Campylobacter fetus by PCR targeting variable regions of the 16S rDNA. Vet. 
Microbiol. 58: 61-71. 
Oyarzabal, O. A., K. S. Macklin, J. M. Barbaree, and R. S. Miller. 2005. Evaluation of 
agar plates for direct enumeration of Campylobacter spp. from poultry carcass 
rinses. Appl. Environ. Microbiol. 71: 3351-3354. 
Oyarzabal, O. A., S. Backert, M. Nagaraj, R. S. Miller, S. K. Hussain, and E. A. 
Oyarzabal. 2007. Efficacy of supplemented buffered peptone water for the 
isolation of Campylobacter jejuni and C. coli from broiler retail products. J. 
Microbiol. Methods 69: 129-136. 
Palmer, S. R., P. R. Gully, J. M. White, A. D. Pearson, W. G. Suckling, D. M. Jones, J. C. 
Rawes, and J. L. Penner. 1983. Water-borne outbreak of campylobacter 
gastroenteritis. Lancet 1: 287-290. 
 
 
 
 
166 
Parkhill, J., B. W. Wren, K. Mungall & other authors. 2000. The genome sequence of the 
food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. 
Nature 403: 665-668. 
Paulsen, P., P. Kanzler, F. Hilbert, S. Mayrhofer, S. Baumgartner, and F. J. Smulders. 
2005. Comparison of three methods for detecting Campylobacter spp. in chilled 
or frozen meat. Int. J. Food Microbiol. 103: 229-233. 
Pavlovskis, O. R., D. M. Rollins, R. L. Haberberger, Jr., A. E. Green, L. Habash, S. 
Strocko, and R. I. Walker. 1991. Significance of flagella in colonization resistance 
of rabbits immunized with Campylobacter spp. Infect. Immun. 59: 2259-2264. 
Pei, Z., C. Burucoa, B. Grignon, S. Baqar, X. Z. Huang, D. J. Kopecko, A. L. Bourgeois, 
J. L. Fauchere, and M. J. Blaser. 1998. Mutation in the peb1A locus of 
Campylobacter jejuni reduces interactions with epithelial cells and intestinal 
colonization of mice. Infect. Immun. 66: 938-943. 
Penner, J. L., and J. N. Hennessy. 1980. Passive hemagglutination technique for 
serotyping Campylobacter fetus subsp. jejuni on the basis of soluble heat-stable 
antigens. J. Clin. Microbiol. 12: 732-737. 
Perko-Makela, P., M. Koljonen, M. Mietttnen, and M. Hannien. 2000. Survival of 
Campylobacter jejuni in marinated and non-marinated chicken products. Journal 
of Food Safety 20: 209-216. 
Pickett, C. L., E. C. Pesci, D. L. Cottle, G. Russell, A. N. Erdem, and H. Zeytin. 1996. 
Prevalence of cytolethal distending toxin production in Campylobacter jejuni and 
relatedness of Campylobacter sp. cdtB gene. Infect. Immun. 64: 2070-2078. 
 
 
 
167 
Pickett, C. L., and C. A. Whitehouse. 1999. The cytolethal distending toxin family. 
Trends Microbiol. 7: 292-297. 
Pintar, K., A. Cook, F. Pollari, A. Ravel, S. Lee, and J. A. Odumeru. 2007. Quantitative 
effect of refrigerated storage time on the enumeration of Campylobacter, Listeria, 
and Salmonella on artificially inoculated raw chicken meat. J. Food Prot. 70: 
739-743. 
Potturi-Venkata, L. P., S. Backert, A. J. Lastovica, S. L. Vieira, R. A. Norton, R. S. 
Miller, S. Pierce, and O. A. Oyarzabal. 2007a. Evaluation of different plate media 
for direct cultivation of Campylobacter species from live broilers. Poult. Sci. 86: 
1304-1311. 
Potturi-Venkata, L. P., S. Backert, S. L. Vieira, and O. A. Oyarzabal. 2007b. Evaluation 
of logistic processing to reduce cross-contamination of commercial broiler 
carcasses with Campylobacter spp. J. Food Prot. 70: 2549-2554. 
Ribot, E. M., C. Fitzgerald, K. Kubota, B. Swaminathan, and T. J. Barrett. 2001. Rapid 
pulsed-field gel electrophoresis protocol for subtyping of Campylobacter jejuni. J. 
Clin. Microbiol. 39: 1889-1894. 
Rivera-Amill, V., B. J. Kim, J. Seshu, and M. E. Konkel. 2001. Secretion of the 
virulence-associated Campylobacter invasion antigens from Campylobacter jejuni 
requires a stimulatory signal. J. Infect. Dis. 183: 1607-1616. 
Rodrigues, L. C., J. M. Cowden, J. G. Wheeler & other authors. 2001. The study of 
infectious intestinal disease in England: risk factors for cases of infectious 
intestinal disease with Campylobacter jejuni infection. Epidemiol. Infect. 127: 
185-193. 
 
