Reproductive Confinement of Common Carp, Cyprinus carpio, and Channel 
Catfish, Ictalurus punctatus, via Transgenic Sterilization 
 
 
by 
 
Baofeng Su 
 
 
 
 
A dissertation submitted to the Graduate Faculty of 
Auburn University 
in partial fulfillment of the 
requirements for the Degree of 
Doctor of Philosophy 
 
Auburn, Alabama 
December 8, 2012 
 
 
 
 
Keywords: Transgenic Sterilization, Common Carp, Channel Catfish, PGC Gene Expression 
 
 
Copyright 2012 by Baofeng Su 
 
 
Approved by 
 
Rex A. Dunham, Chair, Professor of Fisheries and Allied Aquacultures 
Eric Peatman, Co-chair, Assistant Professor of Fisheries and Allied Aquacultures 
Nannan Liu, Professor of Entomology and Pathology 
 
ii 
 
Abstract 
 
 
    Transgenic animals had shown great potential for increasing growth rate, ability to 
resist disease, and for use as tool to research in forward and reverse genetics. Genetically 
modified animals could pose ecological risk to the environment upon escapement. 
Modified sterile feral constructs based on sterile feral concept and technology has been 
applied to reproductively control the genetically modified animals in the field of 
aquaculture.  
    Constructs utilzing short hair-pin structures to produce cDNA, theoretically could 
control primordial germ cell (PGC) marker genes, nanos, vasa and dead end (dnd) in 
channel catfish, Ictalurus punctatus.  Constructs were electroporated into embryos of 
common carp and channel catfish. Ideally, the embryos would undergo normal 
development and the gonad would form and mature in the presence of repressible 
compounds. However, without repressible chemicals, the gonad would not develop 
normally. Real-time PCR was used to test the relative temporal expression level of 
natural PGC marker gene expression between constructs electroporated and no constructs 
non-electroporated embryos (common carp) and no constructs electroporate embryos 
(channel catfish). Sexual maturity of electroporated and control channel catfish and 
common carp were evaluated.  
    In the case of knockdown common carp, two proteins, nanos and dead end were 
targeted and a third related, but off-target PGC protein, vasa, was assayed. The 
effectiveness of constructs varied depending upon the promoter.  The expression levels of 
these proteins naturally decreased during development. In some, but not all cases, the 
expression of targeted mRNA was knocked down to minimal levels or degradation 
accelerated. Up-regulation was also observed for dead end, possibly due to interferon 
responses. In other cases, the sterilization constructs had little effect on the targeted gene, 
 
iii 
 
but strongly down-regulated one or two of the alternative PGC genes examined in this 
study. At 19 months of age, common carp males exposed to these constructs had reduced 
rates of sexual maturity, but evaluation of reduction of female rates of sexual maturity 
were inconclusive.  
    In the case of channel catfish electroporated with the knockdown constructs some 
constructs knocked down PGC genes at certain time points. As was the case with 
common carp, some constructs appeared to induce sterility in catfish at 3-year of age.   
    Further experimentation is needed to evaluate sterility in the F1 generation. Potential 
pleiotropic effects of these PGC knockdown constructs should be evaluated, especially 
since off-target effect was observed.
 
iv 
 
Acknowledgment 
 
 
    The author would like to thank all the undergraduate students in Dr. Dunham?s group 
who worked as a team during spawning seasons and performed the hard work of 
harvesting ponds and feeding the brood fish. Without the kind help from Randell 
Goodman, Deborah Beam and Mark Peterman, field work and experiments could not go 
smoothly and successfully. I will not forget the help  
and Donny Wade for their labors in the field. I would also like to extend my sincere 
thanks to Karen Booker, Susan Smith, Mary Hahn, Dr. William Daniels, Chairs Dr. 
Arthur Appel and Dr. David Rouse for the excellent administrative work and service to 
me.  
    The author is in great debt to the students in the big research family in the Fish 
Molecular Genetics and Biotechnology Laboratory at Auburn University. Special thanks 
go to lab mom Milla Kaltenboeck, Dr. Huseyin Kucuktas, and Chia-chen Weng for their 
assistance in the lab. 
    I would thank Dr. Zhanjiang Liu who earlier served on my committee, for the 
additional professional and skill training during my PhD study.  I would also thank the 
faculty members, Dr. Catherine Mcvay, Dr. Scott Santos, Dr. Nannan Liu and Dr. Eric 
Peatman at Auburn University for providing basic and advanced molecular teaching to 
enable me to become skilled and qualified in the field, especially to my mentors Dr. 
Xingping Hu and Dr. Rex Dunham, who prepare my mind in academic development.       
    The author was partially sponsored by a 4-year scholarship from Chinese Scholarship 
Council (CSC). Without doubt, the author appreciates the reviewer?s comments and 
suggestions from Dr. Narendra K. Singh from Biology Department at Auburn University.    
 
v 
 
 
Finally, I am grateful to my wife, Mei Shang for her forever and unconditional support 
and love, and inspiration from my baby daughter, Emma, and my parents, who always 
support and encourage my education.
 
vi 
 
Table of Contents 
 
 
Abstract?? ????????????????????????????? ? ii 
Acknowledgement?????????????????????????? ? ..iv 
List of Tables? ??????????????????????????? ....viii 
List of Figures???????????????????????????? .?i x 
I. Introduction: Will Transgenic Sterilization Reduce the Ecological Risk???.?.1  
    References ?? ????????????????? ? ??...? ....11  
II. Expression and Knock down of Primordial Germ Cell Genes, Vasa, Nanos and 
Dead end in Common Carp, Cyprinus carpio, Embryos for Transgenic 
Sterilization and Reduced  Sexual Maturity 
Abstract??????????????????????? ...?... 19 
Introduction????????????????????? ? ? ....20 
Materials and methods?????????????????.?? ..24 
Results???????????????????????? ?.... 29 
Discussion??????????????????????. ?.? 43 
Conclusions?????????????????????? ?.... 48 
Acknowledgement??????????????????? ??. 48 
References?????????????????????? ??.. 49 
III. Reversible Transgenic Sterilization in Channel Catfish Ictalurus punctatus 
Abstract?????????????????????? ...? ...? 53 
Introduction?????????????????????? ?. ...54 
Materials and methods??????????????????? ...57 
Results ???????????????????????? ? ...63
 
vii 
 
 
Discussion?????????????????????? ?.. ..102 
Conclusions???????????????????? ??? ..107 
Acknowledgement?????????????????? ??.. .108 
References?????????????????????? ?.. ..109
 
viii 
 
 
List of Tables 
 
 
Table 1 QT-PCR Primers used for detection knockdown effect on PGC marker genes in 
common carp (Cyprinus carpio)??????? ????????????...? ?. 28 
Table 2 Sex maturity of 19-month hypothetical sterile transgenic common carp (Cyprinus 
carpio) using different knockdown constructs??????????????..? ? 42 
Table 3 Pool sex maturity data by RNAi gene in 19-month common carp (Cyprinus 
carpio) using different knockdown constructs???????? ?? ...????....... 43 
Table 4 Designation of the 28-transgenic sterilization constructs and treatment methods 
for transgenic channel catfish (Ictalurus punctatus) embryos??????? ??..?. 58 
Table 5 Primers used for qRT-PCR to test knockdown effect on the PGC marker genes 
relative expression in the transgenic channel catfish (Ictalurus punctatus) embryos? ...62 
Table 6 Average Ct values (N=3) for PGC marker genes expression across three time 
points in the electroporated non-transgenic channel catfish (Ictalurus punctatus) embryos 
??? ????????????????????????????? ? ..?. 64 
Table 7 Percentage of gravid, 3-year-old male and female channel catfish, Ictalurus 
punctatus, electroporated with knockout constructs for nanos and dead end and then 
receiving (t) or not receiving repressor compounds??????????? ..??..1 03
 
ix 
 
List of Figures 
 
Fig.1. Double stranded short hairpin structures dead end sh (dnd shRNA), and nanos 
shRNAs (5?nanos sh and 3?nanos sh) used for knockdown Primordial germ cell marker 
genes ...?  ??????? ?? ??????? ?? ????????? ? ?? 24 
Fig.2. CLUSTAL 2.1 multiple sequence of dead end alignment result among Danio rerio, 
Misgurnus anguillicaudatus, Oncorhynchus mykiss, and Carassius auratus (C.auratus) 
??? ??????? ?? ??????? ?? ??????? ????? ..? ..31 
Fig.3. Analysis of relative expression of nanos and vasa gene during embryos 
development using real-time PCR in non-transgenic common carp (Cyprinus carpio)... 32 
Fig.4. Analysis of expression of dead end gene during early embryos development using 
real-time PCR in non-transgenic common carp (Cyprinus carpio)?????? ? .? ..33 
Fig.5. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter 
M, yeast CTR3 promoter mctr (less sensitive) and zebrafish racemase (RM)) on channel 
catfish dead end (dnd) expression in common carp (Cyprinus carpio) ?????? ? 34 
Fig.6. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter 
mctr (less sensitive) and zebrafish racemase (RM)) on channel catfish  nanos cDNA 
expression in common carp (Cyprinus carpio) ??????? ??????.. ? ...? 35 
Fig.7. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter 
m and zebrafish racemase (RM) )on 5? channel catfish nanos expression in common carp 
(Cyprinus carpio) ? ?? ?????? ??? ?????????? ??? ..?? 36
 
x 
 
Fig.8. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter 
m and zebrafish racemase (RM)) on 3? channel catfish nanos expression in common carp 
(Cyprinus carpio) ??. ? ????? ????. ????????????? ? ? 37 
Fig.9. Effect of same promoter channel catfish nanos (nanos) on different shRNA 
structures (channel catfish dead end (dnd), nanos cDNA (cDNA), 5?sh nanos (N1), and 
3?sh nanos (N2) expression in common carp (Cyprinus carpio)??.. ???? ?. ...?  38 
Fig.10. Effect of same promoter zebrafish racemase (RM) on different shRNA structures 
(channel catfish dead end (dnd), nanos cDNA (cDNA), 5?sh nanos (N1), and 3?sh nanos 
(N2)) expression in common carp (Cyprinus carpio)?.????????????.. .39 
Fig.11. Effect of same promoter yeast CTR3 (M) on different shRNA structures (channel 
catfish dead end (dnd), 5?sh nanos (N1), and 3?sh nanos (N2)) expression in common 
carp (Cyprinus carpio)??.. ...?????????.. ...????????? ........?. 40 
Fig.12. Effect of same promoter yeast CTR3 with reduced sensitive (MCTR) on different 
shRNA structures (channel catfish dead end (dnd) and nanos cDNA (cDNA)) expression 
in common carp (Cyprinus carpio)??????????. ??? ...???? ..?? ..41 
Fig.13. Analysis of relative expression of nanos, vasa and dead end (dnd) gene during 
embryonic development of channel catfish (Ictalurus punctatus) using real-time PCR in 
electroporated non-transgenic eggs?? ????????????????? ?? 63 
Fig.14. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated adss-dnd transgenic channel catfish 
(Ictalurus punctatus) embryos.????.. ...?????????.. ...?????? ? 65 
Fig.15. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated adss-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos ???.. ...?????????.. ...??????? ? 66 
 
xi 
 
Fig.16. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated adss-N1 transgenic channel catfish 
(Ictalurus punctatus) embryos.....?????????.. ...????????? .....? 67 
Fig.17. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated adss-N2 transgenic channel catfish 
(Ictalurus punctatus) embryos?????.. ...?????????.. ...????? .? 68 
Fig.18. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated RM-DND transgenic channel catfish 
(Ictalurus punctatus) embryos.???.. ...???????? ...?.. ...?????? .? 78 
Fig.19. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated RM-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos.????.. ...?????????.. ...????? ..? ..70 
Fig.20. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated Rm-N1 transgenic channel catfish 
(Ictalurus punctatus) embryos.....?????????.. ...????????? .....? 71 
Fig.21. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated Rm-N2 transgenic channel catfish 
(Ictalurus punctatus) embryos......?????????.. ...?????????. ...? 72 
Fig.22. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated M-DND transgenic channel catfish 
(Ictalurus punctatus) embryos????.. ...?????????.. ...????? ? .? 73 
Fig.23. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated m-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos???.. ...?????????.. ...?????? .?? 74  
 
xii 
 
Fig.24. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated m-N1 transgenic channel catfish (Ictalurus 
punctatus) embryos.??.. ...?????????.. ...?????????.. ...??? 75 
Fig.25. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated m-N2 transgenic channel catfish (Ictalurus 
punctatus) embryos?????.. ...?????????.. ...???????? ...?.. .76 
Fig.26. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated mctr-DND transgenic channel catfish 
(Ictalurus punctatus) embryos???.. ...?????????.. ...??????? .? 77 
Fig.27. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated mctr-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos???.. ...?????????.. ...?????? ? .? 78 
Fig.28. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated mctr-N1 transgenic channel catfish 
(Ictalurus punctatus) embryos???.. ...?????????.. ...????? ? ?. ? 79 
Fig.29. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated mctr-N2 transgenic channel catfish 
(Ictalurus punctatus) embryos?????????.. ...?????????.. ..? ? ..80 
Fig.30. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated T-DND transgenic channel catfish 
(Ictalurus punctatus) embryos.????????.. ...?????????.. ....? ...? 81 
Fig.31. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated T-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos..??.. ...?????????.. ...?????? ...?? 82 
 
xiii 
 
Fig.32. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated T-N1 transgenic channel catfish (Ictalurus 
punctatus) embryos..??.. ...?????????.. ...???????? ?? ..?..? 83 
Fig.33. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated T-N2 transgenic channel catfish (Ictalurus 
punctatus) embryos.. ??????.. ...?????????.. ...?????? ...?? 83 
Fig.34. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated nanos-DND transgenic channel catfish 
(Ictalurus punctatus) embryos? ?.. ....?????????.. ...??????? ?? 84 
Fig.35. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated nanos-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryos..??.. ...?????????.. ...???...????? 85 
Fig.36. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated nanos-N1 transgenic channel catfish 
(Ictalurus punctatus) embryos.??.. ...?????????.. ...?????? ?... ? 86 
Fig.37. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated nanos-N2 transgenic channel catfish 
(Ictalurus punctatus) embryos.??.. ...?????????.. ...?????? .? ...? 87 
Fig.38. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated vasa-DND transgenic channel catfish 
(Ictalurus punctatus) embryos? ??? ??????.. ...?????????.. ....? 88 
Fig.39. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated vasa-cDNA transgenic channel catfish 
(Ictalurus punctatus) embryo? ?????????.. ...?????????.. .??. 89 
 
xiv 
 
Fig.40. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated vasa-N1 transgenic channel catfish 
(Ictalurus punctatus) embryos? ?????.. ...?????????.. ...???? ....90 
Fig.41. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and 
vasa expression in the treated and non-treated vasa-N2 transgenic channel catfish 
(Ictalurus punctatus) embryos?????????.. ...?????????.. .....? ..91 
Fig.42. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on 
channel catfish dead end (dnd) shRNA structure in knock down PGC marker genes 
expression in transgenic channel catfish (Ictalurus punctatus) embryos???? ....? .92 
Fig.43. Effect of different promoter yeast (copper specific transcriptional repression) 
CTR3 promoter (M) and CTR3 promoter but less sensitive (Mctr) on channel catfish 
dead end (dnd) shRNA structure in knock down PGC marker genes expression in 
transgenic channel catfish (Ictalurus punctatus) embryos?? ??.. ...????? ..? .93 
Fig.44. Effect of different promoter channel catfish nanos and channel catfish vasa on 
channel catfish dead end (dnd) shRNA structure in knock down PGC marker genes 
expression in transgenic channel catfish (Ictalurus punctatus) embryos??? ..? ? ? 94 
Fig.45. Effect of promoter salmon transferrin on channel catfish dead end (dnd) shRNA 
structure in knock down PGC marker genes expression in transgenic channel catfish 
(Ictalurus punctatus) embryoys? ? ????????????????? ..?? ..94 
Fig.46. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on  
channel catfish nanos cDNA overexpression structure in knock down PGC marker genes 
expression in transgenic channel catfish (Ictalurus punctatus) embryos??? ..? ? ? 95 
Fig.47. Effect of different promoter yeast (copper specific transcriptional repression) 
CTR3 promoter (M) and CTR3 promoter but less sensitive (Mctr) on channel catfish 
nanos cDNA overexpression in knock down PGC marker genes expression in transgenic 
channel catfish (Ictalurus punctatus) embryos? ??????????? ? ? ?? .96 
 
xv 
 
Fig.48. Effect of different promoter channel catfish nanos and channel catfish vasa on 
channel catfish nanos cDNA overexpression structure in knock down PGC marker genes 
expression in transgenic channel catfish (Ictalurus punctatus) embryos????... ?. .97 
Fig.49. Effect of promoter salmon transferrin on channel catfish nanos cDNA 
overexpression structure in knock down PGC marker genes expression in transgenic 
channel catfish (Ictalurus punctatus) embryos????????.????? ?. ..? .98 
Fig.50. Effect of promoter salmon transferrin on channel catfish nanos1 ds-sh RNA (N1) 
(targeting 5? nanos) structure in knock down PGC marker genes expression in transgenic 
channel catfish (Ictalurus punctatus) embryos?.... ??? ???.?????? ? ....99 
Fig.51. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on 
channel catfish nanos ds-sh RNA (N2) (targeting 3? nanos) structure in knock down PGC 
marker genes expression in transgenic channel catfish (Ictalurus punctatus) embryos? 99 
Fig.52. Effect of different promoter yeast (copper specific transcriptional repression) 
CTR3 promoter (M) and CTR3 promoter but less sensitive (Mctr) on channel catfish 
nanos1 ds-sh RNA (N2) (targeting 3? nanos) in knock down PGC marker genes 
expression in transgenic channel catfish (Ictalurus punctatus) embryos??? ..??.. 100 
Fig.53. Effect of different promoter channel catfish nanos and channel catfish vasa on 
channel catfish nanos1 ds-sh RNA (N2) (targeting 3? nanos) structure in knock down 
PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) 
embryos?? ????????????????????? .???? .?.. ??1 01 
Fig.54. Effect of promoter salmon transferrin on channel catfish nanos1 ds-sh RNA (N2) 
(targeting 3? nanos) structure in knock down PGC marker genes expression in transgenic 
channel catfish (Ictalurus punctatus) embryos????...?? .?????? ..? ..? 101
 
1 
 
Introduction: will transgenic sterilization reduce the ecological risk? 
Fisheries and aquaculture has been making great contributions to the world?s well-being 
and prosperity, providing the population with nutritious food and animal protein. The 
world population is increasing year by year and will continue to grow in the near future 
from current projection, with an increase from 7 billion to 10.5 billion by 2050, a 50 
percent increase (Population Division, 2009; World population clock, 2012). With the 
increasing of world population, human beings would experience food crisis. Global 
consumption of meat is estimated to double by 2020 and total food consumption will 
double by 2030 (Population Resource Center, 2012). Hardy (1999) predicted that 
aquaculture will have to increase by 350% to meet the shortage of 55 million t seafood 
products by 2025 from leveled wild catch and increasing demand. Fish provide 3.0 
billion people with almost 20 percent of their intake of animal protein, and 4.3 billion 
people with about 15 percent of such protein (FAO, 2012). Although world food supply 
has grown dramatically in the past five decades, exceeding global population growth, a 
great and steady demand for food are much more urgent than ever before because of 
sluggish economic crisis, greater climate change vulnerabilities, declining domestic 
fishery production (10% down in the period 2000-2010) (FAO, 2012).   
The United States ranks the world?s second largest importer of seafood and the third in 
wild capture fishery landings, but is the 14th in aquaculture production (FAO, 2010). 
Catfish is one of the primary cultured species in the U.S., ranking sixth in the ?top 10? 
fish and seafood consumption list for Americans (Hanson and Sites, 2010).  Catfish 
farming accounted for over two-thirds of US aquaculture production and over half of the 
value in the 1980?s and 1990?s (ARS, Aquaculture National Program, 2008). However, 
catfish production has been stagnating since 2003. Catfish production in the United States 
peaked in 2003 when approximately 650 million pounds were processed (Hanson, 2010).  
For a variety of reasons, primarily the low cost of imports and the increased cost 
 
2 
 
associated with domestic production (e.g., ingredients to manufacture feed, fuel, fish 
disease, survival, growth conversion), production has since decreased and the amount of 
catfish processed in 2010 was equivalent to the amount processed in the early 1990?s 
(approximately 470 million pounds) (Hanson, 2010). The number of U.S catfish 
operations and catfish production acres continues to decrease, especially in last four 
years. High prices for corn and soybean resulted in high catfish feed prices from 2008 to 
2012. Imported catfish fillets increased by 6.3% in 2010 as substitutes to meet food 
needs, accounting for 57% of all U.S sale of frozen catfish fillet product. Sustainability 
needs to be greatly improved for catfish farming and profitability and competitiveness 
should be strived for regarding the deficit balance. The US catfish industry is in crisis, 
and undergoing a critical evolution.  
Culture of carps dominates fish farming in fresh water. Common carp (Cyprinus carpio) 
is a widespread freshwater fish, and is one of the most economically important cultured 
species worldwide with an annual global production of 3.4 million tons (out of 24.2 
million tones carp), accounting for 14% of the freshwater aquaculture production in the 
world (FAO, 2012). Farming of common carp is popular in many countries and 
represents about 64% of the farmed cyprinids in Europe (Huntingford et al. 2012). 
Common carp is also kept as an ornamental species. Color variants of common carp, koi, 
are valuable as ornamentals with more than 100 different types of coloration (Wang and 
Li, 2004). Although common carp have great economic importance, in many countries it 
is considered an invasive species. Once introduced and established, common carp are 
very hard to eradicate. Common carp populations have a negative effect on the 
environment in Australia, and the U.S government has been spent millions of dollars 
annually to control common carp populations. Transgenic technologies could be used to 
enhance common carp for aquaculture, but might also be used to help control common 
carp populations. 
Transgenesis can be utilized as a tool in genetic and genome research, as a means to 
increase knowledge of gene regulation in organisms; Transgenic animals have the 
potential to increase economic benefit by improving growth rate, disease resistance, and 
feed conversion, enhancing nutritional and processing qualities, coloration, recreational 
 
3 
 
traits and other desirable traits (Dunham, 2003; Van Eenennaam, 2006). Fish lay large 
quantities of eggs, have external fertilization and embryonic development, a lower 
possibility of carrying human pathogens, and have large eggs that are readily pierced by a 
suitable glass needle (Liu, et al. 1990; Maclean, 1998; Van Eenennaam, 2006), making 
them amenable for transgenesis compared to mammals.  
Transgenic fish have been produced for at least 14 species of fish, including model 
species, such as zebrafish and medaka, non-model species such as Atlantic salmon, coho 
salmon, chinook salmon, tilapia, rainbow trout, catfish, carp and northern pike (Dunham, 
2003; Devlin et al 2006). Traits and phenotypes addressed include growth (growth 
hormone), freeze tolerance (antifreeze protein), disease resistance (cecropin and 
lactorferrin), carbohydrate metabolism (glucose transporter and hexokinase), lipid 
metabolism (D6-desaturase), phosphorus metabolism (phytase), and vitamin C 
metabolism (L-gulono-gamma-lactone oxidase) (Devlin et al 2006). Growth hormone is 
one of the most widely used transgenes. Additionally, different fluorescent proteins are 
widely used to study the gene interaction, protein function, embryonic development and 
gene expression.    
In the middle 1980s?introduction of mammalian GH genes later fish GH sequences 
driven by non-piscine promoters resulted in 10-80% faster growth in transgenic fish 
compared to non-transgenic fish in aquaculture conditions (Dunham, 2003).  In the 
1990?s , all-fish GH gene constructs were developed and used, resulting in transgenic 
Atlantic salmon and Nile tilapia (Du, et al 1992; Rahman and Maclean, 1999) with 
growth enhanced from 10% to 30X. Growth rate of transgenic Atlantic salmon increased 
by 400% to 600%, but body weight at maturity was slightly larger than controls. Feed 
input decreased 25% for these transgenic salmon, and the time to market is greatly 
shortened (Du et al. 1992).   
Although GH genes greatly enhanced growth rate, pleiotropic effects occurred for 
moisture content, body composition, intestinal surface area, morphological abnormalities, 
gill morphology, endocrine stimulation, and deposition of cartilage. The intestinal surface 
area in GH transgenic Atlantic and coho salmon was enlarged 2.2X compared to that of 
 
4 
 
control salmon and growth rate was about twice that of the controls (Stevens and Devlin, 
2000). Moisture content in GH transgenic Atlantic salmon was higher than normal 
controls (Cook et al. 2000). GH transgenic Pacific salmonids had morphological 
abnormalities in the head, fin, jaw and operculum when compared to controls (Devlin et 
al 1995).  GH transgenesis had different pleiotropic effects in closely related species. GH 
transgenic Atlantic salmon and Pacific salmon had different gill morphology than 
controls. Transgenic Pacific salmon had smaller lamellar spacing than control, and 
transgenic Atlantic salmon had longer gill filaments than controls (Stevens and Devlin, 
2000). GH transgenic salmonoids had other pleiotropic effects, such as reduced 
reproductive fitness (Fitzpatrick et al. 2011), reduced swim ability (Farrell, et al. 1996), 
reduced disease resistance (Jhingan et al. 2003), modified regulation of GH (Mori et 
al.1999) and the thyroid (Eales, et al. 2004).  GH transgenic mature parr of Atlantic 
salmon (Salmon Salar), an alternative male reproductive phenotype (i.e. precocially 
mature and mature only in freshwater), have showed reduced fertilization success 
compared with nontransgenic wild-type mature parr. However, GH transgenic 
anadromous males (i.e. larger, fighter males) out-performed wild counterparts. Though 
breeding differences among the two phenotypes of GH transgenic Atlantic salmoon 
existed, results demonstrated both male reproductive had the ability to pass down 
transgene into offspring (Moreau et al. 2011).  GH gene is one of the few genes used in 
production transgenic fish breeding, and benefits the breeding program as a whole.   
Zbikowska (2003) predicted that fish will be the first group of transgenic animals, to be 
applied commercially. At this time, the only commercialized transgenic fish is the 
GloFish, a zebrafish danio, which expresses fluorescence protein and is used for 
ornamental purposes. Transgenic Atlantic salmon containing a single copy of a DNA 
sequence coding for Chinook salmon growth hormone driven by regulatory sequences 
derived from Chinook salmon and the eel-like ocean pout is reported to close to be 
approved by the Food and Drug Administration (FDA) (Marris, 2010). Fish Information 
& Services (FIS) reports that the US Senate rejected an amendment demanding further 
study of evaluation of environmental and economic impact of transgenic 
AquaAdvantage? salmon on May 24, 2012 (FIS, 2012).  
 
5 
 
The first transgenic fish was produced by Zhu et al. (1985) and many researchers have 
developed transgenic fish with improved growth rate and disease resistance but 27 years 
later none of the transgenic fish have been commercialized for the food market. The 
commercialization of transgenic fish is likely dependent on food safety and effective 
containment. The food safety of a transgenic fish largely depends on the DNA insert, 
transgene coding sequence, gene product and insertion process and insertion mutagenesis 
(Berkowitz and Kryspin-Sorensen, 1994; Maclean, 2003). Public concerns include 
consumption of transgenes, change in the nutritional composition of foods, potential 
production of toxins, and activation of vial sequences and allergenicity of transgenic 
products (Dunham 2003).  
Aquaculture activity is conducted in land-based or sea-based facilities. Sea-based 
facilities such as pens are more vulnerable to accidents and pose much greater risk of 
escapee than do land-based aquaculture facilities because of storm damage, accidental 
mechanical damage from boats, predator damage or human errors (Devlin and 
Donaldson, 1992).  For example, farmed salmon escapement has been reported 
worldwide, including the North Atlantic, Scotland, and Norway (Bratspies, 2006). They 
had the ability to adapt to the local environmental condition, and in some cases, the 
number of escapees of Atlantic salmon outnumbered the wild population, and threaten 
the wild population thorough either competition or interbreeding. Evidence showed that 
Atlantic salmon has successfully spawned in British Columbian waters and become an 
invasive species (Volpe, 2000). 
Fish are highly mobile and because of escapement or intentional stocking they can easily 
become feral, are difficult to contain and this is of greatest concern (NRC, 2002). There 
are no standard criteria for evaluating the potential risk of exotic introductions, models 
have been suggested to estimate the genetic risk of transgenic fish, including the Trojan 
gene effect (Muir and Howard, 1999),  and a deterministic model (Hedrick, 2001).  
Fitness determines the ability of a genotype, exotic species or transgenic fish to become 
established in the natural environment. Fitness is defined as the probability of producing 
off-spring and transmitting genetic information to future generations of a population. 
 
6 
 
Muir and Howard (2001) concluded that six components of an organism?s life cycle are 
needed for a fitness evaluation, including juvenile viability, adult viability, age at sexual 
maturity, female fecundity (number of eggs), male fertility and mating success, which 
were used to group into two category if survival or reproductive capacity of transgenic 
differ from wild type. Dunham (2011) also indicated that predator avoidance, foraging 
ability and swimming ability are also important components of fitness. 
The Trojan gene effect model was developed using GH and non-transgenic medaka in 
aquaria, and the result indicated that normal females had a mating preference for large, 
less fit transgenic males that could lead to extinction of a population (Muir and Howard 
1999). Shortcomings of this model include no consideration for genotype-environment 
interactions, no predation, artificial feed (no foraging), a highly artificial environment and 
an atypical mating preference for a typical fish species. Large male fish do not always 
have mating advantage, for example, reproductive success of male Atlantic cod was 
determined by female size (Rakitin et al. 2001).   
Similarly, Hedrick (2001) developed a deterministic model on the assumption that 
transgene has a male-mating advantage, but a general viability disadvantage, providing a 
detailed examination of mating advantage and viability disadvantage for transgenic 
organisms. The conclusion was that transgene increase in frequency for 66.7% of 
possible combinations of the possible mating and viability parameters; the transgene goes 
to fixation for 50% of the combinations. Increasing the frequency of the GH transgene 
results in the reduced viability of natural population and increased probability of 
extinction of conspecific natural populations.  
All models are limited, and. no single model can take all factors from nature into 
consideration. Different research groups have different opinions on the relative fitness of 
transgenic, domesticated and wild types (Maclean and Laight, 2000; Hedrick, 2001; 
Dunham, 2003; Dunham 2011). Risk-based frameworks or platforms need to be 
developed to evaluate individual transgenes and transgenic species under the actual (best 
simulation of) ecosystem on a case-by-case basis.  
 
7 
 
Regardless of risk, several options exist for containment of transgenic fish. Simultaneous 
application of multiple containment strategies were recommended by the National 
Research Council (NRC, 2004). Wong and Van Eenennaam (2008) had reviewed and 
compared different containments strategies, and grouped them into different categories 
including physical, biological and genetic containment. Physical containment and 
biological containment have their internal and distinct disadvantages.  
One option for genetic containment is triploid induction. Triploid induction rates vary 
between 10 and 100%, depending on the species, shock conditions and egg batch quality. 
Triploidy can decrease performance in fish (Dunham, 2004), and is not feasible on a 
commercial scale in the case of catfish and many other species of fish. Triploid induction 
reduced performance of GH transgenic fish negating about half of the enhancement from 
the transgenesis (Dunham, 2004; Nam et al. 2004). Triploidy also has the disadvantage 
that it required fertile diploid brood stock, so the possibility of escape and risk can be 
reduced, but not eliminated.  
An alternative genetic containment is transgenic sterilization. An option is the disruption 
of translation of reproductive genes with antisense followed by hormone therapy when 
reproduction is needed. Earlier study (Uzbekova et al., 2001) was using antisense 
Atlantic salmon (Salmo salar) sGnRH cDNA, driven by the sGnRH Pab promoter in 
production of transgenic rainbow trout. They had positive results in their initial studies 
but never followed up. Also this was not the sterile feral approach, it was straight 
antisense followed by hormone therapy. 
Hu et al. (2006) reported that a recombinant construct using carp beta ?actin driving 
antisense Atlantic salmon GnRH gene microinjected into fertilized common carp eggs, 
and produced 30% undeveloped gonads in the  founders. They also reported that the 
fertility could be restored by exogenous hormone administration. Unfortunately, 100% 
sterility was not produced in the transgenic common carp, hindering further application 
and commercialization. The system might be improved by the careful analysis of 
construct design, altering the dosage of external GnRH administration, and the 
environmental design.   
 
8 
 
Wu et al (2010) also modified similar system to control reproduction of transgenic 
zebrafish by microinjection. The construct was driven by an ovary-specific and a testis-
specific promoter, respectively. The transgene of interest was a suicide gene, consisting 
of a reductase and photosensitizer, while the reductase gene was linked to a reporter gene. 
The novelty of this concept is that infertility is induced if transgenic fish expressing the 
reductase are treated with an effective amount of reductase-activated cytotoxic prodrug or 
if the transgenic fish expressing photosensitizer are treated with light irradiation. They 
had reported 100% reliable infertility in zebrafish.  The author has doubt regarding how 
to effectively providing a transgenic male with three copies of fusion transgene because 
the high copy number of transgene prevents high transfection rate of the cell, and 
integration sites are random events. A piece sequence of Simian virus 40, a 
polyomavirus, was used for design of the construct, which may be disadvantage when 
considering commercialization.  
One form of transgenic sterilization, Sterile Feral (SF) technology has shown promise for 
achieving transgenic reproductive confinement. Components of these constructs are fused 
so that a specific promoter is coupled to a repressible element that in turn drives 
expression of a blocker gene, antisense RNA, dsRNA, sense RNA or ribozyme to an 
early key developmental gene (Dunham 2004; Thresher et al. 2005; Thresher et al. 2009). 
This strategy has two parts: one is to suppress the expression of critical gene related to 
embryonic development gonad development or sexual maturity via a knockdown 
construct in the absence of a repressible element.  The second step is to reverse the 
sterility of transgenic fish by administrating exogenous compound to shut off expression 
of the blocker gene allowing rescue of the embryos and/or to produce brood stock. This 
knockdown strategy could be used to generate reversibly sterile transgenic fish. Proof of 
principle of the sterile feral system has been demonstrated with the repression of the 
knockout function demonstrated in zebrafish, oysters, channel catfish and common carp 
for disruption of embryonic development (Thresher et al. 2005; Templeton 2005; 
Chaimongkol 2009; Thresher et al. 2009).  This approach could be utilized to disrupt 
gamete production by preventing primordial germ cell (PGC) migration during 
embryogenesis. 
 
9 
 
PGCs migrate far from the site of developing gonads to the genital ridge where they 
differentiate into gametes. The decision by PGCs to develop into gametes varies and 
depends on the species and clues. Mammals and Drosophila have different mechanisms 
controlling the differentiation of gametes. The mechanism of fish gamete differentiation 
can be grouped into two different ways (Slanchev et al. 2005). Channel catfish and 
medaka have undifferentiated gonads, which develop into ovaries in females and testes in 
males. Zebrafish is representative of the second mechanism. Ovary-like structure is 
initially found in all embryos; subsequently this structure develops into ovaries in 
females, or after the death of the oocytes, into testis in males.  
A number of genetic markers are associated with and expressed in PGCs such as vasa, 
nanos(nos), dead end (dnd), cxcr4b, and dazl (Raz, 2004). In general, the function of 
PGC marker genes was studied using morpholino (MO) antisense oligonucleotides by 
specifically inhibiting the translation of the corresponding RNA (Raz, 2003; Slanchev et 
al. 2005).  Expression pattern, function, cell-fate maintenance, migration mechanism of 
PGC marker genes were reviewed (Raz, 2004; Richardson and Lehmann, 2010).  
Weidinger et al. (2003) found that dead end protein RNA binding protein is expressed in 
PGCs of zebrafish throughout embryogenesis. Dead end expression was required for 
PGC migration, survival and female development. Dnd knockout produced all male with 
highly reduced fertility (Weidinger et al 2003; Slanchev et al. 2005). 
 Zebrafish nanos is essential for proper migration and survival of primordial germ cells 
(Koprunner et al. 2001). Nanos deficient PGCs migrate, but are abnormal, have 
premature activation of germ cell markers, exhibit abnormal morphology and express 
mRNA usually found in the soma. When nos-1 was knocked out, PGC migration stopped 
and they died. Dazl is another protein involved in PGC migration. zDazl and brul are 
locally expressed like vas, nanos, and dead end (Hashimoto et al. 2004). 
Vasa was discovered in zebrafish (Yoon et al. 1997). Vasa differs from other PGC 
markers in that it is continually expressed in the germ line (Yoon et al. 1997; Koprunner 
et al. 2001; Weidinger et al. 2003).  
 
10 
 
The expression of the PGC genes is very specific, and they do not appear to have other 
functions. This is another advantage for application in transgenic sterilization as 
pleiotropic effects would be predicted to be minimal when multiple functions and 
interactions do not exist. However, pleiotropic effects are possible, and should be 
examined in transgenically sterilized fish. Pleiotropic effects have been primarily studied 
for GH transgenic fish. The list of observed pleiotropic effects in various species of fish 
include changes in feed conversion efficiency, feed consumption, behavior, survival, 
disease resistance, tolerance of low oxygen, respiration,  swimming ability, predator 
avoidance, body shape, body composition, dressout %,  organelle number, gill 
morphology, gene expression, IGF level, reproduction and intestinal length (Dunham 
2008).  
Our long-term goal is to accomplish reversible transgenic sterility in fish, specifically 
catfish and carp, and to reproductively confine and prevent the establishment of 
transgenic or domestic genotypes in the natural environment. Our specific objectives are 
to prevent primordial germ cell (PGC) migration and gamete formation rendering the 
carp and catfish sterile, and to reverse this process in a subset of embryos to produce 
fertile brood stock that generate sterile offspring.  
 
 
 
 
 
 
 
 
 
 
11 
 
References 
ARS (USDA Agriculture research service), 2008. National Program 106: Aquaculture 
Action Plan FY05 - FY09. Available: 
http://www.ars.usda.gov/research/programs/programs.htm?np_code=106&docid=
276 
Berkowitz, D. B., Kryspin-S?rensen, I., 1994. Transgenic Fish: Safe to Eat?. Nat 
Biotechnol, no. 12: 247-52. 
Bratspies, R. M., 2006. Can Transgenic Fish Save Fisheries? Globalization: Effect on 
Fisheries Resources. Social Science Research Network (SSRN): Cambridge 
University Press, 2007. 
Chaimongkol, A. , 2009. Disruption of Embryonic Development in Common Carp, 
Cyprinus Carpio, and Channel Catfish, Ictalurus Punctatus, Via Knock Down of 
BMP2 Gene for Repressible Transgenic Sterilization. Ph.D Dissertation, Auburn 
University. 
Cook, J. T., McNiven, M. A.,  Richardson, G. F., and Sutterlin, A. M.  2000. Growth 
Rate, Body Composition and Feed Digestibility/Conversion of Growth-Enhanced 
Transgenic Atlantic Salmon (Salmo Salar). Aquaculture 188, no. 1?2: 15-32. 
Devlin, R. H., Yesaki, T. Y., Donaldson, E. M., Du, S. J., and Hew, C. L. 1995. 
Production of Germline Transgenic Pacific Salmonids with Dramatically 
Increased Growth Performance. Canadian Journal of Fisheries and Aquatic 
Sciences 52, no. 7: 1376-84. 
Devlin, R. H., and Donaldson, E. M., 1992. Containment of Genetically Altered Fish with 
Emphasis on Salmonids. In Transgenic Fish, edited by C. L. Hew and G.L. 
Fletcher. 229-66. Singapore: World Scientific. 
 