 
168 
Rosef, O. 1981. Isolation of Campylobacter fetus subsp. jejuni from the gallbladder of 
normal slaughter pigs, using an enrichment procedure. Acta Vet. Scand. 22: 149-
151. 
Sails, A. D., D. R. A. Wareing, and F. J. Bolton 1998. Evaluation of three microaerobic 
systems for the growth and recovery of Campylobacter spp., In A. J. Lastovica, D. 
G Newell and E. E. Lastovica (ed.) edn: The Rustica Press, Pinelands, South 
Africa. 
Schnaitman, C. A. 1970. Protein composition of the cell wall and cytoplasmic membrane 
of Escherichia coli. J. Bacteriol. 104: 890-901. 
Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs 
by pulsed field gradient gel electrophoresis. Cell 37: 67-75. 
Sebald, M., and M. Veron. 1963. [Base DNA Content and Classification of Vibrios.]. 
Ann. Inst. Pasteur (Paris). 105: 897-910. 
Sellers, J., and B. Kiepper 2001.U.S. Egg and Poultry Association.A survey of 
wastewater treatment practices and experiences in the poultry processing industry. 
In Completed Research project #562. 
Shaheen, B. W., M. E. Miller, and O. A. Oyarzabal 2007. In vitro survival at low pH and 
acid adaptation response of Campylobacter jejuni and Campylobacter coli. 
Journal of Food Safety. 27: 326-343. 
Sheffield, V. C., D. R. Cox, L. S. Lerman, and R. M. Myers. 1989. Attachment of a 40-
base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the 
polymerase chain reaction results in improved detection of single-base changes. 
Proc. Natl. Acad. Sci. U. S. A. 86: 232-236. 
 
 
169 
Shimada, K., and H. Tsuji. 1986. Enrichment for detection of Campylobacter jejuni. J. 
Clin. Microbiol. 23: 887-890. 
Simpson, J. M., V. J. Mccracken, B. A. White, H. R. Gaskins, and R. I. Mackie. 1999. 
Application of denaturant gradient gel electrophoresis for the analysis of the 
porcine gastrointestinal microbiota. J. Microbiol. Methods 36: 167-179. 
Skirrow, M. B. 1991. Epidemiology of Campylobacter enteritis. Int. J. Food Microbiol. 
12: 9-16. 
Smith, S. I., D. K. Olukoya, A. J. Fox, and A. O. Coker. 1999. Flagellin gene 
polymorphism analysis of Campylobacter compared with antigen serotyping. Z. 
Naturforsch. [C]. 54: 946-951. 
Smith, T., and M. S. Taylor. 1919. Some morphological and biochemical characters of 
the spirilla (Vibrio fetus n. sp.) associated with disease of the fetal membranes in 
cattle. J. Exp. Med. 30: 299-312. 
Solomon, E. B., and D. G. Hoover. 1999. Campylobacter jejuni: A bacterial paradox. 
Journal of Food Safety 19: 121-136. 
Steinbrueckner, B., F. Ruberg, and M. Kist. 2001. Bacterial genetic fingerprint: a reliable 
factor in the study of the epidemiology of human campylobacter enteritis? J. Clin. 
Microbiol. 39: 4155-4159. 
Stern, N. J., P. Fedorka-Cray, J. S. Bailey & other authors. 2001. Distribution of 
Campylobacter spp. in selected U.S. poultry production and processing 
operations. J. Food Prot. 64: 1705-1710. 
Stern, N. J., and M. C. Robach. 2003. Enumeration of Campylobacter spp. in broiler 
feces and in corresponding processed carcasses. J. Food Prot. 66: 1557-1563. 
 