12 
 
Devlin, R. H., Sundstr?m, L. F., and Muir, W. M., 2006. Interface of Biotechnology and 
Ecology for Environmental Risk Assessments of Transgenic Fish. Trends in 
Biotechnology 24, no. 2: 89-97. 
Du, S.J., Gong, Z.Y., Fletcher, G.L., Shears, M.A., King, M.J., Idler, D.R., and Hew, 
C.L., 1992. Growth Enhancement in Transgenic Atlantic Salmon by the Use of an 
"All Fish" Chimeric Growth Hormone Gene Construct. Biotechnology 
(NY).10(2):176-181 
Dunham R.A. 2003. Status of genetically modified (transgenic) fish: research and 
application, working paper topic 2. Food and Agriculture Organization/World 
Health Organization expert hearings on biotechnology and food safety. Website: 
ftp://ftp.fao.org/es/esn/food/GMtopic2.pdf Accessed on 9/10/12 
Dunham, R. A. 2004. Aquaculture and Fisheries Biotechnolgy: Genetics Approaches 
Cambridge, USA: CABI Publishing. 
Dunham, R. A, Liu, Z., 2006. Transgenic Fish ? Where We Are and Where Do We Go? 
Israeli Journal of Aquaculture-Bamigdeh 58, no. 4: 297-319. 
Dunham, R. A. 2009. Transgenic Fish Resistant to Infectious Diseases, Their Risk and 
Prevention of Escape into the Environment and Future Candidate Genes for 
Disease Transgene Manipulation. Comparative Immunology, Microbiology and 
Infectious Diseases 32, no. 2: 139-61. 
Eales, J. G., Devlin, R., Higgs, D. A., McLeese, J. M., Oakes, J. D., and Plohman, J., 
2004. Thyroid Function in Growth-Hormone-Transgenic Coho Salmon 
(Oncorhynchus Kisutch).  Canadian journal of zoology 82, no. 8: 1225-29. 
FAO (Food and Agriculture Organization). 2010. The state of world fisheries and 
aquaculture 2010. Available: http://www.fao.org/docrep/013/i1820e/i1820e.pdf 
FAO (Food and Agriculture Organization). 2012. The state of world fisheries and 
aquaculture 2012. Available: http://www.fao.org/docrep/016/i2727e/i2727e.pdf 
 
13 
 
Farrell, A.P., Bennett, W., and Devlin, R. H., 1996. Growth-Enhanced Transgenic 
Salmon Can Be Inferior Swimmers. Canadian Journal of Zoology 75: 335-37. 
FIS (Fish Information & Services), 2012. Available: www.fis.com; 
http://fis.com/fis/worldnews/worldnews.asp?l=e&id=52760&ndb=1 
Fitzpatrick, J. L., Akbarashandiz, H., Sakhrani, D.,  Biagi, C. A.,  Pitcher, T. E., and 
Devlin, R. H., 2011. Cultured Growth Hormone Transgenic Salmon Are 
Reproductively out-Competed by Wild-Reared Salmon in Semi-Natural Mating 
Arenas. Aquaculture 312, no. 1?4: 185-91. 
Hanson, T., Sites, D., 2010. U.S Farm-Raised catfish industry 2010 and 2011 outlook 
highlights. Available: http://www.aces.edu/dept/fisheries/aquaculture/catfish-
database/2010%20catfish/Economics/us_farmraised_catfish_industry_2010_revie
w.pdf 
Hardy, R.W., 1999. Collaborative opportunities between fish nutrition and other 
disciplines in aquaculture: an overview. Aquaculture 177, 217-230. 
Hashimoto, Y., Maegawa, S., Nagai, T., Yamaha, E., Suzuki, H., Yasuda, K., and Inoue, 
K., 2004. Localized Maternal Factors Are Required for Zebrafish Germ Cell 
Formation.  Developmental Biology 268, no. 1: 152-61. 
Hedrick, P.W.  2001. Invasion of Trangenes from Salmon or Other Genetically Modified 
Organisms into Natural Populations. Canadian Journal of Fisheries and Aquatic 
Sciences 58: 841-44. 
Hu, W., Wang, Y., Zhu, Z.. 2006. A Perspective on Fish Gonad Manipulation for 
Biotechnical Applications. Chinese Science Bulletin 51, no. 1: 1-6. 
Huntingford, F., Kadri, S., Jobling, M. 2012. Introduction: Aquaculture and Behaviour. 
Chap. 1 In Aquaculture and Behaviour, edited by F. Huntingford, Kadri, S., 
Jobling, M.: Blackwell Publishing Ltd.  
 
14 
 
Jhingan, E., Devlin, R. H., Iwama, G. K.  2003. Disease Resistance, Stress Response and 
Effects of Triploidy in Growth Hormone Transgenic Coho Salmon. J. of Fish 
Biology 63, no. 3: 806-23. 
Koprunner, M., Thisse, C., Thisse, B., Raz. E., 2001. A Zebrafish Nanos-Related Gene Is 
Essential for the Development of Primordial Germ Cells. Genes Dev 15, no. 21: 
2877-85. 
Liu, Z.J., Moav, B., Faras, A.J., Guise, K.S., Kapuscinski, A.R., and Hackett, P.B. 1990. 
Development of Expression Vectors for Transgenic Fish. Nat Biotech 8, no. 12: 
1268-72. 
Maclean, N. 1998.  Regulation and Exploitation of Transgenes in Fish. Mutation 
Research/Fundamental and Molecular Mechanisms of Mutagenesis 399, no. 2: 
255-66. 
Maclean, N., Laight, R. J. 2000. "Transgenic Fish: An Evaluation of Benefits and Risks." 
Fish and Fisheries 1, no. 2: 146-72. 
Maclean, N. 2003. Genetically Modified Fish and Their Effects on Food Quality and 
Human Health and Nutrition. Trends in Food Science & Technology 14, no. 5-8: 
242-52. 
Marris, E. 2010. Transgenic Fish Go Large. Nature 467, no. 259: 259-59. 
Moreau, D. T. R., Conway, C., and Fleming, I.A., 2011. Reproductive Performance of 
Alternative Male Phenotypes of Growth Hormone Transgenic Atlantic Salmon 
(Salmo Salar). Evolutionary Applications 4, no. 6: 736-48. 
Mori, T., Devlin, R. H., 1999. Transgene and Host Growth Hormone Gene Expression in 
Pituitary and Nonpituitary Tissues of Normal and Growth Hormone Transgenic 
Salmon. Molecular and Cellular Endocrinology 149, no. 1?2: 129-39. 
 
15 
 
Muir, W. M., Howard, R. D., 1999. Possible Ecological Risks of Transgenic Organism 
Release When Transgenes Affect Mating Success: Sexual Selection and the 
Trojan Gene Hypothesis. PANS  96, no. 24:13853-56. 
Nam, Y. K., Park, I., Kim, D. S., 2004. Triploid Hybridization of Fast-Growing 
Transgenic Mud Loach Misgurnus Mizolepis Male to Cyprinid Loach Misgurnus 
Anguillicaudatus Female: The First Performance Study on Growth and 
Reproduction of Transgenic Polyploid Hybrid Fish. Aquaculture 231, no. 1?4: 
559-72. 
NRC (National research council). 2002. Animal biotechnology: science-based concerns. 
Washington, DC: Nat Acad Pr. 182p. 
NRC(Organisms, Committee on the Biological Confinement of Genetically Engineered, 
and National Research Council), 2004. Biological Confinement of Genetically 
Engineered Organisms. Washington, DC. The National Academies Press.  
Accessible: http://www.nap.edu/catalog.php?record_id=10880 
Population Division, 2008. World Population Prospects: The 2008 Revision. Population 
Division of the Department of Economic and Social Affairs of the United Nations 
Secretariat. June 2009. Accessible 
http://www.un.org/esa/population/publications/popnews/Newsltr_87.pdf 
Population Resource Center, 2012. Accessible at 
http://www.prcdc.org/globalpopulation/Population_and_Food/ 
Rahman, M. A., and Maclean,N.,1999. Growth Performance of Transgenic Tilapia 
Containing an Exogenous Piscine Growth Hormone Gene. Aquaculture 173, no. 
1?4: 333-46. 
Rakitin, A., Ferguson, M.M., and Trippel, E.A., 2001. Male Reproductive Success and 
Body Size in Atlantic Cod Gadus Morhua L. Marine Biology 138, no. 6: 1077-85. 
 
16 
 
Raz, E. 2003. Primordial Germ-Cell Development: The Zebrafish Perspective. Nat Rev 
Genet 4, no. 9: 690-700. 
Raz, E. 2004.  Guidance of Primordial Germ Cell Migration. Current Opinion in Cell 
Biology 16, no. 2: 169-73. 
Richardson, B. E., and Lehmann, R., 2010. Mechanisms Guiding Primordial Germ Cell 
Migration: Strategies from Different Organisms.  Nat Rev Mol Cell Biol 11, no. 1: 
37-49. 
Slanchev, K., Stebler, J., de la Cueva-M?ndez, G., and Raz, E. 2005. Development 
without germ cells: The role of the germ line in zebrafish sex differentiation. 
PNAS, 102(11), 4074-79.  
Stevens, E. D., and Devlin, R. H., 2000. Intestinal Morphology in Growth Hormone 
Transgenic Coho Salmon. Journal of Fish Biology 56, no. 1: 191-95. 
Templeton, C. M. , 2005. Disruption of Embryonic Development in Channel Catfish, 
Ictalurus Punctatus, Using "Sterile-Feral" Gene Constructs. Master Thesis, 
Auburn University. 
Thresher, R., Hinds, L., Hardy, C., Whyard, S., Vignarajan, S., Grewe, P.M., and Patil, J. 
2005. Repressible Sterility of Animals. United States. 
Thresher, R., Grewe, P., Patil, J. G., Whyard, S., Templeton, C. M., Chaimongol, A., 
Hardy, C. M., Hinds, L. A., and Dunham, R. A. 2009. Development of 
Repressible Sterility to Prevent the Establishment of Feral Populations of Exotic 
and Genetically Modified Animals. Aquaculture 290, no. 1?2: 104-09. 
Uzbekova, S., Chyb, J., Ferriere, F., Bailhache,T., Prunet, P., Alestrom, P.,and Breton, B. 
2000.  Transgenic Rainbow Trout Expressed sGnRH-Antisense RNA under the 
Control of sGnRH Promoter of Atlantic Salmon. Journal of Molecular 
Endocrinology 25, no. 3: 337-50. 
 
17 
 
Van Eenennaam, A. L., and Olin, P. G. 2006. Careful Risk Assessment Needed to 
Evaluate Transgenic Fish. California agriculture. 60, no. 3: 126-31. 
Volpe, J.P., Taylor, E.B., Rimmer, D.W., Glickman, B.W.  2000. Natural reproduction of 
aquaculture escaped Atlantic salmon (Salmo salar) in a coastal British Columbia 
river. Conservation Biology 14: 899-903. 
Wang, C.H., and Li, S., 2004. Phylogenetic Relationships of Ornamental (Koi) Carp, 
Oujiang Color Carp and Long-Fin Carp Revealed by Mitochondrial DNA Coii 
Gene Sequences and Rapd Analysis. Aquaculture 231, no. 1?4: 83-91. 
Weidinger, G., Stebler, J., Slanchev, K., Dumstrei, K., Wise, C., Lovell-Badge, R., 
Thisse, C., Thisse, B., and Raz, E. 2003.  Dead End, a Novel Vertebrate Germ 
Plasm Component, Is Required for Zebrafish Primordial Germ Cell Migration and 
Survival. Current Biology 13, no. 16: 1429-34. 
World Population Clock ? Worldometers, 9.20.2012. Accessbile at: 
http://www.worldometers.info/world-population/  
Wong, A. C., and Van Eenennaam, A. L. 2008. Transgenic Approaches for the 
Reproductive Containment of Genetically Engineered Fish. Aquaculture 275, no. 
1?4: 1-12. 
Wu, J., Hu, S., Her, G.U., 2010. Infertility Control of Genetically Modified Fish. United 
States. 
Yoon, C., Kawakami, K.,  and Hopkins. N., 1997. Zebrafish Vasa Homologue RNA Is 
Localized to the Cleavage Planes of 2- and 4-Cell-Stage Embryos and Is 
Expressed in the Primordial Germ Cells. Development 124, no. 16: 3157-65. 
Zbikowska, H. M. 2003. Fish Can Be First ? Advances in Fish Transgenesis for 
Commercial Applications. Transgenic Research 12, no. 4:379-89. 
 
18 
 
Zhu, Z., He, L., Chen, S., 1985. Novel Gene Transfer into the Fertilized Eggs of Gold 
Fish (Carassius Auratus L. 1758). Journal of Applied Ichthyology 1, no. 1:31-34
 
19 
 
II  Expression and Knockdown of Primordial Germ Cell Genes, Vasa, Nanos and 
Dead end in Common Carp, Cyprinus carpio, Embryos for Transgenic Sterilization 
and Reduced Sexual Maturity 
 
Abstract:  
Common carp, Cyprinus carpio, is the most widely grown aquaculture species 
worldwide. Four types of knock down constructs designed to transgenically sterilize fish 
were electroporated into common carp embryos to knockdown or eliminate expression of 
primordial germ cell (PGC) proteins, nanos and dead end. Embryos from different 
developmental stages were collected and tested using quantitative realtime PCR. REST 
program was used to analyze gene expression among control embryos and embryos 
exposed to these constructs during development. Two proteins, nanos and dead end were 
targeted, each specific for a set of constructs, and a third related, but non-targeted PGC 
protein, vasa, was assayed. The effectiveness of constructs varied depending upon the 
promoter.  The expression levels of these proteins naturally decreased during 
development. In some, but not all cases, the expression of targeted mRNA was knocked 
down to minimal levels or degradation was accelerated. Up-regulation was also observed 
for dead end, possibly due to interferon responses. In other cases, the sterilization 
constructs had little effect on the targeted gene, but strongly down-regulated one or two 
of the alternative PGC genes examined in this study. At 19 months of age, common carp 
males exposed to these constructs had reduced rates of sexual maturity; however, 
reduction of female rates of sexual maturity was not conclusively shown. These 
constructs appear promising for the potential transgenic sterilization of common carp. 
This accomplishes the first step for transgenic sterilization of transgenic fish harboring 
other transgenes or other fish of concern for preventing environmental effects of 
aquacultured fish. 
Keyword: Transgenic sterilization, Common carp, Real-time PCR
 
20 
 
1. Introduction 
Common carp (Cyprinus carpio), is a widespread freshwater fish, and is one of the most 
economically important cultured species worldwide with an annual global production of 
3.4 million tons, accounting 14% of the freshwater aquaculture production in the world 
(FAO, 2007). Common carp is also selected and kept as ornamental species. One of the 
color variants of common carp, koi, is valuable ornamental species with more than 100 
different types of coloration (Wang and Li, 2004). Common carp is used as model species 
in the fields of immunology, developmental biology and others (Ji et al. 2012). Common 
carp have reproductive traits and early sexual maturity that may make them excellent, 
large, realistic, aquaculture model species for other warm water aquaculture species with 
long generation intervals such as channel catfish, Ictalurus punctatus. Although common 
carp have great economic importance, in many countries it is considered an invasive 
species. Once introduced and established, common carp are very hard to eradicate. 
Common carp populations have a negative effect on the environment in Australia, and the 
U.S government has been spent millions of dollars annually to control common carp 
populations. Transgenic technologies could be used to enhance common carp for 
aquaculture, but might also be used to help control common carp populations. 
Although transgenic technologies have shown promise for helping to supply the world 
populations with food, public fear exists that transgenic animals would pose risk to the 
environment and ecology upon release or escape. Two major categories of containment 
are physical and genetic confinement. Physical control has inherent risk, and cannot 
guarantee the establishment of transgenic lines in the natural environment (Wong and 
Eenennaam, 2008). Genetic control could include triploidy, however, triploidy requires 
existence of fertile, diploid transgenic brood stock, which opens the possibility of 
escapement and establishment of transgenic fish. Additionally, triploidy can decrease 
performance in fish (Lilyestrom et al. 1999; Dunham 2004, 2011) and is not feasible on a 
 
21 
 
commercial scale in the case of catfish and many other species of fish. Triploid induction 
reduced performance of GH transgenic fish negating about half of the enhancement from 
the transgenesis (Dunham 2004, Nam et al. 2004). Transgenic sterilization might obviate 
these problems, and could address other environmental impact issues with interspecific 
hybrid fish, exotic species and domestic fish. 
One transgenic sterilization technology that has been evaluated is Sterile Feral (SF) 
technology, a modified tet-off system (Thresher, et al 2005, 2009). The SF system 
comprises: a trigger molecule and construct. The construct is made of four main parts: 
first nucleic acid encoding a promoter, closely linked to the second nucleic acid encoding 
the tetracycline transcriptional activator protein (tTA), the third nucleic acid encoding a 
promoter called tet repressible element (TRE) and coupled to and tightly regulated a 
minimal promoter region, the fourth nucleic acid encoding a blocker molecule which 
could be antisense RNA, sense RNA, double-stranded RNA, or  ribozyme. The SF 
system works as follows: the first promoter drives the expression of tTA in a spatio-
temporal way; in the absence of trigger molecule (such as doxycycline), the tTA binds to 
TRE, thus activating the minimal promoter, eventually resulting in the transcription of the 
blocker gene and the death of embryos; in the presence of trigger molecule, the tTA binds 
to trigger molecule, which prevents the TRE, minimal promoter and block gene from 
working, the embryos develop normally. 
Expression of double stranded RNA, RNA interference (RNAi) technology is one 
potential mechanism used in SF technology. When sense and antisense  molecules linked 
by loop sequence bind each other and form a double-stranded RNA, they can silence 
genes after undergoing procession in the cell (McManus and Sharp, 2002; Bantounas, et 
al, 2004; Wong and Van Eenennaam 2008). Several important components are involved 
in the procession, which include Dicer, recognizing and cleaving double stranded long 
RNA into fragments; another protein complex, called RNA-induced silencing complex 
 
22 
 
(RISC), bind these fragments and unwind the duplex fragment into single strands. Sense 
strand of the siRNA is removed, but antisense remains bound to the RISC complex to 
detect mRNA molecules and guide their cleavage. The process would result in RNA 
degradation with siRNA, translational inhibition with microRNAs and probably target 
chromatin remodeling with the outcome of gene silencing.   
Another mechanism that can be used in SF technology is overexpression of cDNA, sense 
RNA, and this approach has disrupted BMP-2 function in zebrafish, common carp and 
channel catfish (Thresher et al. 2009). Gene overexpression with multiple-copy plasmid 
libraries has successfully suppressed a temperature-sensitive cdc24 mutation, leading to 
discovery of four such genes (Bender and Pringle, 1989). Overexpression could 
complement loss-of-function screens, and has dominant effects (Prelich, 2012).    
SF technology has been demonstrated with repression of the knockout function shown in 
zebrafish, oysters, channel catfish and common carp (Thresher et al. 2009). Although 
doxycycline (dox), used as the repressor molecule, can be easily administered in water to 
allow embryonic development, discharge of dox into the environment would be public 
concern and application of such system would be of great cost if scaled up. These 
problems might be solved by knocking out reproductive genes rather than embryonic 
development genes or by developing systems that are not dependent on dox. In both 
cases, targets could be primordial germ cell (PGC) genes responsible for PGC migration, 
colonization of the genital ridge and ultimately gamete formation. Candidate genes 
include nanos, vasa and dead end.  
Vasa gene is a germ cell marker in zebrafish, trout, tilapia and medaka and from gibel 
carp, Carassius auratus gibelio (Xu  et al., 2005). Vasa gene was only expressed in the 
gonads, rather than brain, liver, spleen, kidney, muscle and heart in gibel carp. Vasa  is 
expressed continuously in the germ line (Yoon, et al. 1997; Koprunner et al. 2001; 
Weidinger, et al 2003). Satio et al. (2006) concluded that vasa sequence does not work 
across many species and may have evolved to have different function in different species, 
while nanos has a more constant function across species. 
 
23 
 
Zebrafish nanos gene is essential for PGC formation, proper migration and survival 
(Koprunner, et al 2001). Nanos deficient PGCs migrate, but they exhibit abnormal 
morphology, and express mRNA in the soma. When nanos was knocked out, the PGC 
migration stopped and the PGCs eventually died. 
Dead end (dnd) is another important gene for migration and survival of PGCs. 
Knockdown of dnd confined the PGCs to the deep blastoderm in zebrafish, preventing 
migration and leading to the death of PGCs, but did not influence the secondary effect of 
PGC specification because of nos-1 and vasa were normally expressed till early 
gastrulation stages (Weiginger, et al 2003). However, expression of both nanos-1 and 
vasa markers gradually disappeared, though dnd RNA expressed longer after the PGC 
died (Weidinger et al. 2003). Males and females have different timing of germ cell 
proliferation (Moringa et al. 2004). Another study demonstrated a novel function of dnd 
that zebrafish would invariably develop into sterile males in PGCs were ablated using 
dnd antisense morpholino oligonucleotide (MO). dnd was vital for female development 
(Slanchev et al. 2005), confirming the result of the dead end knockouts being male in 
zebrafish with higher sterility (Weidinger et al. 2003). Ablation of the germ line with Dnd 
(MO) resulted in smaller gonad structure in zebrafish embryos (Slanchev, et al., 2005). 
No gonad-like structures were found in dnd MO injected fish at 90 days post-fertilization. 
In zebrafish, germ cells are not required for the formation of the gonads but are essential 
for its differentiation and survival. Sterile zebrafish males without gonads still exhibited 
sexual behavior and could induce normal females to ovulate. If these embryos were 
treated with estrogen, they developed into sterile fish with female characteristics. The 
unique expression pattern of nanos, dnd and vasa make them applicable and potentially 
advantageous in transgenic sterilization, because pleiotropic effects would be predicted to 
be minimal when multiple functions and interactions do not exist. 
Our objectives were to determine the normal pattern of gene expression of nanos, vasa 
and dead end in common carp embryos, evaluate shRNAi constructs and a cDNA 
construct designed for knockdown of nanos and dead end in channel catfish 
(theoretically, disrupting migration of the PGCs and preventing germ cell development), 
examine off target effects, determine the effectiveness of different promoter systems, and 
 
24 
 
determine sexual maturity in 19-month-old common carp exposed to transgenic 
sterilization constructs during embryonic development.  
2. Materials and Methods 
2.1 Construction of plasmids 
All the constructs used in this experiment have the backbone of the plasmid FRMwg 
(GenBank: AF170915.1; Gibbs and Schmale, 2000), which has three primary elements, 
insulator, Ocean pout terminator and boundary element. The regulatory elements 
triggering the knockdown systems included Tet-off based, yeast copper control based, 
yeast reduced copper control based, zebrafish racemase based and zebrafish Adss based 
systems. These systems were modified according to the sterile feral, SF, system described 
by Thresher, et al (2005, 2009). 
Channel catfish nanos gene and the channel catfish vasa promoter were sequenced. All 
construct systems included 4 alternative knockdown genes components, nanos1 ds-sh 
RNA, nanos2 ds-sh RNA, nanos cDNA and dead end ds-sh RNA. These were inserted 
between the insulater and Ocean pout terminator. Nanos1 and Nanos2 in our study were 
designed as short hairpin structure targeting 5? (abbreviation N1) and 3? (abbreviation 
N2) of nanos gene; Nanos cDNA was full-length of cDNA sequence of nanos of channel 
catfish (abbreviation cDNA). Dead end ds RNA was as short hairpin structure of channel 
catfish dead end gene (dnd) (see Fig.1.). 
Channel catfish, Ictalurus punctatus: dnd shRNA designs. 
ShRNA design against dead end gene of the channel catfish. 
Oligo1.5?GTTCCAGAGCGTAGCGCCGCTCTACGAGTTCCGAGCGGCGCTACGCTCTGGAAC3? 
Oligo2.3?CAAGGTCTCGCATCGCGGCGAGATGCTCAAGGCTCGCCGCGATGCGAGACCTTG5? 
Channel catfish, Ictalurus punctatus: nanos shRNA designs. 
N1: targeting 5? nanos gene 
Oligo1.5?CTCTCTATCCCGATGACTCGCGATGGTGTTTTCGCGAGTCATCGGGATAGAGAG3? 
 
25 
 
Oligo2.3?GAGAGATAGGGCTACTGAGCGCTACCACAAAAGCGCTCAGTAGCCCTATCTCTC5? 
N2: targeting 3? nanos gene 
Oligo3.5?CCGAAAATCTGAACCCCACTCTCACACTCGCTAGAGTGGGGTTCAGATTTTCGG3? 
Oligo4.3?GGCTTTTAGACTTGGGGTGAGAGTGTGAGCGATCTCACCCCAAGTCTAAAAGCC5? 
Legend: Loops were in grey shade, stem sequences were underlined. 
Fig. 1. Double stranded short hairpin structures dead end sh (dnd shRNA), and nanos shRNAs 
(5?nanos sh and 3?nanos sh) used for knockdown Primordial germ cell marker genes   
The catfish nanos promoter was used to drive the tet-off system. Other promoters 
included adenylase promoter and racemase promoter from zebrafish, yeast (copper 
specific transcriptional repression) CTR3 promoter and CTR3 promoter but less 
sensitive. They are designated as Nanos, ADSS, RM, M and MCTR, respectively. After 
designing the constructs, they were synthesized at GenScript Corporation (Piscataway, 
New Jersey, U.S.A).   
2.2 Construct preparation, extraction and linearization  
Plasmids were transformed with One Shot? Top10 chemically competent E.coli cell, 
following the procedures recommended by the protocol. About 100 to 200 ?l 
transformation mix was used to plate on the LB agar (10.0 g Tryptone, 5.0 g yeast 
extract, 5.0 g NaCl, 15.0 g agar in 1.0 L solution) plates. A single colony was picked up 
from each plate to conduct a mini-prep plasmid DNA extraction (Qiagen mini-prep). 
Plasmids were linearized with SfiI (20,000 units/ml, BioLabs) following the product?s 
protocol with little modification. For each plasmid digestion, a mixed 50 ?l reaction 
solution contains 1 ?g of plasmid DNA, NEBuffer 4 (10?), BSA (100?) and the volume 
adjusted using water to 50 ?l.   
DNA Agarose Gel electrophoresis was used to analyze the plasmid DNA (using uncut 
plasmid, SfiI cut plasmid). Once the size of plasmid was confirmed, a maxi-prep plasmid 
DNA extraction was carried out using Qiagen maxi-prep kit. Plasmid DNA was 
linearized following the same enzyme digestion protocol. After plasmids linearization, 
phenol-chloroform-ethanol method was used to inactivate SfiI enzyme and purify the 
 
26 
 
DNA. The quantity of DNA was measured using a UV-spectrophotometer. Each plasmid 
from above procedure was prepared and diluted in 6.0 ml TE buffer (5 mM Tris-HCl, 0.5 
M EDTA, pH=8.0) at the concentration 50 ?g/ml.  
2.3 Brood fish and gamete  
Common carp males and females were kept in troughs at the Fish Genetics Research 
Unit, Auburn University. The water temperature was kept at 25 ?C before the fish were 
induced to spawn in the early January, 2011. Brood stock carp with visible reproductive 
traits were induced using cap pituitary extraction (CPE).  CPE were dissolved 30-45 min 
in the 0.85% saline before injected with priming dose of 0.4 mg/kg and followed 12 
hours later with a resolving dosage of 3.6 mg/kg, respectively. After the priming 
injection, male common carp were placed downstream of the females, but separated by a 
divider.  
Females ovulating eggs were anesthetized with 200 mg/L tricaine methanesulfonate (MS-
222), and were slight rinsed in the trough with genital vent covered with a finger. The 
anesthetized females were towel dried and eggs were hand-stripped into pans or bowl 
lubricated with Crisco vegetable shortening. Males were anesthetized, rinsed and dried in 
the same way and sperm were hand stripped into a sterile dry cup.  
2.4 Gene transfer and electroporation procedures  
High quality eggs with greenish and yellowish color were distributed evenly in small 
petri dishes. One to two drops of sperm were spread onto one thin layer egg (around 250 
eggs) using 3.0 ml syringe. Pond water (pre-heated to 25 ?C) was quickly added for 
fertilization. After 5minutes, fertilized eggs were transferred into a larger pan with 
enough pond water to incubate the zygotes with periodic agitation. After 20 min, the eggs 
were collected into the petri dishes (cuvette) for electroporation.  Plasmid DNA solution 
was quickly added onto the fertilized eggs. Electroporation was performed with the 
Baekon 2000 macromolecule transfer system. Parameters were set at 6 kV, 27 pulses, 0.8 
sec burst, 4 cycles, 160 ?sec (Powers et al., 1992). Non-contact mode of electroporation 
with the electrode 1 to 2 mm above the buffer was applied.  Once finishing 
 
27 
 
electroporation, the eggs were transferred into the Holtfreter?s solution (NaCl 3.5g, 
NaHCO3 0.2 g, KCl 0.05 g, MgSO4 333 ?l (300 g in 500 ml), CaCl2 333 ?l (150 g in 500 
ml), pH: 7~7.5 in 1.0 L decholorined water) in separate tubs (Armstrong, et al. 1989). 
Dead embryos were picked out and water was changed daily. Water temperature was kept 
at 25~26 ?C using submersible heaters.   
 2.5 Embryos collection and RNA extraction 
Embryos were collected at different time points, 0, 6, 12, 24, 48, and 72 hours post 
fertilization (hpf) for both non-transgenic embryos and potential transgenic embryos. 
Around 0.5 ml of embryos were collected into a 1.5 ml sterile tube and three replicates 
per sample were immediately submerged in liquid nitrogen. All the samples were stored 
at -80 ?C till RNA extraction. Samples were ground using mortar and pestle in the 
presence liquid nitrogen. 
RNA was extracted using TRIzol? Reagent (Ambio, cat #: 15596-018) and the extraction 
procedure followed the manufacture?s recommendation. The quality and concentration of 
all the samples were checked by gel electrophoresis and UV-spectrophotometer. All 
extracted samples had an A260/280 ratio greater than 1.8, and were diluted to 500 ng/ ?l.   
2.6 Real-time PCR 
RNAs were reverse transcribed into cDNAs by iScript Synthesis Kit (Bio-Rad, USA, cat 
#: 170-8891). Each of the reaction consisted of a total volume of 10 ?l containing 4.0 ?l 
iScript reaction mix, 1.0 ?l iScript reverse transcriptase, 500 ng RNA template, and water 
to reach the 10 ?l volume. The reaction followed the protocol: 5 minutes at 25 ?C, 30 min 
at 42 ?C, 5 min at 85 ?C.  
qRT-PCR was carried out on a C1000 Thermal Cycler (Bio-Rad, USA) by using SsoFast 
EvaGreen supermix kit (Bio-Rad, USA, cat: #172-5201) following the manufacturer?s 
instructions with modification. Briefly, all qRT-PCR reactions were performed in a 10 ?l 
total reaction volume (9.0 ?l mix and 1.0 ?l  200 ng/?l cDNA). The mix contained 1.0 ?l 
of each primer (5 umol/ ?l), 5.0 ?l SsoFast EvaGreen supermix, 2.0 ?l RNase/DNase-
 
28 
 
free water.  The same cycling conditions were used for all the tested samples: 
denaturation, 95 ?C /30s, 40 cycles of 95 ?C /5s, and 57 ?C /5s followed by melting curve 
analysis, 5s at 65?C, then up to 95?C at a rate of 0.1 ?C/s. The mRNA levels of all the 
samples were either normalized to the levels of 0 hpf PGC marker genes expression for 
non-transgenic control or to the non-transgenic control sample of the same time point for 
the knockdown effect measurement. Ribosome 18s mRNA was used a reference gene. 
Crossing-point (Ct) values were exported into Excel sheet from Bio-Rad CRX Manager 
(Version 1.6.541.1028, 2008). The relative expression ratio of target gene was analyzed 
for significance test using a randomization test in the REST (Pfaffl, et al 2002) software 
assuming 100% efficiencies. The results were graphed with corresponding standard 
errors.    
2.7 Data mining and primer design 
Sequence of nanos, vasa, and 18s ribosomal mRNA gene of Cyprinus carpio could be 
found in NCBI with the accession ID, 323098305, 28275371 and 29336521, respectively. 
However, sequence of dead end in Cyprinus carpio was unavailable up to now. 
Therefore, sequences of dead end from Danio rerio, Misgurnus anguillicaudatus, 
Oncorhynchus mykiss, and Carassius auratus were aligned and analyzed (Fig. 12.) using 
Multiple Sequence Alignment by CLUSTALW program 
(http://www.genome.jp/tools/clustalw/). Conserved region from the alignment was used 
to design dead end primer. Primers were designed using primer3plus (Rozen and 
Skaletsky, 2000. Online primer design tool).  Primers were listed in (Table 1).  
Table 1 QT-PCR Primers used for detection knockdown effect on PGC marker genes in common carp 
(Cyprinus carpio).   
Gene name GID Forward primer Reverse primer 
18s gi|29336521 CATGGCCGTTCTTAGTTGGT CGGACATCTAAGGGCATCAC 
Nanos gi|323098305 GGAGAAAAGAGACCCGGAAC AATCTCTTGGTGTGCGCTTT 
Vasa gi|28275371 GGGCTGCAATGTATTGTGTG GGCACTGAACATGAGGGTTT 
Dead end gi|47086450 AAGTCAATGGGCAGAGGAAA TCATGAGGCGAAACTCGTAA 
 
29 
 
 
2.8 Sexual Maturity 
The electroporated common carp were kept in aquarium and fed AquaMax? Fish Diet 
(PMI Nutrition International, LLC, St. Louis) till 19 month old. Two indicators were used 
to determine sex and state of sexual maturity in the current study (Jhingran and Pullin, 
1985). Male common carp have a concave and triangular pit-like genital opening, while 
females have a protruding, swollen genital opening which is more oval with pinkish 
margins. Sexually mature females have a soft, swollen abdomen, and sometimes when 
gentle pressure was applied against the abdomen, the vent would slightly open and ova 
became visible inside the genital aperture. When abdominal pressure was applied to 
sexually mature males milt could be extruded. 
2.9 Statistical analysis 
Fisher's Exact Test and Fisher's Multi-treatment Exact Test were used to compare rates of 
sexual maturity between and among the different treatment groups. REST? (Relative 
Expression Software Tool, Pfaffl, et al 2002) using Pairwise Fixed Reallocation 
Randomisation Test? was applied to compare the three target genes with a reference 
gene between the treated group and control group. Group means were used to express 
differences in expression between control and treated sample. Mean crossing point 
deviation of control and sample group was normalized by a reference transcript. 
Statistical significance was performed by randomization test with 2,000 
randomisations/test (P<0.05).   
3. Results 
3.1 Primer specificity   
The alignment of sequences of dnd from Danio rerio, Misgurnus anguillicaudatus, 
Oncorhynchus mykiss, and Carassius auratus are highly conserved (Fig.2). Although dnd 
sequence from a close family number of Cyprinidae, Carassius auratus was chosen, 
primer design was based on the highly conserved region from zebrafish. Only a one 
 
30 
 
nucleotide difference in the forward primer and a three nucleotide difference in the 
reverse primer were found when comparing dnd sequences of C. auratus and Danio 
rerio. 
DNA agarose gel electrophoresis was used to check the primer specificity from a RT-
PCR test, indicating dnd primer could amplify one single band at 168 bp (data not 
shown). Specificity of each primer set was confirmed from real-time PCR because single 
peaks present in the melting curve analysis indicated that PCR product was specifically 
amplified as a single product (data not shown).  
3.2 Relative expression of the three PGC marker genes in control embryos. 
Embryos underwent early gastrulation (blastopore) at 6 hpf and neurulation at 12 hpf. At 
24 hpf, embryonic movement started, and the cephalic region broadened with distinct 
fore brain. At 48hpf, the lens formed in the eyes and the heart formed while at 72 hpf, 
hatching began.  
Nanos and vasa exhibited a similar expression pattern.  Both nanos and vasa were 
significantly up-regulated at 6 hpf (approximately 1.5X, Fig. 3.). Both nanos and vasa 
genes down regulated significantly and progressively from 6hpf to 72hpf (2X at 12 h, 3-
5X at 24 h and 5-7X at 48 h). At each point, vasa gene expression was relatively lower 
than that of nanos gene except at 12 hpf. Vasa gene was down-regulated more than that 
of nanos from 24 hpf toward 72 hpf, and progressively so.  At 72 hpf, both of nanos and 
vasa were expressed at their lowest level with nanos down-regulated about 7X and vasa 
down regulated approximately 11X.
 
31 
 
gi|47086450                   ----------------CTTTAATGACCTTTTCTTGACTTT----TCCACCAATTTACAGG 
gi|371535697                  --------------------------------------AC----GCGGGGGATTTACAGG 
gi|307548814                  GGAATCATGGGGTTCATCCTATTGACCTTTCCTTGACTCTCTCTTTCATCAATTTACAGG 
gi|185135188                  ----------------------------ACTAATGACTAGAAAGCAGATTAGGTAATTGT 
                                                                                   * *  *  
gi|47086450                   TGTGTCTATCATCATCATCACAGATGGTCGGAGACATGGATGCCCAGCAGCAGGAGCTTC 
gi|371535697                  TGCGC----------CATCACAGGTGGACAGCGGCATGGAGGGACAGCAG------CTAC 
gi|307548814                  TGCGTCG--------TCTCATAAGCAGCAAACGCAATGGAAGG--AGCAG----ATCTGC 
gi|185135188                  TGCTA----------CTTTTTCGAAACCTAGGATAATGGAGG---AGCGT------TCAA 
                              **               *                 ***** *   ***             
gi|47086450                   AGCAGATTCTGAACCCGCAGAAACTCAAGTCTCTGCAGGAATGGATGCAGAGGAACTCCA 
gi|371535697                  AGCAGGTTTTGAACCCGCAGAGACTGAAATCACTACAAGAATGGATGCAGAAAAGCTCAG 
gi|307548814                  TACAGCTTTTCAACCCGCAGGCACTGAAGGCACTGAAGGAGTGGATGCAAAAATCCTCCA 
gi|185135188                  GTCAGGTGTTGAACCCGGAGCGACTGAAGGCGCTGGAGATGTGGCTGCAGGAGACTGACG 
                                *** *  * ****** **  *** **  * **  *    *** ****            
                                   AaGTCAATGGGCAGAGGAAA 
gi|47086450(Danio rerio)      TCACTTTAACCCAAGTCAATGGGCAGAGGAAATATGGTGGTCCTCCTCCAGGTTGGCAGG 
gi|371535697(C.auratus)       TCACTTTAACACAGGTCAATGGGCAGAGGAAATATGGTGGTCCTCCTGTTGGCTGGCAAG 
gi|307548814              CCACCCTAACGCAGGTCAACGGTCAGAGGAAATATGGTGGTCCTCCTCCGGGCTGGCACG 
gi|185135188                  TCAAACTGACCCAAGTCAATGGCCAGAGAAAATATGGAGGTCCACCTGATGATTGGCTTG 
                               **   * ** ** ***** ** ***** ******** ***** ***   *  ****  * 
gi|47086450               GTCCTGCTCCTGGTTCGGGCTGTGAGGTTTTCATCAGTCAGATCCCGAACGACGTGTACG 
gi|371535697              GTCCTGCTCCCGGCCCGGGGTGTGAGGTTTTCATCAGTCAGATCCCATGTGATGTCTATG 
gi|307548814                  GTCCTGCTCCAGGGCCAGGTTGCGAGGTCTTTATCAGTCATATTCCACGTAACGTCTTTG 
gi|185135188                  GCGCCCCCCCTGGGCCGGGCTGTGAGGTGTTCATCAGCCAGATCCCGCGGGATGTCTTTG 
                              *  *  * ** **  * ** ** ***** ** ***** ** ** **     * ** *  * 
                                                                      TTAcGAgTTTCGcCTCATGA 
gi|47086450(Danio rerio)      AGGACCGCCTGATCCCTCTCTTCCAGAGCATCGGCACCATTTACGAGTTTCGCCTCATGA 
gi|371535697(C.auratus)       AGGACCACCTGATCCCTCTTTTCCAGAGCATTGGAACAATTTATGAATTTCGTCTCATGA 
gi|307548814              AGGACACCCTAATCCCGCTCTTCCAGAGAGTCGGCACTCTATACGAGTTTCGTCTCATGA 
gi|185135188                  AGGACCAGCTGATTCCGCTGTTCCGTGCGGTGGGCCCTCTCTGGGAGTTCCGCCTCATGA 
                              *****   ** ** ** ** ****      * **  *  * *  ** ** ** ******* 
 
gi|47086450                   TGAACTTCAGCGGGCAGACCCGGGGCTTCGCCTATGCTAAGTACGGTGACCCTCTTACAG 
gi|371535697                  TGAACTTCAGTGGGCAGAACCGTGGCTTCGCCTACGCTAAGTATGGTGACCCGGTCACCG 
gi|307548814              TGAACTTCAGTGGGCAGAACCGCGGCTTCGCCTACGCTAAGTACGGTGACCAGGTCACGG 
gi|185135188              TGAACTTCAGCGGACAGAACCGTGGCTTTGCCTACGCCAAGTACGACAGCCCTGCCTCGG 
                              ********** ** **** *** ***** ***** ** ***** *    **      * * 
 
Fig.2. CLUSTAL 2.1 multiple sequence of dead end genes alignment result among Danio rerio, Misgurnus anguillicaudatus, Oncorhynchus mykiss, and 
Carassius auratus (C.auratus). 
 