 
170 
Studer E., B. W., M. Domke, J. Luthy, S. Schmid, and U. Candrian. 1998. RFLP and 
sequence analysis of Campylobacter jejuni and Campylobacter coli products 
amplified directly from environmaental samples. Lebensm, -Wiss. u. Technol. 31: 
537-545. 
Szalanski, A. L., C. B. Owens, T. Mckay, and C. D. Steelman. 2004. Detection of 
Campylobacter and Escherichia coli O157:H7 from filth flies by polymerase 
chain reaction. Med. Vet. Entomol. 18: 241-246. 
Tran, T. T. 1995. Evaluation of Oxyrase enrichment method for isolation of 
Campylobacter jejuni from inoculated foods. Lett. Appl. Microbiol. 21: 345-347. 
Veron, M., and R. Chatelian. 1973. Taxonomic study of the genus Campylobacter Sebald 
and Veron designation of the neotype strain for the type species Campylobacter 
fetus (Smith and Taylor) Sebald and Veron. Int. J. Syst. Bacteriol. 23: 122-134. 
Vinzent, R. 1949. Not Available. Presse Med. 57: 1230-1232. 
Vinzent, R., J. Dumas, and N. Picard. 1947. Septicemie grave eu cours de la grossesse, 
due a' un vibrion. Avortement consecutif. C. R. Acad. Med. 131: 90. 
Vogt, R. L., H. E. Sours, T. Barrett, R. A. Feldman, R. J. Dickinson, and L. Witherell. 
1982. Campylobacter enteritis associated with contaminated water. Ann. Intern. 
Med. 96: 292-296. 
Vogt, R. L., A. A. Little, C. M. Patton, T. J. Barrett, and L. A. Orciari. 1984. Serotyping 
and serology studies of campylobacteriosis associated with consumption of raw 
milk. J. Clin. Microbiol. 20: 998-1000. 
 
 
 
 
171 
Wassenaar, T. M., B. A. Van Der Zeijst, R. Ayling, and D. G. Newell. 1993. 
Colonization of chicks by motility mutants of Campylobacter jejuni demonstrates 
the importance of flagellin A expression. J. Gen. Microbiol. 139 Pt 6: 1171-1175. 
Wassenaar, T. M., B. N. Fry, and B. A. Van Der Zeijst. 1995. Variation of the flagellin 
gene locus of Campylobacter jejuni by recombination and horizontal gene 
transfer. Microbiology 141 ( Pt 1): 95-101. 
Wassenaar, T. M., B. Geilhausen, and D. G. Newell. 1998. Evidence of genomic 
instability in Campylobacter jejuni isolated from poultry. Appl. Environ. 
Microbiol. 64: 1816-1821. 
Wassenaar, T. M., and D. G. Newell. 2000. Genotyping of Campylobacter spp. Appl. 
Environ. Microbiol. 66: 1-9. 
Whitehouse, C. A., P. B. Balbo, E. C. Pesci, D. L. Cottle, P. M. Mirabito, and C. L. 
Pickett. 1998. Campylobacter jejuni cytolethal distending toxin causes a G2-phase 
cell cycle block. Infect. Immun. 66: 1934-1940. 
Willis, W. L., and C. Murray. 1997. Campylobacter jejuni seasonal recovery observations 
of retail market broilers. Poult. Sci. 76: 314-317. 
Winters, D. K., and M. F. Slavik. 1995. Evaluation of a PCR based assay for specific 
detection of Campylobacter jejuni in chicken washes. Mol. Cell. Probes 9: 307-
310. 
Wong, T. L., L. Hollis, A. Cornelius, C. Nicol, R. Cook, and J. A. Hudson. 2007. 
Prevalence, numbers, and subtypes of Campylobacter jejuni and Campylobacter 
coli in uncooked retail meat samples. J. Food Prot. 70: 566-573. 
 
 
 
172 
Wonglumsom, W., A. Vishnubhatla, J. M. Kim, and D. Y. Fung. 2001. Enrichment 
media for isolation of Campylobacter jejuni from inoculated ground beef and 
chicken skin under normal atmosphere. J. Food Prot. 64: 630-634. 
Yan, W., N. Chang, and D. E. Taylor. 1991. Pulsed-field gel electrophoresis of 
Campylobacter jejuni and Campylobacter coli genomic DNA and its 
epidemiologic application. J. Infect. Dis. 163: 1068-1072. 
Ziprin, R. L., C. R. Young, L. H. Stanker, M. E. Hume, and M. E. Konkel. 1999. The 
absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not 
expressing bacterial fibronectin-binding protein. Avian Dis. 43: 586-589.