32 
 
 
 
Fig. 3. Analysis of relative expression of nanos and vasa gene during embryos development using real-time 
PCR in non-transgenic common carp (Cyprinus carpio). The samples were analyzed at 6 h, 12 h, 24 h, 48 h 
and 72 h post fertilization, respectively. Relative nanos and vasa genes expression were expressed as fold 
change over control samples taken at 0h of unfertilized egg as normalized to change in the expression of 
18s control. Relative fold changes were expressed as mean ?SE; all the fold changes were significant at the 
level of P< 0.05 using Pairwise Fixed Reallocation Randomisation Test. 
Dnd gene was down-regulated during early embryo development (Fig. 4). Dnd gene was 
down-regulated more dramatically at each time point compared with that of the other 
nanos and vasa. From 6 hpf to 72 hpf, dnd was continuously down regulated; 72 hpf 
expression showed the lowest down-regulated value (580X).  
 
33 
 
 
Fig.4. Analysis of expression of dead end gene during early embryos development using real-time PCR in 
non-transgenic common carp (Cyprinus carpio). The samples were analyzed at 6 h, 12 h, 24 h, 48 h, and 72 
h post fertilization (hpf). Relative dead end expression was expressed as fold change over control samples 
taken at 0h of unfertilized egg normalized to change in the expression of 18s control. Relative fold changes 
were expressed as mean ?SE. Numbers next to the dot on the line indicated relative fold change over time. 
Stand error were less than 0.001 except that at 6hpf which was 0.107. All the values were significant at the 
level of p < 0.05 except that of 6 hpf (p=0.081) using Pairwise Fixed Reallocation Randomisation Test. 
 
3.3 Effect of promoters on each knock down construct. 
3.3.1 Effects of Nanos, M, MCTR and RM promoter on knock down by dnd shRNAi 
In general, these promoters were ineffective in knocking down the target, dnd (Fig.5), 
and had the opposite effect, up-regulation of dnd. At one time point, 24 h, the nanos 
driven construct did down-regulate dnd 4X, and at 72 h the M driven construct down-
regulated dnd approximately 2X.  
Off target knock down of nanos and vasa was prevalent with the dnd shRNAi construct 
(Fig.5). dnd shRNAi construct driven by promoters M, Mctr and RM knocked down 
nanos upwards to 7-22X at all-time points with MCTR appearing to be the most 
consistent. Vasa was knocked down to a lesser degree and less consistently. The  
 
34 
 
construct driven by M gave the strongest and most consistent result.  
 
Fig.5. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter M, yeast CTR3 
promoter mctr (less sensitive) and zebrafish racemase (RM)) on channel catfish dead end (dnd) expression. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 12, 24, 48 and 72 hours after 
fertilization during embryonic development of common carp, Cyprinus carpio, using knockdown constructs 
with shRNAI targeting dead end gene (DND). Relative PGC genes expressions were expressed as fold 
change over control samples taken at the same time point as normalized to change in the expression of 18s 
control. Relative fold changes were expressed as mean ?SE. All the values were significant at the level of p 
< 0.05 unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
3.3.2 Effects of Nanos, Mctr and Racemase promoter on knock down by nanos cDNA  
Nanos, mctr and rm promoter worked in concert with nanos cDNA to knockdown the 
PGC markers nanos and vasa (Fig.6). Knock down was the least at 12 hpf. Consistent 
with the results for the dnd shRNAi constructs, MTCR drove the strongest knock down 
of nanos and vasa. 
Again, dnd was not knocked down dramatically or was up- regulated. The MCTR driven 
construct had strong up-regulation 25X on dnd at 12 h, but little or no effect during the 
rest of development. The RM driven construct had the most consistent up-regulation of 
 
35 
 
dnd, 4-10X at all-time points.  Overall, the nanos driven construct did not have much 
effect on RNA levels of nanos, vasa and dnd. 
 
Fig.6. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter mctr (less 
sensitive) and zebrafish racemase (RM)) on channel catfish nanos cDNA expression. Expression of PGC 
genes (nanos, vasa and dead end) were measured at 12, 24, 48 and 72 hours after fertilization during 
embryonic development of common carp, Cyprinus carpio, using knockdown constructs with shRNAI 
targeting channel catfish nanos cDNA. Relative PGC genes expressions were expressed as fold change 
over control samples taken at the same time point as normalized to change in the expression of 18s control. 
Relative fold changes were expressed as mean ?SE. All the values were significant at the level of p < 0.05 
unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
3.3.3 Effects of Nanos, M and Racemase promoters on knock down by nanos sh-5? 
construct 
The M promoter worked best with sh5? nanos gene (Fig.7). It knocked down nanos and 
vasa at 24, 48 and 72 hours.This combination also knocked down the off-target dnd at 24 
and 72 h, although it up-regulated dnd at 12 and 48 h. 
The Nanos promoter with sh5? nanos gene also knocked down nanos at 24 h, 48 h and 72 
h, but not as strikingly as M. This nanos construct did not affect vasa mRNA levels, but 
 
36 
 
was the only construct that up-regulated dnd gene at all-time points. The RM promoter 
construct knocked down nanos at 12 h, 24 h and 48 h, but not dramatically. 
 
Fig.7. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter m and zebrafish 
racemase (RM)) on 5? channel catfish nanos expression. Expression of PGC genes (nanos, vasa and dead 
end) were measured at 12, 24, 48 and 72 hours after fertilization during embryonic development of 
common carp, Cyprinus carpio, using knockdown constructs with shRNAI targeting channel catfish 5? 
nanos. Relative PGC genes expressions were expressed as fold change over control samples taken at the 
same time point as normalized to change in the expression of 18s control. Relative fold changes were 
expressed as mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk 
using Pairwise Fixed Reallocation Randomisation Test. 
3.3.4 Effects of Nanos, M, Racemase and ADSS promoter on knock down by nanos sh-3? 
construct 
Again, the construct driven by M was the most consistent, knocking down nanos at all-
time points (Fig.8), and it also knocked down the off-target vasa at all-time points.  The 
ADSS driven construct was also quite effective for knocking down nanos from 12 hpf to 
48 hpf. The construct driven by RM had strong down-regulation on nanos and vasa at 
hatch (72 hpf). Regulation of dnd was inconsistent from one time point to another with 
the nanos driven construct again up-regulating dnd 12-48 hpf. 
 
37 
 
 
Fig.8. Effect of different promoters (channel catfish nanos (nanos), yeast CTR3 promoter m and zebrafish 
racemase (RM)) on 3? channel catfish nanos expression. Expression of PGC genes (nanos, vasa and dead 
end) were measured at 12, 24, 48 and 72 hours after fertilization during embryonic development of 
common carp, Cyprinus carpio, using knockdown constructs with shRNAI targeting channel catfish 3? 
nanos. Relative PGC genes expressions were expressed as fold change over control samples taken at the 
same time point as normalized to change in the expression of 18s control. Relative fold changes were 
expressed as mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk 
using Pairwise Fixed Reallocation Randomisation Test. 
3.4 Effects of genes in nanos constructs on PGC marker genes 
Nanos 
In general, constructs driven by the catfish nanos promoter down-regulated their target 
except when the target was dnd (Fig.9). Nanos-cDNA was the only construct that down-
regulated nanos at all-time points. Nanos-N5?had the strongest down-regulation 4-10X 
during the period 24 hpf-72 hpf.  
These constructs had sporadic effects on the off-target vasa. However, Nanos-cDNA was 
again the only construct to down-regulate at all-time points and most strongly. In general, 
 
38 
 
this set of constructs up-regulated dnd, and the shRNAi constructs had the greatest up-
regulation. 
 
Fig.9. Effect of same promoter channel catfish nanos (nanos) on different shRNA structures (channel 
catfish dead end (dnd), nanos cDNA (cDNA), 5?sh nanos (N1), and 3?sh nanos (N2) expression. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 12, 24, 48 and 72 hours after 
fertilization during embryonic development of common carp, Cyprinus carpio, using knockdown constructs 
with shRNAi. Relative PGC genes expressions were expressed as fold change over control samples taken at 
the same time point as normalized to change in the expression of 18s control. Relative fold changes were 
expressed as mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk 
using Pairwise Fixed Reallocation Randomisation Test. 
Racemase 
Racemase driven constructs tended to have stronger expression than nanos (Fig. 10). 
Oddly, RM-dnd was effective at down-regulating the off target nanos. This construct and 
the RM-cDNA had the strongest down-regulation of nanos, usually 4-21X. Most of the 
constructs down regulated vasa, but not as strongly as nanos and again up-regulated dnd. 
RM-cDNA most strongly, upwards to 10X, up-regulated dnd. 
 
39 
 
 
Fig.10. Effect of same promoter zebrafish racemase (RM) on different shRNA structures (channel catfish 
dead end (dnd), nanos cDNA (cDNA), 5?sh nanos (N1), and 3?sh nanos (N2)) expression. Expression of 
PGC genes (nanos, vasa and dead end) were measured at 12, 24, 48 and 72 hours after fertilization during 
embryonic development of common carp, Cyprinus carpio, using knockdown constructs with shRNAI. 
Relative PGC genes expressions were expressed as fold change over control samples taken at the same time 
point as normalized to change in the expression of 18s control. Relative fold changes were expressed as 
mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk using 
Pairwise Fixed Reallocation Randomisation Test. 
M 
M driven constructs exhibited a similar pattern of regulation as the previous constructs 
(Fig. 11). M-DND and M-sh3? down-regulated nanos (P<0.05) at all-time points and 
downwards to 18X. Again, the sh5? construct had observed down-regulation of greater 
magnitude that the sh3? construct. All constructs also down-regulated the off target vasa, 
 
40 
 
but not as strongly as nanos. Effects on dnd were small and sporadic. 
 
Fig.11. Effect of same promoter yeast CTR3 (M) on different shRNA structures (channel catfish dead end 
(dnd), 5?sh nanos (N1), and 3?sh nanos (N2)) expression. Expression of PGC genes (nanos, vasa and dead 
end) were measured at 12, 24, 48 and 72 hours after fertilization during embryonic development of 
common carp, Cyprinus carpio, using knockdown constructs with shRNAI. Relative PGC genes 
expressions were expressed as fold change over control samples taken at the same time point as normalized 
to change in the expression of 18s control. Relative fold changes were expressed as mean ?SE. All the 
values were significant at the level of p < 0.05unless marked with asterisk using Pairwise Fixed 
Reallocation Randomisation Test. 
MCTR 
Only two MCTR constructs were evaluated but they gave similar results as other 
constructs in the study (Fig. 12). MCTR-DND and MCTR-cDNA both down-regulated 
nanos as much as 20X, and both down regulated the off target, vasa, to a lesser extent. 
Both had variable effects on dnd, but at 12 hpf the cDNA construct up-regulated dnd 25X 
(P<0.05). 
 
41 
 
 
Fig.12. Effect of same promoter yeast CTR3 with reduced sensitive (MCTR) on different shRNA structures 
(channel catfish dead end (dnd) and nanos cDNA (cDNA)) expression. Expression of PGC genes (nanos, 
vasa and dead end) were measured at 12, 24, 48 and 72 hours after fertilization during embryonic 
development of common carp, Cyprinus carpio, using knockdown constructs with shRNAI. Relative PGC 
genes expressions were expressed as fold change over control samples taken at the same time point as 
normalized to change in the expression of 18s control. Relative fold changes were expressed as mean ?SE. 
All the values were significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed 
Reallocation Randomisation Test. 
3.5 Sex maturity  
In the control group, males showed 100% sexual maturity at 19 months of age and 
females showed 25% maturity (Table 2).  Low number of fish prevented meaningful 
analysis in many cases. However, M-DND and Nanos-N2 treated males had less (P< 
0.05) sexual maturity than control males, and MCTR-DND males had less (P=0.07) 
sexual maturity than control males. In the case of females, no differences (P>0.05) in 
sexual maturity were observed between control and females treated with knock down 
constructs. If sexes are pooled, ADSS-N2 treated fish also had less (P<0.07) sexual 
maturity than controls. 
 
 
42 
 
Table 2. Sexual maturity of putative 19-month sterile transgenic common carp (Cyprinus carpio) 
electroporated with different knockdown constructs. Im: immature or sterile; m: sexually maturecontaining 
gametes; m%: maturity percentage. Percentage mature is significantly different from the non-electroporated 
controls (*P<0.05, **P<0.01,***P<0.001;Fisher's Exact Test and Fisher's Multi-treatment Exact Test).  
Construct Male Female Pooled by Sex Im M M% Im M M% Im M 
ADSS N2 2 0 0 4 0 0 6 0** 
M N1 1 0 0 1 0 0 2 0 
RM DND 1 0 0 2 0 0 3 0 
RM cDNA 1 0 0 1 0 0 2 0 
RM N1 5 3 37.5 2 1 33.3 7 4 
RM N2 2 0 0 2 0 0 4 0 
M DND 3 0 0.0* 3 1 25 6 1 
MCTR DND 4 1 20.0** 9 0 0 13 1* 
MCTR cDNA 1 0 0 1 0 0 2 0 
Nanos DND 1 0 0 na na na 1 0 
Nanos cDNA 1 0 0 1 0 0 2 0 
Nanos N1 2 0 0 na na na 2 0 
Nanos N2 3 0 0.0* 1 0 0 4 0 
Control 0 3 100 6 2 25 6 5 
 
If knock down constructs are pooled among promoters, reduction in sexual maturity rate 
for electroporated embryos was more obvious for males and pooled sex, but not females 
(Table 3). Differences in male maturity existed among groups (P=0.01), and all four 
knock down types, N1, N2, nanos cDNA and DND had less sexual maturity (P<0.05) 
than control males. Differences in maturity for pooled sexes existed among groups 
(P=0.01), and three knock down types, N2 (P<0.05), nanos cDNA (P<0.07) and DND 
(P<0.05) had less sexual maturity (P<0.05) than pooled control sexes.   
 
Table 3 Sexual maturity of putative 19-month sterile transgenic common carp (Cyprinus carpio) 
electroporated with different knockdown constructs pooled by knockdown element. Im: immature or 
sterile; m: sexually mature containing gametes; m%: maturity percentage. Percentage mature is 
significantly different from the non-electroporated controls (*P<0.05, **P<0.01,***P<0.001; Fisher's Exact 
Test and Fisher's Multi-treatment Exact Test). N1and N2: short hairpin structures targeting 5? and 3? of 
based on channel catfish nanos gene; cDNA: channel catfish nanos cDNA; Dnd: short hairpin structure of 
based on channel catfish dead end gene.  
 
43 
 
Gene 
Male  Female  Pooled  
Im  M M%       Im  M M% Im  M M% 
N1 8 3 27.2* 3 1 25.0 11 4 26.7  
N2 7 0 0.0* 7 0 0.0 14 0 0.0* 
cDNA 3 0 0.0* 3 0 0.0 6 0 0.0** 
Dnd  9 1 10.0* 14 1 6.7 23 2 8.3* 
Control  0 3 100.0 6 2 25.0 6 5 45.4  
 
4. Discussion 
4.1 Normal pattern of PGC marker genes expression 
A significant quantity of vasa, nanos and dnd mRNA was present in the unfertilized 
common carp eggs. After fertilization and within 6 hours, there was a significant, but not 
dramatic up-regulation of nanos and vasa (approximately 1.5X, Fig. 3). Both nanos and 
vasa genes were progressively down regulated from 6 hpf to 72 hpf (2X at 12h, 3-5X at 
24 h and 5-7X at 48 h). At 72 hpf, both of nanos and vasa were expressed at their lowest 
level with nanos down-regulated about 7X and vasa down regulated approximately 11X 
compared to the 0 h control. It appears that vasa and nanos genes shut down early in 
embryogenesis, and their corresponding mRNA, which could have been as much as 40% 
of maternal origin depending upon rates of degradation, and during the remainder of 
embryogenesis after 6 hpf these mRNAs are degraded in a linear fashion. However, 
maternally derived nanos mRNA in zebrafish degrades rapidly before gastrulation but 
having strong signal using Northern blot (Koprunner, et al., 2001), so perhaps very little 
rather than 40% of the vasa and nanos mRNA that was detected at 6hpf (the time of 
gastrulation in the current study) was of maternal origin. This raises the question of what 
is the purpose of the relatively high levels of nanos and vasa in the common carp egg and 
presumably the zebrafish, if it is going to be replaced or supplemented by embryonically 
derived nanos and vasa mRNA around the time of gastrulation? If it is being 
supplemented, this could mean that the maternal levels, although easily detectable, are 
 
44 
 
not adequate for development and PGC migration.  For some reason, up-regulation of 
nanos and vasa at gastrulation appears important. 
Results of Xu et al (2005) examining the vasa homolog from gibel carp (Carassius 
auratus gibelio) were also similar to ours. Vasa expression was high in unfertilized eggs 
and continued throughout cleavage to the early gastrula stage, then dramatically declined 
to barely detectable level during neurula, muscle, heart beating, prehatch and hatch stage 
as measured by RT-PCR.   
There are two types of maternal nanos mRNA in zebrafish, nos1 and nos2. Nos1 has been 
involved to PGC migration and survival during embryogenesis by knockdown 
experiment; while Nos2 is undetectable in the PGC during the first 2 days post-
fertilization (Koprunner et al.,2001). 3?UTR of nos1 has been constructed into a construct 
fused with green fluorescent protein (GFP) to visualize the PGCs migration because of its 
3? UCR specifically stabilization in the PGCs.  Kawakami et al., (2011) had developed 
3?UTR of common carp nanos gene fused with GFP to visualize PGCs migration 
behavior in goldfish host embryos. They had also demonstrated that common carp (cc) 
cells labeled with GFP-ccnanos-3? UTR mRNA colocalized with cells expressing vasa 
mRNA, thus concluding the identity of the GFP-labeled cells as PGCs. Our result may 
further indicate that nanos gene had the same expression pattern as that of vasa during 
early embryo development (Fig.3).  
Dnd gene was also down-regulated during early embryo development (Fig. 4). Dnd gene 
was down-regulated more dramatically at each time point compared with that of nanos 
and vasa. Even by 6hpf significant (P=0.08) down-regulation or degradation of dnd 
mRNA has begun (-1.36X). This accelerated between 6 hpf and 12 hpf (-71X). It 
appeared to be more important to clear the embryo of dnd mRNA than vasa and nanos as 
at 24, 48 and 72 hpf down-regulation of dnd was -144, -355 and -580X, respectively. Dnd 
was still detectable after this strong down-regulation. 
These observations on embryonic expression and levels of nanos, vasa and dnd mRNA 
might have implications for different knock down strategies to prevent migration of 
 
45 
 
PGCs and their potential success. If the maternal mRNA is of sufficient quantity and 
fully functional, knockdown of embryonic expression of these genes may not impede 
PGC migration. However, if knockdown of the early embryonic expression of nanos, 
vasa or dnd is important for stopping PGC migration or if the knock down constructs 
could accelerate degradation of existing mRNA, an impact on PGC migration or fertility 
could be made. To better understand the pattern of expression observed in this study and 
its implications, expression of nanos, vasa and dnd should be examined from 0-6 hpf.    
4.2 Effect of knock down constructs on PGC marker genes expression 
Overall, M, and Mctr promoters drove the strongest expression of the knock down 
constructs as measured by the degree of up- or down expression followed by RM 
promoter, and then Nanos promoter. Thus these two yeast promoters worked quite well in 
a common carp genomic background. Not surprisingly from a phylogenic standpoint, the 
zebrafish promoters were also effective in common carp embryos. 
Nanos, M, MCTR and Racemase promoter driving Dead end shRNAi were almost 
always ineffective in knocking down the target, dnd, and had the opposite effect, up-
regulation of dnd. There is no obvious reason why these genes would up-regulate dnd. 
Activation of interferon pathway, one of the antiviral responses, could be used to explain 
that most of the gene constructs up-regulated dnd gene in this study (Karpala et al. 2005). 
dsRNAs activate gene expression by targeting noncoding regulatory regions in gene 
promoters, which can increase gene transcription (Li et al., 2006).  Therefore, it could be 
speculated that dnd short-hairpin structure may produce RNA sequences that are 
complementary to parts of dnd promoter, thus increasing dnd gene transcription during 
early embryo PGC knockdown process.  Perhaps, the expression of dead end shRNAi is 
actually slowing degradation rather than elevating expression through some kind of 
blockage, binding or competition with the mechanisms, pathways or enzymes 
metabolizing the dnd mRNA. 
Overexpression of nanos cDNA also appeared to up- regulate dnd. The MCTR driven 
construct had strong up-regulation (25X) on dnd at 12 h, but little or no effect during the 
 
46 
 
rest of development. The RM driven construct had the most consistent up-regulation of 
dnd.  Again, perhaps the increase in nanos mRNA slowed the degradation of the existing 
dnd mRNA rather than upregulating dnd. 
Knock down of nanos and vasa was prevalent with the dnd shRNAi constructs (Fig. 5) 
with the knock down of nanos being stronger. Dnd shRNAi construct driven by 
promoters M, Mctr and RM knocked down nanos upwards to 7-22X at all-time points 
with MCTR appearing to be the most consistent. This unexpected result could be 
explained by these constructs silencing nanos and vasa via off-targeting effects (Karpala 
et al.,2005) . Introduction of foreign dsRNA into an organism could trigger a number of 
antiviral immune responses, which contribute to induction, activation and regulation of 
antiviral mechanism through the interaction between dsRNA associated with viral 
replication and the host. Such an antiviral mechanism induces knockdown of any genes 
from which the processes of RNAi are to be derived in addition to the non-specific gene 
silencing effects (Karpala et al., 2005; Thresher et al., 2009).  
Nanos, mctr and rm promoter worked in concert with nanos cDNA to knockdown the 
PGC markers nanos and vasa. Consistent with the results for the dnd shRNAi constructs, 
MTCR drove the strongest knock down of nanos and vasa. This yeast copper control 
promoter was one of the most consistent and stronger promoters in this study. 
sh5? nanos gene knocked down nanos, vasa at 24, 48 and 72 h. This combination also 
knocked down the off-target dnd at 24 and 72 h, although it up-regulated dnd at 12 and 
48 h. 
Nanos promoter with sh5? nanos gene also knocked down nanos at 24 h, 48 h and 72 h, 
but not as strikingly as M. This nanos construct did not affect vasa mRNA levels, but was 
the only construct that up-regulated dnd gene at all timepoints. The RM promoter 
construct knocked down nanos at 12 h, 24 h and 48 h, but not dramatically. 
Again, sh3? nanos driven by M was the most consistent, knocking down nanos at all 
timepoints, and it also knocked down the off-target vasa at all timepoints. The ADSS 
driven construct was also quite effective for knocking down nanos from 12 hpf to 48 hpf.   
 
47 
 
4.3 Sexual Maturity 
Several constructs exhibited promise for knocking down expression of nanos and vasa or 
overexpressing dnd or altering the degradation dynamics of these mRNAs. Sexual 
development was measured to see if these alterations at the mRNA level affected sexual 
maturation as measured by ovarian development or sperm production.  
At 19 months of age, the majority of the male common carp should be expressing sperm, 
and a fraction of the females should be sexually mature and exhibit ovarian growth 
sufficient to appear gravid. Replication was limited for this aspect of the study as a cold 
front rapidly lowered the temperature when the majority of the fingerlings in this study 
were about 2.5 cm in length resulting in heavy mortality. 
Although replication was low, the data analysis indicated that some of these constructs 
reduced fertility and sexual maturation at 19 months of age.  Putative sterilization was 
more effective in males than females. M-DND, Nanos-N2 and MTR-DND treated males 
had less sexual maturity than control males. Based on the patterns of gene expression in 
the embryos, it is not clear if these are target or off target effects.  In the case of females, 
although there appeared to be trends in reduction of sexual maturity, no differences in 
rate of sexual maturity were observed between control and females treated with knock 
down constructs. If sexes are pooled, ADSS-N2 treated fish also had less sexual maturity 
than controls. 
If knock down constructs are pooled among promoters, reduction in sexual maturity rate 
for electroporated embryos was obvious for males and pooled sex, but not females. All 
four knock down types, N1, N2, nanos cDNA and DND had less sexual maturity than 
control males.  
 
 
 
 
48 
 
5. Conclusions  
The knock down constructs evaluate reduced or in some cases increased mRNA of PGC 
related proteins, but did not eliminate mRNA of primordial germ cell (PGC) proteins 
because they were not 100% effective or because of the presence of residual mRNA.   
This alteration of mRNA levels for nanos, vasa and/or dnd sterilized a large percentage 
of common carp males at 19 months of age, but the effects on female fertility were 
inconclusive. These constructs were electroporated into one-cell embryos, and with the 
known dynamics of DNA introduction into fish embryos (Dunham 2011), the expression 
and biological effects on these embryos could be realized without gene integration. Thus, 
fish need to be evaluated at older ages elucidate the sexual effects on females, F1 
transgenic individuals need to be produced and evaluated to confirm the results from 
genomic expression rather than cytoplasmic expression and lastly, the repressibility of the 
constructs needs to be evaluated to allow production of fertile transgenic brood stock to 
complete a system of repressible transgenic sterilization. 
 
Acknowledgement 
This work was partially funded by USDA-Biotechnology Risk Assessment (grant no: 
2009-33522-05774) and Alabama Agricultural Experiment Station funding.  
 
 
 
 
 
 
 
 
 
49 
 
References 
FAO (2012). The State of World Fisheries and Aquaculture 2012: FAO. Online resource: 
www.fao.org/docrep/016/i2727e/i2727e.pdf 
Alikunhi, K.H., 1966. Synopsis of biological data on common carp Cypriuns carpio 
(Linnasus), 1758 (Asia and the Far East). FAO Fish. Synop. 31(2):39p. 
Armstrong, J.B., Duhon, S.T., and Malacinski, G.M., Raising the Axoltol in Captivity. 
1989. In Developmental Biology of the Axolotl, edited by J.B.  Amstrong and 
G.M. Malacinski. 220-27. New York: Oxford University Press. 
Jhingran, V.G., and Pullin, R.S.V.,1985. A hatchery Manual for the common, Chinese 
and India major carps. ICLARM studies and reviews 11, 191p. Asian 
development bank, Manila, Philippines and International Center for living aquatic 
resources management, Manila, Philippines. 
Bantounas, I., Phylactou, L. A., and Uney, J. B., 2004.RNA Interference and the Use of 
Small Interfering RNA to Study Gene Function in Mammalian Systems. J Mol 
Endocrinol 33, no. 3: 545-57. 
Bender, A., and Pringle, J. R., 1989. Multicopy Suppression of the Cdc24 Budding 
Defect in Yeast by Cdc42 and Three Newly Identified Genes Including the Ras-
Related Gene RSR1. Proc Natl Acad Sci, USA 86, no. 24: 9976-80. 
Dunham, R. A., 2004. Aquaculture and Fisheries Biotechnology: Genetics Approaches. 
Cambridge, USA: CABI Publishing, Pp 22-52. 
Dunham, R. A., 2011.Aquaculture and Fisheries Biotechnology: Genetics Approaches. 
Cambridge, USA: CABI Publishing, Pp 93-127. 
Gibbs, P. D., and Schmale, M. C., 2000. GFP as a Genetic Marker Scorable Throughout 
the Life Cycle of Transgenic Zebra Fish. Mar Biotechnol. 2(2):107-125. 
 
50 
 
Ji, P.F., Liu, G.M., Xu, J., Wang, X.M., Li, J.T., Zhao, Z.X., Zhang, X.F., et al. 
2012.Characterization of Common Carp Transcriptome: Sequencing, De Novo 
Assembly, Annotation and Comparative Genomics. PLoS ONE 7, no. 4: e35152. 
Karpala, A. J., Doran, T. J., and Bean, A., 2005. Immune Responses to dsRNA: 
Implications for Gene Silencing Technologies. Immunol Cell Biol 83, no. 3: 211-
16. 
Kawakami, Y., Saito, T., Fujimoto, T., Goto-Kazeto, R., Takahashi, E., Adachi, S., Arai, 
K., and Yamaha, E., 2012. Technical Note: Viability and Motility of 
Vitrified/Thawed Primordial Germ Cell Isolated from Common Carp (Cyprinus 
Carpio) Somite Embryos. Journal of Animal Science 90, no. 2: 495-500. 
Koprunner, M., Thisse, C., Thisse, B., and Raz, E., 2001. A Zebrafish Nanos-Related 
Gene Is Essential for the Development of Primordial Germ Cells. Genes Dev 15, 
no. 21: 2877-85. 
Li, L. Ch., Okino, S. T., Zhao, H., Pookot, D., Place, R. F., Urakami, Sh., Enokida, H., 
and Dahiya, R., 2006. Small dsRNAs Induce Transcriptional Activation in Human 
Cells. PNAS 103, no. 46: 17337-42. 
Lilyestrom, C. G., Wolters, W. R., Bury, D., Rezk, M., and Dunham, R. A., 1999. 
Growth, Carcass Traits, and Oxygen Tolerance of Diploid and Triploid Catfish 
Hybrids. North American Journal of Aquaculture 61, no. 4: 293-303. 
McManus, M. T., Sharp, P. A., 2002. Gene Silencing in Mammals by Small Interfering 
RNAs. Nat Rev Genet 3, no. 10: 737-47. 
Nam, Y. K., Park. In-Seok, and Kim, D.S., 2004. Triploid Hybridization of Fast-Growing 
Transgenic Mud Loach Misgurnus Mizolepis Male to Cyprinid Loach Misgurnus 
Anguillicaudatus Female: The First Performance Study on Growth and 
Reproduction of Transgenic Polyploid Hybrid Fish. Aquaculture 231, no. 1?4: 
559-72. 
 
51 
 
Pfaffl, M. W., Horgan, G. W., Dempfle, L.. 2002. Relative Expression Software Tool 
(REST) for Group-Wise Comparison and Statistical Analysis of Relative 
Expression Results in Real-Time PCR. Nucleic Acids Res 30, no. 9. 
Powers, D. A., Hereford, L., Cole, T., Chen, T. T., Lin, C. M., Kight, K., Creech, K., and 
Dunham, R., 1992. Electroporation: A Method for Transferring Genes into the 
Gametes of Zebrafish (Brachydanio Rerio), Channel Catfish (Ictalurus 
Punctatus), and Common Carp (Cyprinus Carpio). Mol Mar Biol Biotechnol, 1(4-
5):301-8. 
Prelich, G.,2012. Gene Overexpression: Uses, Mechanisms, and Interpretation. Genetics 
190, no. 3: 841-54. 
Rozen, S., and Skaletsky, H.J., 2000. Primer3 on the Www for General Users and for 
Biologist Programmers. Chap. 20 In Bioinformatics Methods and Protocols: 
Methods in Molecular Biology., edited by S. Misener and S. Krawetz. Methods in 
Molecular Biology, 365-86. Totowa, New Jersey, United States Humana Press. 
Saito, T., Fujimoto, T., Maegawa, S., Inoue, K., Tanaka, M., Arai, K., and Yamaha, E., 
2006. Visualization of Primordial Germ Cells in Vivo Using GFP-Nos1 3'UTR 
mRNA. In Int J Dev Biol. 50(8):691-9. 
Slanchev, K., Stebler, J., Cueva-M?ndez, G., Raz, E., 2005. Development without Germ 
Cells: The Role of the Germ Line in Zebrafish Sex Differentiation. Proc Natl 
Acad Sci, USA 102, no. 1: 4074-79. 
Thresher, Ron., Grewe, P., Patil, J. G., Whyard,S., Templeton, Ch.M., Chaimongol, A., 
Hardy, C., Hinds, L. A., and Dunham, R. A., 2009. Development of Repressible 
Sterility to Prevent the Establishment of Feral Populations of Exotic and 
Genetically Modified Animals. Aquaculture 290, no. 1?2: 104-09. 
Thresher, Ron.,Hinds,L.A., Hardy,C.,  Whyard, S.,  Vignarajan, S., Grewe, P., and Patil, 
J.,2005.  Repressible Sterility of Animals. USA.  
 
52 
 
Wang, Ch.H., and Li, S.F., 2004.  Phylogenetic Relationships of Ornamental (Koi) Carp, 
Oujiang Color Carp and Long-Fin Carp Revealed by Mitochondrial DNA COII 
Gene Sequences and RAPD Analysis. Aquaculture 231, no. 1?4: 83-91. 
Weidinger, G., Stebler,J., Slanchev,K., Dumstrei,K., Wise,C., Lovell-Badge,R.,Thisse,C., 
Thisse, B., and Raz, E.,2003. Dead End, a Novel Vertebrate Germ Plasma 
Component, Is Required for Zebrafish Primordial Germ Cell Migration and 
Survival. Current Biology 13, no. 16: 1429-34. 
Wong, A. C., and Eenennaam, A.L.V., 2008.Transgenic Approaches for the Reproductive 
Containment of Genetically Engineered Fish. Aquaculture 275, no. 1?4 (2008): 1-
12. 
Xu, H.Y., Gui, J.F. and Hong, Y.H., 2005. Differential Expression of Vasa RNA and 
Protein during Spermatogenesis and Oogenesis in the Gibel Carp (Carassius 
Auratus Gibelio), a Bisexually and Gynogenetically Reproducing Vertebrate. 
Developmental Dynamics 233, no. 3: 872-82. 
Yoon, C., Kawakami, K., and Hopkins, N., 1997. Zebrafish Vasa Homologue RNA Is 
Localized to the Cleavage Planes of 2- and 4-Cell-Stage Embryos and Is 
Expressed in the Primordial Germ Cells. Development 124, no. 16: 3157-65.
 
53 
 
III Reversible Transgenic Sterilization in Channel Catfish 
 
Abstract 
Knockdown approaches utilizing overexpression and shRNAi approaches were 
investigated to attempt reversible transgenic sterilization in channel catfish, Ictalurus 
punctatus. Two primordial germ cell marker genes, nanos and dead end were the target 
knockdown genes and an off-target gene, vasa, their expressions were evaluated in 
temporal manner using real-time PCR. Sodium chloride, cadmium chloride, copper 
sulfate and doxycycline were evaluated as repressor compounds. Constructs were 
designed driven by promoters from different species and were electroporated into 
embryos. Some of the constructs had knocked down PGC marker genes expression and 
some of the constructs had repressed the PGC marker genes in the presence of repressor 
chemicals. For some systems and gene constructs, rate of sexual maturity appeared higher 
in three-year-old brood fish treated with repressors as embryos than for corresponding 
controls indicating potential for some of these reversible transgenic sterilization systems 
to be functional. Evaluation of F1 transgenic channel catfish with these constructs will be 
needed to confirm the results observed in this initial generation of fish and experiments. 
Perfection of this system would allow environmentally safe application of transgenic 
catfish, hybrids and domesticated catfish would be applicable to other aquatic organisms. 
Key words: Transgenic sterilization, RNAi, Channel Catfish embryos, PGC gene 
expression
 
54 
 
1. Introduction 
Channel catfish (Ictalurus punctatus), is the primary aquaculture species produced in the 
United States, consecutively ranked from 2006 to 2010 as the sixth most consumed 
seafood in the US (NFI, 2010). American producers are facing difficulty keeping pace 
with competition from Southeast Asia. A $3.4 billion deficit in fish and other seafood 
products was encountered in 2010, accounting for almost a tenth of US total trade deficit 
of $37.3 billion, and almost half of trade deficit in fish products with Southeast Asian 
countries.  
Exploiting fish genetics can greatly contribute to production efficiency and enhancing 
production. Genetic enhancement of farmed fish has advanced to the point that it is now 
impacting aquaculture worldwide, however, potential maximum improvement in overall 
performance is not close to being achieved (Dunham et al. 2001). Transgenic technology 
holds to improve the production and profit to aquacultured fish.  
Channel catfish growth has been improved via growth hormone gene transfer (Dunham et 
al. 1998), bacterial disease resistance improved with cecropin gene transfer (Dunham et 
al. 2002).  Transgenic fish have been developed that have improved growth, color, 
disease resistance, tolerance of heavy metals, survival in cold and body composition, and 
that can produce pharmaceutical proteins ( Dunham and Liu 2006; Dunham 2008).  
Public fears that transgenic fish would pose environmental and ecological risk if escaped 
and unconfined, allowing transgenic genotype to expand the geographic range and 
become an exotic species essentially. The fitness of transgenic fish will determine 
whether or not they impact the environment. Key factors determining fitness of 
transgenic fish include reproductive performance, foraging ability, swimming ability and 
 
55 
 
predator avoidance and these traits have been the same or weaker compared to controls 
(Dunham et al. 1995; Dunham, 2003).Regardless of fitness and potential environmental 
risk, guaranteed containment will likely be necessary for transgenic fish to be 
commercialized. Wong and Van Eenennaam (2008) reviewed that containment methods 
and applications, including physical containment, physicochemical containment and 
genetic containment. 
Genetic containment options include triploidy and transgenic sterilization. Transgenic 
sterilization is a better option to reduce the risk than triploidy because triploidy can 
decrease performance and minimizes, but does not eliminate risk because fertile brood 
stock are necessary (Dunham, 2003; Dunham 2004). Additionally, triploidy is not 
feasible on a commercial scale for channel catfish and many other fishes.  
Transgenic sterilization is currently the most promising option to confine various 
biotechnological forms of fish by achieving reproductive confinement via genetic 
disruption of gondal development, formation of gametes or blockage of embryonic 
development (Thresher et al. 2004; Templeton 2005; Chaimongkol 2009; Thresher et al. 
2009). Repressible transgenic sterilization is essential as reproductive capacity needs 
restoration to both produce fish as well as perpetuate future generations. One such system 
is the sterile feral technology based on a modified tet-off system, in which components of 
the constructs are fused so that a specific promoter is coupled to a repressible element 
that in turn drives expression of a blocker gene, antisense RNA, dsRNA, sense RNA or 
ribozyme to an early key developmental gene (Thresher et al. 2001; Dunham 2004, 2010; 
Thresher et al. 2009). In the absence of a repressor, the construct functions, the blocker 
gene turned on, the target gene disrupted and gonads do not develop or embryos die. If 
the blocker gene does not transcribe, the gonad develops or the embryos live. Sterile feral 
system has been demonstrated with the repression of the knockout function in zebrafish, 
oysters, channel catfish and common carp (Thresher et al. 2009). 
Doxcycline (dox) was administrated into water during incubation of embryo development 
in the tet-off system. Embryonic development is rescued in the presence of dox while the 
embryo experiences abnormal development or dies out without the dox. The beauty of the 
 
56 
 
tet-off system is that it is manageable, inducible, and repressible in a temporal and spatial 
way (Wong and Eenennaam, 2008; Thresher et al. 2009; Gama Sosa et al. 2010).  The 
mechanism of the tet-off system works as follows: the primary part of the system is tet 
repressor, which is constructed by a tet transcriptional activator (tTA) , fusing with tetR 
DNA binding domain with the activation domain of the herpes simplex virus VP16 
transcriptional activation protein. tTA is expressed under the control of a tissue specific 
promoter, such as bone morphogenetic protein 2 (zBMP2) or other embryogenesis or 
gametogenesis promoter in a temporal and spatial way. The second part has transgene 
sequences, including tet response element (TRE), a cytomegalovirus (CMV) minimal 
promoter (PminCMV) with the tetO sequences, followed by a transgene (blocker gene). 
The system is turned on without doxcycline. In this scenario, tTA binds to TRE, 
activating CMV promoter, which in turn results in transcription of the blocker gene. By 
adding the dox, tTA is prevented binding to the TRE, and transcription of the trangene is 
repressed.  
Continuous dox treatment could lead to environmental issues and could be expensive on 
a commercial scale. An additional drawback of the tet-off system is that it includes short 
stretches of bacterial and viral sequences, which regulators and the public fear. 
Alternative repressor systems may be necessary to alleviate these concerns. Repressors 
such as salt and copper sulfate were considered in the current study, because salt and 
copper sulfate are inexpensive and widely used to treat fungus in catfish hatcheries (Su et 
al 2012). Cadmium chloride based systems may have potential as transferrin is strongly 
down-regulated by cadmium chloride in fish (Carginale et al. 2002). If these compounds 
are not found at high levels in the natural environment occupied by the species, the 
promoters are turned off in their presence and high concentrations do not kill the 
developing embryos, these compounds could be used as repressors to restore fertility of 
the transgenic knockout embryos.  
Primordial germ cell gene markers include nanos, vasa, and dead end and others. Their 
unique characteristics such as origins, migration route, and specification, gene expression 
profiles along with results of knockout studies (Yoon et al, 1997; Koprunner et al 2001; 
Weidinger et al, 2003; Slanchev, et al 2005; Saito et al 2006; Richardson and Lehmann, 
 
57 
 
2010) suggest they would be suitable targets for knockout and a source of early 
embryonic promoters.   
The overall goal was to develop repressible systems that can transgenically sterilize 
channel catfish. The objectives of  this study were to determine the normal pattern of 
gene expression of nanos, vasa and dead end in channel catfish embryos, evaluate 
shRNAi constructs and a cDNA construct designed for knockdown of nanos and dead 
end  (theoretically,disrupting  migration of the PGCs and preventing germ cell 
development), examine off target effects, repress the effects of the sterilization constructs 
on expression of nanos and dead end, and determine sexual maturity in 3-year-old 
channel catfish exposed to transgenic sterilization constructs during embryonic 
development.  
2. Materials and Methods 
2.1 Construct and Experimental Design 
A 7 X 4 X 2 factorial design below had been utilized in the study.  
Tet-off vasa                     dead end ds RNA 
Tet-off nanos                   nanos  ds RNA 3?              repressor molecule 
CTR3 
CTR3 (reduced)       X     nanos  ds RNA 5?     X                                                  
ADSS2  
RM                                   nanos cDNA                      no repressor molecule 
Transferrin 
Seven sets of constructs driven by 7 different promoters were designed. These promoters 
included, Zebrafish ADSS2 (ADSS) and racemase (RM) (both salt responsive), yeast 
CTR3 (M) (copper sensitive) and Mctr (reduced, copper less sensitive), Salmon 
transferrin (T) (cadmium sensitive), channel catfish nanos (nanos) and vasa (vasa).  
The 7 promoters were linked to 4 knockout constructs (28 constructs), 3 that target 
channel catfish nanos and one that targets catfish dead end. Two knockouts were double 
stranded short hair-pin structure RNAis, sh-nanos targeting the 5? nanos sequence (N1) 
and sh-nanos targeting the 3? nanos sequence (N2); a full length nanos cDNA (cDNA) 
 
58 
 
and a double stranded short hair-pin structure RNAi targeting dead end (dnd). Three 
knock out systems target nanos and one targets dead end (dnd).  
Table 4 Promoter system, knockout gene, construct name, repressible treatment and control treatment for 
28 transgenic sterilization constructs electroporated into channel catfish, Ictalurus punctatus, embryos. 
Embryos were incubated in the regular Holtfreter solution (with 3.5ppt saline) for all treated and control 
groups except for the ADSS and RM groups for which Holtfreter?s was altered to contain 4ppt salinity and 
0.3ppt salinity for treated and controlled groups, respectively.). These constructs were driven by promoters 
included, Zebrafish ADSS2(ADSS) and racemase (RM) (both salt responsive),  yeast CTR3 (M) (copper 
sensitive) and Mctr (copper less sensitive), Salmon transferrin (T) (cadmium sensitive), channel catfish 
nanos (nanos) and vasa (vasa). The main genes fused in the constructs included, double stranded short hair-
pin structure RNAis, sh-nanos targeting the 5? nanos sequence (N1) and sh-nanos targeting the 3? nanos 
sequence (N2), a full length nanos cDNA (cDNA) and a double stranded short hair-pin structure RNAi 
targeting channel catfish dead end (dnd). 
System(promoter) Knockout Gene  Construct name Treatment  Control  
Adss  shRNAi dnd  adss-dnd 4 ppt salinity in Holtfreter 
solution, 10 
ppm 
doxycycline 
(dox)  
0.3 ppt salinity 
in Holtfreter 
solution, 10ppm 
dox 
  Nanos cDNA adss-cDNA 
  shRNAi 5? adss-N1 
  shRNAi 3? adss-N2 
RM dnd  RM-dnd 
  cDNA RM-cDNA 
  N1 RM-N1 
  N2 RM-N2 
M dnd  M-dnd 3.5 ppt salinity in Holtfreter 
solution, 0.1 
ppm CuSO4, 10 
ppm dox 
3.5 ppt salinity 
in Holtfreter 
solution, 10 ppm 
dox 
  cDNA M-cDNA 
  N1 M-N1 
  N2 M-N2 
MCTR dnd  MCTR-dnd 
  cDNA MCTR-cDNA 
  N1 MCTR-N1 
  N2 MCTR-N2 
T dnd  T-dnd 3.5 ppt salinity in Holtfreter, 
0.1 ppm CdCl2, 
10 ppm dox 
3.5 ppt salinity 
in Holtfreter 
solution, 10 ppm 
dox 
  cDNA T-cDNA 
  N1 T-N1 
  N2 T-N2 
Nanos dnd  nanos-dnd 3.5 ppt salinity in Holtfreter 
solution, 100 
ppm dox  
3.5 ppt salinity 
in Holtfreter 
solution, 10  
ppm formalin 
treatment for 15-
30 min before 
change water  
  cDNA nanos-cDNA 
  N1 nanos-N1 
  N2 nanos-N2 
Vasa dnd  vasa-dnd   
  cDNA vasa-cDNA 
  N1 vasa-N1 
  N2 vasa-N2 
Control No gene Control  10 ppm dox   
 
59 
 
A key to each of the 7 systems are the repressor molecules. Zebrafish ADSS2 and 
racemase are strongly down-regulated by sodium chloride (Hoshijima and Hirose, 2007), 
yeast CTR3 is strongly down-regulated by copper (Labbe et al. 1997) and transferrin is 
strongly down-regulated by cadmium chloride in fish (Carginale et al. 2002). Channel 
catfish nanos and vasa promoters were tethered to tet-off system and their expression 
drove tTA which binds with TRE to express the knock out constructs. Theoretically, this 
system is deactivated by doxycycline.  
Electroporated embryos will be divided into 2 groups for each of the 28 sterilization 
constructs. One group will be untreated and the other group will be incubated in the 
appropriate repressor compound. The following amount of compounds were administered 
into the Holtfreter?s solution: 100 ppm dox based on for the tet-off systems (Thresher et 
al. 2009), 4 ppt  NaCl for the salt systems (Su et al. 2012), 0.1 ppm copper sulfate and 0.1 
ppm cadmium chloride based on toxicity trials we conducted in 2008.    
Waste CdCl2 was collected using appropriate procedures and disposed of by the Auburn 
University Environmental Safety Unit. Even though waste CdCl2 must be disposed of, a 
large number of potential repressed, fertile brood stocks can be produced in a limited 
amount of static water without creating an environmental hazard. 
2.3 Plasmid DNA preparations 
Plasmids were transformed with One Shot? Top10 chemically competent E.coli cell, 
following the procedures recommended by the protocol. About 100 to 200 ?l 
transformation mix was used to plate on the LB agar (10.0 g Tryptone, 5.0 g yeast 
extract, 5.0 g NaCl, 15.0 g agar in 1.0 L solution) plates. A single colony was picked up 
from each plate to conduct a mini-prep plasmid DNA extraction (Qiagen mini-prep). 
Plasmids were linearized with SfiI (20,000 units/ml, BioLabs) following the product?s 
protocol with little modification. For each plasmid digestion, a mixed 50 ul reaction 
solution contains 1 ug of plasmid DNA, NEBuffer 4(10?), BSA (100?) and the volume 
adjusted using water to 50 ?l.   
 
60 
 
DNA agarose gel electrophoresis was used to analyze the plasmid DNA (using uncut 
plasmid, SfiI cut plasmid). Once the size of plasmid was confirmed, a maxi-prep plasmid 
DNA extraction was performed using Qiagen maxi-prep kit. Plasmid DNA was linearized 
following the same enzyme digestion protocol. After plasmid linearization, phenol-
chloroform-ethanol method was used to inactivate SfiI enzyme and purify the DNA. The 
quantity of DNA was measured using a UV-spectrophotometer.  
Each plasmid was prepared separately in two tubes for the purpose of twice 
electroporation. One was diluted in the 2.0 ml (0.9%) saline with the concentration 50 
?g/ml. The other for the second electroporation was prepared in 9.0 ml TE buffer (5 mM 
Tris-HCl, 0.5 M EDTA, pH=8.0) with a concentration 50 ?g/ml.  
2.4 Brood stock preparation  
Sexually mature male and female channel catfish were harvested from Fisheries Genetics 
Unit, Auburn University.  Six AU-20 females were artificially spawned (Kristanto et al. 
2009, Su et al. 2012b).  Sperm was collected from all 3 AR and 3 Th males and diluted 
with 9 ppt saline (1000 Ml VisIV container 0.9% sodium chloride, injection, USP).  
Sperm was refrigerated till use. Water temperature was 25-27 ?C and oxygen 
concentration was around 5-8 ppm. Females were induced with LHRHa at 30 ?g/kg BW 
for the priming dose and 12 h later at 150 ?g/kg for the resolving dose, and eggs 
collected (Kristanto et al. 2009, Su et al. 2012b).  
2.5 Electroporation 
Electroporation was performed with the Baekon 2000 macromolecule transfer system. 
Parameters were 6 kV, 27 pulses, 0.8 sec burst, 4 cycles, 160 ?sec (Powers et al., 1992). 
One-1.5 ml of each sperm (TH and AR) was dropped in the tube containing 2.0 ml DNA 
construct and was gently shaken. Sperm and DNA constructs were mixed at least 5  
minutes before pouring into petri dish (electroporation cuvette). Approximately 8-10 ml 
of water was added to reduce the salt concentration.  
 
61 
 
Noncontact mode of electroporation with the electrode 1 to 2 mm above the buffer was 
applied to electroporate sperm with plasmid. Eggs were fertilized within 1-2 minutes 
after electroporation of the sperm. Sixty minutes after fertilization, 100-200 embryos 
were loaded as a thin layer into the petri dishes, 2-4 ml of DNA solution was added. The 
embryos were allowed to incubate in the plasmid DNA for 10 minutes. Seventy minutes 
post fertilization, the embryos were electroporated using the exact same procedure as for 
the sperm. There were 3 replicates for each embryo transfection.Same amount of sperm 
within 2 ml saline (0.9%) was electroporated using the same setting for the first time. Egg 
embryos were fertilized using electroporated sperm. After 60min, control non-transgenic 
embryos were electroporated with TE buffer for the second electroporation. Embryos 
were then moved into 8.0L tubs with 5.0L Holtfreter?s solution, and incubated statically. 
The tubs were aerated and the embryos gently agitated with compressed air delivered 
through airstones.  Dead embryos were removed every 24 hours. Holtfreter?s solution 
was changed daily.  
2.6 Embryo treatent 
Embryo treatment began within 4-5 hours after completion of fertilization process. 
Treated transgenic Adss and RM groups were incubated in 4 ppt salinity in Holtfreter?s 
solution, and another 3 control transgenic embryo replicates were incubated in 0.3 ppt 
salinity in Holtfreter solution. M and MCTR group were treated with 0.1 ppm copper 
sulfate in 3.5 ppt salinity of Holtferter solution (NaCl 3.5 g, NaHCO3 0.2 g, KCl 0.05 g, 
MgSO4 333 ?l (300 g in 500 ml), CaCl2 333 ?l (150 g in 500 ml), pH: 7~7.5 in 1.0 L 
decholorined water). T group was treated with 0.1 ppm CdCl2 for only 3 days before 
hatch. 10.0 ppm doxycycline was used to treat the following treated and non-treated 
transgenic sterile embryos, which included ADSS, RM, M, MCTR, and T groups. Nanos 
and vasa groups were treated with 100 ppm doxycycline for the treated transgenic 
embryos while non-treated transgenic embryos received 10.0 ppm formalin for 30 min 
daily. Non-transgenic channel catfish was treated with 10 ppm doxycycline.  
2.7 Embryo collection, RNA extraction and Real-time PCR  
 
62 
 
Embryos were collected at three different time points, 24 h, 48 h and 120 h post 
fertilization for treated transgenic, non-treated transgenic and non-transgenic control for 
all the 59 groups, respectively. Approximately, 20 embryos from each sample were 
collected from each tub for each treatment, placed into 1.5 ml sterile micro centrifuge 
tube and submerged into liquid nitrogen for each time point. Samples were kept at -80 ?C 
after collection until RNA extraction.  
Samples were ground into powder in the presence of liquid nitrogen and around 0.3 ml 
powder from each sample was used to extract RNA using TRIzol? Reagent (Ambio, cat 
#: 15596-018). The quality and quantity of RNA was measured using DNA agarose gel 
and UV- spectrophotometer. All extracted samples had an A260/280 ratio greater than 
1.8, and were diluted to 500 ng/ul. 
RNA was reverse transcribed into cDNAs by iScript Synthesis Kit (Bio-Rad, USA, cat #: 
170-8891). qRT-PCR was performed on a C1000 Thermal Cycler (Bio-Rad, USA) by 
using SsoFast EvaGreen supermix kit (Bio-Rad, USA, cat: #172-5201) following the 
manufacturer?s instructions with modification. Ribosome 18s mRNA was used as an 
internal control. Primers used for relative nanos, vasa and dnd expression were listed in 
table 5.  
Table 5.  Primers used for qRT-PCR to test knockdown effect on the PGC marker genes relative expression 
in the transgenic channel catfish (Ictalurus punctatus) embryos. Dnd: short for dead end gene. Nanos, vasa 
and 18s ribosome mRNA from channel catfish could be traced down with the NCBI accession IDs.  
 
2.8 Sexual maturity  
Fry were grown in aquarium until they reached 10cm, marked and stocked in earthen 
ponds in 2009. When channel catfish were 3-year olds, sex and state of sexual maturity 
Gene  GID Forward Sequence Reverse Sequence 
Nanos  CK419278.1 TACGCCCGAGATTTCTCATC ACCTTGAGGTGATGGAGGTG 
Vasa  FD175080.1 CGTTATTGGTCGTGGAAAGG GGCACTGAACATGAGGGTTT 
DND unpublished  AGCTGTGTCTCAGCGATCTG GCACTGACGTCCTTCTCCTT 
18S GQ465834.1 GAGAAACGGCTACCACATCC GATACGCTCATTCCGATTACAG 
 
63 
 
was determined based upon both primary and secondary sexual characteristics (Kelly 
2004).  
2.9 Statistical analysis 
Crossing-point (Ct) values were exported into Microsoft Excel sheet from Bio-Rad CRX 
Manager (Version 1.6.541.1028, 2008). The relative expression ratio of target gene was 
analyzed for significance test using a randomization test in the REST (Pfaffl, et al., 2002) 
software on the assumption that PCR had 100% efficiencies, and randomization was 
performed at 1000 times to capture significance at the level of P<5%. The results were 
graphed with corresponding standard errors. Two different ways of relative expression 
analysis were performed. Transgenic treated and non-treated data were normalized to 
non-transgenic data of the same time point as the first data analysis, respectively. Data 
from transgenic treated were compared to data of transgenic non-treated in a pair-wise 
fashion. 
Fisher's Exact Test was used to test the sexual maturity of 3-year-old potentially 
transgenic channel catfish. Probablity levels evaluated were P=0.05 and P=0.10. 
3. Results  
3.1 Expression of nanos, vasa and dead end in normal channel catfish embryos 
 
64 
 
  
Fig.13. Analysis of relative expression of nanos, vasa and dead end (dnd) gene during embryonic 
development of channel catfish (Ictalurus punctatus) using real-time PCR in electroporated non-transgenic 
eggs. The samples were analyzed at 24 h, 48 h and 120 h post fertilization (hpf). Relative nanos, vasa and 
dnd genes expression at 48 hpf and 120 hpf were expressed as fold change over 24 hpf sample as 
normalized to change in the expression of 18s control. Relative fold changes were expressed as mean ?SE; 
all the fold changes were significant at the level of P< 0.05 except that of nanos at 48hpf (P>0.05) using 
Pairwise Fixed Reallocation Randomization Test.   
 
Initial levels of nanos, vasa and dead end at 24 hpf were very low compared to the 
control gene 18s (Fig.13; table 6).  At 48 and 120 hpf nanos was declining relatively 
slowly, -1 and -3X, respectively. Levels of vasa and dead end were about 4X lower at 48 
hpf than at 24 hpf, and were dramatically lower, -50X and -54X at 120 hpf compared to 
24 hpf (Fig.13; table 6). 
Table 6. Average Ct values (N=3) for PGC marker genes expression across three time points in the 
electroporated non-transgenic Channel Catfish (Ictalurus punctatus) embryos. 
 
Time 18s nanos vasa Dnd 
24 hpf 11.39 28.22 27.49 30.59 
48 hpf 11.13 28.32 29.29 32.41 
120 hpf 10.56 29.17 32.42 35.40 
3.2 Comparison of same construct between transgenic treated vs non-transgenic control 
and transgenic control group vs non-transgenic control  
 
65 
 
3.2.1 ADSS system  
ADSS-DND knock-downed the target, dnd, 3X to 5X at 24 hpf and 48 hpf  in treated and 
control electroporated embryos relative to non-transgenic electroporated controls. The 
treated group also had reduced expression at 120 hpf, but not the control. Adss-DND 
treated and control groups had significant knock-down for nanos and vasa at 48 hpf and 
120 hpf 1.7X to 7.5 X (Fig. 14), but little or no knockdown occurred at 24 hpf.   
Adss-dnd treated and control had the same level of expression of dnd at 24 and 48 hpf, 
and treated continued to be down-regulated at 120 hpf, but not the control (Fig. 14). In 
the case of the off- target, nanos, expression level differences between control and treated 
groups was not significant or minimal. For the off target vasa, the treated group was 
down-regulated compared to the corresponding electroporated control at 24 hpf, but as 
expected, was up- regulated at both 48 hpf and 120 hpf compared to the control. 
 
 
Fig.14. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated adss-dnd transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization, respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR).  X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
 
66 
 
Adss-cDNA treated and control strongly up-regulated nanos gene expression at all three 
time points as expected (Fig. 15). Adss-cDNA treated up-regulated nanos from 167X to 
747X at the three time points, reaching highest value at 48hpf. Adss-cDNA control 
progressively up-regulated nanos expression from 32X to almost 300X. Treated and 
control constructs knocked-down dnd from around 2X to 10X all the time. Treated and 
control had little affect on vasa gene at 24 and 48 h, but -8.3X and -3.0X at 120 hpf, 
respectively.  
When treated with salt, ADSS-cDNA electroporated embryos had higher expression 
levels of nanos than those that were not treated with salt at 24 and 48 hpf (Fig. 15), which 
is opposite of what was expected. For the off-target gene, dnd, treated embryos had lower 
expression than untreated at all time points as expected, and for vasa, had lower 
expression than untreated controls at 2 of 3 time points, namely 48 hpf and 120 hpf.  
 
 
Fig.15. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated adss-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). 
Relative expression of nanos (48 hpf) in adss-cDNA treated: 747.40?10.00. X on the SE bar indicated the 
relative expression between treated and control was significantly different from each other using PFRR.   
 
 
67 
 
Adss-N1 was relatively ineffective at knocking down nanos at 24 and 48 hpf (Fig. 16), 
but had significant knockdown at 120 hpf. Only ADSS-N1 control had almost 2X 
knockdown effect on nanos at 120 hpf. Both of them had around 1.5X knockdown effect 
on vasa at 120 hpf. Treated and control groups showed similar knockdown patterns on 
dnd decreasing expression from 7X to 3.5X for salt treated and 4.5X to 1.6X for the 
control. Differences between the salt treated and control group were minimal and 
inconsistent. 
 
 
Fig.16. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated adss-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Adss-N2 control had a 2X knockdown of nanos and vasa at 24 hpf (Fig. 17). Adss-N2 
control had variable effects on nanos and vasa at all time points, knockdown for nanos 
2.3X (24 hpf), for dnd 4X (24 hpf) and 3X (48 hpf). However, it up-regulated nanos 
(6.5X, 120hpf) and dnd (3X, 120 hpf). Salt treated embryos knocked down nanos and 
dnd all the time, around 2X knockdown effect on nanos while knowdown dnd from 8.4X 
to 1.6X. Salt treatment tended to increase the knock down rather than the expected 
decrease in knock down of the PGC markers. 
 
68 
 
 
 
Fig.17. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated adss-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). X on the 
SE bar indicated the relative expression between treated and control was significantly different from each 
other using PFRR.   
 
3.2.2 RM system 
RM-DND (Fig. 18) treated and control electroporated groups knocked down dnd all the 
time from 3X to 5X except for the treated at120 hpf, and knocked down vasa only at 120 
hpf, 3.3X and 2X, respectively. RM-DND treated knocked down nanos for around 2X 
(24 hpf) and 2.5X (48 hpf), but up-regulated nanos to 164X at 120 hpf. RM-DND control 
continuously down-regulated nanos for 1.1X (24 hpf), 2.7X (48 hpf) and 3.3X (120 hpf).  
The salt treatment did not block the down-regulation of the untreated electroporated 
control except at 120hpf, salt treated RM-dnd up-regulated nanos to 548X and dnd to 
2.3X compared to the untreated electroporated control (Fig.18). 
 
69 
 
 
 
Fig.18. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated RM-DND transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). 
Relative expression of nanos (120 hpf) in RM-DND treated: 164.20?1.00. X on the SE bar indicated the 
relative expression between treated and control was significantly different from each other using PFRR.   
RM-cDNA salt treated and control groups up-regulated nanos from 30X (120 hpf) 
upwards to 510X (48 hpf). For the control group, the effect was continuously increasing, 
from 33X (24 hpf) to 384X (120 hpf).  Both of treatments down-regulated dnd at the time 
from 1.9X to 6X. They had little effect on knockdown vasa for 4.8X and 8.8X at 120 hpf, 
respectively. When treated with salt, RM-cDNA considerably up-regulated nanos 8.49X 
(24 hpf) compared to the untreated electroporated control, and this trend continued at 48 
hpf, which was opposite of expectations. At all other time points for the 3 PGC genes, the 
effects of the salt treatment were minimal and inconsistent (Fig. 19). 
 
70 
 
 
 
Fig.19. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated RM-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). 
Relative expression of nanos (48 hpf) in Rm-cDNA treated: 510.83?10.00. X on the SE bar indicated the 
relative expression between treated and control was significantly different from each other using PFRR.   
 
RM-N1(Fig.20)  treated and control knocked down dnd at the time points from 2X to 6X. 
They had little effect on vasa gene with a knockdown effect 2X for treated at 120 hpf. 
These treatments had the opposite of effect on nanos than expected, both treatments 
down-regulated nanos 2.2X (48 hpf) but up-regulated nanos 4X for treated and 2.5X for 
control (120 hpf). Differences existed between the salt treated and untreated 
electroporated eggs, but they were biologically small (Fig. 20).  
 
71 
 
 
 
Fig.20. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated Rm-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). X on the 
SE bar indicated the relative expression between treated and control was significantly different from each 
other using PFRR.   
 
RM-N2 (Fig. 21) showed much more promise than RM-N1. At 24 hpf and 48 hpf, control 
group down-regulated the target, nanos, around 2.2X, and vasa from 2X to 3X. RM-N2 
treated and control knocked down the off-target, dnd, all the time from 2X to 5.5X. The 
salt treated group up-regulate nanos at 24 and 48 hpf as desired, as well as all time points 
for vasa in comparison between salt treated and control group (Fig. 21). Differences 
between salt treated and control expression were minimal for dnd. 
 
72 
 
 
 
Fig.21. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated Rm-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
 
3.2.3 M system  
M-DND (Fig. 22) control down-regulated dnd 3X to 7X for the 3 time points and only 
2.2X at 48 hpf for nanos. Treated group down-regulated dnd continuously from 6X to 
14X, and for the off-target, nanos, 2X to 6X. Treated and control down-regulated vasa 
only at 120 hpf for 10X (treated) and 5X (control). Copper application did not turn off the 
M promoter, and had the opposite effect as, generally, the treated embryos had greater 
down-regulation than the non-treated controls (Fig. 22). 
 
73 
 
 
 
Fig.22. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated M-DND transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). X on the 
SE bar indicated the relative expression between treated and control was significantly different from each 
other using PFRR.   
 
M-cDNA (Fig. 23) treated and control groups up-regulated nanos expression from 80X to 
700X.  Both groups had off-target effects, and progressively down-regulated dnd from 
3X to 9X for copper treated and from 6X to12X for control. Effects on vasa were small 
and inconsistent. Differences in expression between the copper treated and control 
embryos were either insignificant or biologically small (Fig. 23).  
 
74 
 
 
 
Fig.23. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated m-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Copper treated and control M-N1 knocked down nanos for 2.3X (treated) and 3.5X 
(control) at 48hpf but up-regulated nanos for 20X (treated) and 37X (control) at120 hpf 
(Fig. 24). M-N1 had insignificantly down-regulated vasa all the time from 1.1 to 1.4 
(P>0.05). Treated and control groups were knocked down for dnd from 3.7X to 9.5X for 
the treated and from 4X to 7X for the control at 24 and 48 hpf. They both were up-
regulated for dnd for 3X expression at 120 hpf. Copper had minimal effects on the 
expression of this construct (Fig.24). 
 
75 
 
 
 
Fig.24. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated m-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Copper treated and control M-N2 embryos were knocked down at 24 and 48 hpf for the 
target, nanos (Fig. 25). Both treatments knocked down for dnd, from 3X (24 hpf) to 4.2X 
(48 hpf) for the treated and from 3.5X (24 hpf) to 6.5X (48 hpf) for the control. They 
were both up-regulated for dnd 3X (120 hpf) and vasa, close to 2X (24hpf). The copper 
treatment appeared to have promise in this case, as several times it up-regulated 
(observed mean or signicantly different mean) the expression compared to the non-
treated electroporated control. 
 
76 
 
 
 
Fig.25. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated m-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). X on the 
SE bar indicated the relative expression between treated and control was significantly different from each 
other using PFRR.   
3.2.4 Mctr system 
Electroporated control MCTR-DND (Fig. 26) progressively knocked down the target, 
dnd, from 4X to 15X and the off-target, nanos all the time from 1.8X to 4.3X. Treated 
group increasingly knocked down dnd over time from 1X to 20X all the time. Both 
treatments had little effect on vasa expression (p>0.05).  The constructs responded to the 
copper and up-regulated nanos relative to the control at 24 h and 120 h, and dnd at 24 h 
but not at the other time points. 
 
77 
 
 
 
Fig.26. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated mctr-DND transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR).  X 
on the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Mctr-cDNA worked well (Fig. 27) and up-regulated nanos expression in the treated and 
control at all 3 time points. For the copper treated embryos, the expression was 
decreasingly from 147X to 36X; while in the untreated transgenic group, the expression 
was increasingly from 117X to 366X as expected. They both knocked down off-target, 
dnd, decreasingly from 6.7X (48 hpf) to 3.6X (120 hpf) (treated) and from 10.7X (48 hpf) 
to 3.3X (120 hpf) (control). Both treatments had a sporadic effect on vasa, but down-
regulated 1.3X and 1.6X each (48 hpf, p<0.05). Treated up-regulated vasa for 2X (24 
hpf). Significant differences were observed in the expression of copper treated and un-
treated embryos for the target, nanos, at 48 hpf and 120 hpf.  
 
78 
 
 
 
Fig.27. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated mctr-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR).  
Relative expression of nanos (24hpf) in mctr-cDNA control: 142.25?26.17; relative expression of nanos 
(24 hpf) in mctr-cDNA treated: 147.17? 21.77; relative expression of nanos in mctr-cDNA control   
117.40?15.34 (48 hpf), and 366.16?22.82 (120 hpf). X on the standard error bar indicated the relative 
expression between treated and control was significantly different from each other using PFRR.  
 
Mctr-N1 (Fig. 28) treated and control groups were knocked down for nanos, 3.3X and 
5.8X, respectively, at 120 hpf. Both the treated embryos were progressively knocked 
down for dnd from 2.5X (48 hpf) to 9.3X (120 hpf) for the treated and from 7X (48 hpf) 
to 11X (120 hpf) for the transgenic control. Significance was found in the expression of 
dnd due to treatment at 48 hpf. Both treatments knocked down for vasa 4X and 2.3X at 
48 hpf (P<0.05), respectively.   
 
79 
 
 
 
Fig.28. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated mctr-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). X on the 
SE bar indicated the relative expression between treated and control was significantly different from each 
other using PFRR.   
 
Control Mctr-N2 embryos were knocked down for nanos 1.8X (48 hpf), 8.4X (120 hpf) 
and 1.7X for vasa (48hpf) (Fig. 29). This construct knocked -down dnd decreasingly 
from 7.6X (48 hpf) to 4.6X (120 hpf) for treated and from 8.6X (48 hpf) to 4.7X (120 
hpf) for the control. The copper treated groups were knocked down for nanos (2.3X, 
120hpf) and vasa (2.4X, 48hpf). At 120 hpf, this construct responded to copper as 
expected in regards to nanos expression.  
 
80 
 
 
 
Fig.29. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated mctr-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR).  X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
3.2.5 T system 
Treated and control of T-DND (Fig. 30) knocked down dnd at all time points, roughly 3X 
to 6X. In general, both groups were knocking down the off-targets vasa and nanos. 
Cadmium did not repress this construct (Fig. 30), but significant differences were found 
between the treatments for nanos at 48 hpf and 120 hpf, and for vasa at 48 hpf due to 
Cadmium.  
 
81 
 
 
 
Fig.30. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated T-DND transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Like other cDNA fused constructs, T-cDNA (Fig. 31) up-regulated nanos all the time, but 
dramtically from 18X up to 2900X for the treated, and 275X to 1741X for the control 
treatments. Treated groups were knocked down for vasa expression from 1.5X (24 hpf) to 
5X (120 hpf), and 2.3X (48 hpf) and 1.7X (120 hpf) for the control. Cadmium 
successfully repressed expression of T-cDNA for the target at 24 hpf, but was not very 
effective at other time points and with the off- targerts (Fig. 31). 
 
82 
 
 
 
Fig.31. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated T-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). Relative 
expression of nanos (48 hpf) in T-cDNA treated: 2968.07? 10.001; Relative expression of nanos (48 hpf) 
in T-cDNA control: 1741.45? 10.001. X on the SE bar indicated the relative expression between treated 
and control was significantly different from each other using PFRR.   
Again, N-1 constructs did not function as expected (Fig. 32).Both treatments knocked the 
target, nanos, for 1.8X (treated) and 3.6X (control) at 24 hpf. They knocked down vasa 
for 1.6X (treated) and 2.2X (control) at 48 hpf. Treated embryos were dramatically up-
regulated for nanos expression from 1X (48 hpf) to 250X (120 hpf). T-N1 (Fig. 32) 
down-regulated dnd expression 3X for the treated embryos at both 24 hpf and 48 hpf, but 
the control was down regulated 3.6X to 4.6X for all time points. Cadmium was able to 
repress the construct when the embryos were 120 hpf (Fig. 32). 
 
83 
 
 
 
Fig.32. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated T-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). 
Relative expression of nanos (120 hpf) in T-N1 treated: 255.83? 10.001. X on the SE bar indicated the 
relative expression between treated and control was significantly different from each other using PFRR.   
T-N2 was also relatively ineffective (Fig. 33). Again, cadmium was able to repress the 
construct for the target when the embryos were 120 hpf .  
 
 
84 
 
 
Fig.33. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated T-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
3.2.6 Nanos system  
Nanos-dnd (Fig. 34) knocked down dnd from 4.6X to 3.4X for the treated group and from 
5.5X to 1.8X for the control at 48 hpf and 120 hpf. Off target effects were observed. The 
treated embryos were up-regulated nanos for 1.6X (24 hpf) and 1.8X (120 hpf), while the 
untreated control was up-regulated for nanos 2.4X (24 hpf) and 12X (120 hpf), both of 
them slight down-regulated nanos at48 hpf (p>0.05). Treated embryos were up-regulated 
for vasa 1.7X at24hpf, but downregulated 10X at 48hpf.  The control treatment had a 
similar effect on vasa, up-regulated at 24 hpf 2.5X but down-regulated 5.7X at 48hpf.  
Doxycycline did not repress this construct in the expected manner (Fig. 34). 
 
 
Fig.34. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated nanos-DND transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X 
 
85 
 
on the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Nanos-cDNA (Fig. 35) dramatically up-regulated nanos expression at all time 
points,128X to 1394X, for the treated embryos, and 61X to 580X for the control 
embryos. Both were knocked down from 2X to 5X for dnd at 48 hpf to 120 hpf . Both up-
regulated about 3.5X for vasa at 24 hpf. Treatment with doxycycline enhanced 
expression, which was the opposite of the expected effect. 
 
 
Fig.35. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated nanos-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). 
Relative expression of nanos (120 hpf) in nanos-cDNA treated: 1394.30? 10.001. X on the SE bar 
indicated the relative expression between treated and control was significantly different from each other 
using PFRR.   
Nanos-N1(Fig. 36) was inconsistent in its effects, and had off target effects. Doxycycline 
also had inconsistent effects in regards to repressing this knock down construct. 
 
86 
 
 
 
Fig.36. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated nanos-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X 
on the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Oddly, Nanos-N2 regulated nanos 3X down (48 hpf) but 14X up (120 hpf) for the control 
(Fig. 37). This construct had the off-target effect of down-regulating dnd for 1.5X to 3.2X 
at 24 hpf and 48 hpf. Again, doxycycline was inconsistent and minimal in its repression 
of the construct. 
 
87 
 
 
 
Fig.37. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated nanos-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). 
Relative expression of nanos (120 hpf) in nanos-N2 treated: 14.04? 2.74. X on the SE bar indicated the 
relative expression between treated and control was significantly different from each other using PFRR.   
3.2.7 Vasa system  
Vasa-dnd (Fig. 38)   knocked down dnd progressively from 1.6X to 8.8X for the treated 
embryos and 3.3X to 7X for the control embryos at 24 hpf and 48 hpf. After that, treated 
embryos were decreasingly down-regulated for dnd to 3.3X at 120 hpf, while control 
embryos were up-regulated for dnd to 2.2X at 120 hpf. The construct had no effect on 
vasa expression. Both treatments down-regulated nanos 340X for treated and 75X for 
control at 120 hpf. Doxycycline was ineffective as a repressor of the construct.  
 
88 
 
 
 
Fig.38. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated vasa-DND transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR).  
Relative expression of nanos (120 hpf) in vasa-DND treated: 339.62? 0.101; Relative expression of nanos 
(120 hpf) in vasa-DND control: 74.77? 0.101. X on the SE bar indicated the relative expression between 
treated and control was significantly different from each other using PFRR.   
Vasa-cDNA (Fig. 39) dramatically up-regulated nanos almost all the time (except control 
at 120 hpf), from 14X to 480X in the treated embryos, and from 11X to 122X in the 
control. Both treatments had the off-target effect of progressively knocking down dnd 
expression from 3.3X to 4.5X for the treated and from 3X to 13.3X for the control at 24 
hpf to 48 hpf, but not at 120 hpf. There was no effect on vasa, and doxycycline tended to 
enhance rather than repress expression (Fig. 39). 
 
89 
 
 
 
Fig.39. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated vasa-cDNA transgenic channel catfish (Ictalurus punctatus) embryos. The 
samples were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and 
vasa genes expression were expressed as fold change over non-transgenic control samples of the same time 
point. Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 
0.05 unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test(PFRR). 
Relative expression of nanos (48 hpf) in vasa-cDNA treated: 480.36? 10.001; relative expression of nanos 
(48 hpf) in vasa-cDNA control: 122.41? 10.001. X on the SE bar indicated the relative expression between 
treated and control was significantly different from each other using PFRR.   
Vasa-N1 (Fig. 40) knocked down nanos and dnd all the time in the treated group. For 
nanos, the knock- down ranged from 1.9X to 2.5X, and for dnd from 3.8X to 6.5X. Vasa 
was only knocked down 3.2X at 120hpf.  
Vasa-N1 (Fig. 40) control knocked down nanos only dramatically of 6.3X at 120hpf, and 
that of dnd range from 2.6X to 11X with the greatest value 11X at 48hpf, and had 
knockdown effect on vasa of 3.8X (48 hpf) and 2.3X (120 hpf), with up-regulated effect 
on vasa at 24hpf. Although significant difference in doxycycline treatment effect was 
observed red, it was relatively ineffective as a repressor for this construct. 
 
90 
 
 
Fig.40. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated vasa-N1 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
Treated and control of Vasa-N2 (Fig. 41) increasingly knocked down nanos at all time 
points, ranging from 1.9X to 4.2X. Both treatments knocked down dnd all the time. 
Knock down for treated embryos ranged from 3.3X to 11X, and for control embryos from 
3X to 13X with the greatest value at 48hpf for both. Both treatments knocked down vasa 
3.5X (control) and 4.7X (treated) at 48 hpf. No significant repression of the construct was 
obtained from the exposure to doxycycline. 
 
91 
 
 
Fig.41. Relative primordial germ cell (PGC) marker genes, nanos, dead end (dnd) and vasa expression in 
the treated and non-treated vasa-N2 transgenic channel catfish (Ictalurus punctatus) embryos. The samples 
were analyzed at 24, 48 and 120 h post fertilization (hpf), respectively. Relative nanos, dnd and vasa genes 
expression were expressed as fold change over non-transgenic control samples of the same time point. 
Relative fold changes were expressed as mean ?SE; all the values were significant at the level of p < 0.05 
unless where marked with asterisk using Pairwise Fixed Reallocation Randomization Test (PFRR). X on 
the SE bar indicated the relative expression between treated and control was significantly different from 
each other using PFRR.   
3.3 Comparison of expression of each knockdown by promoters designed for each 
repressor  
3.3.1 DND 
Adss and RM promoters (Fig. 42) were exposed to salt. Neither functioned as designed, 
except RM-dnd at 120 hpf.  
 
92 
 
 
 
Fig.42. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on channel catfish dead end 
(dnd) shRNA structure in knock down PGC marker genes expression in transgenic channel catfish 
(Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 
48 and 120 h post fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, 
using knockdown constructs with shRNAi. Relative PGC genes expressions were expressed as fold change 
of transgenic treated over transgenic non-treated samples taken at the same time point as normalized to 
change in the expression of 18s control. Relative fold changes were expressed as mean ?SE. All the values 
were significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. Relative expression of nanos (120 hpf) in RM-DND: 547.57? 10.001. 
 
In general, M promoter had down-regulated PGC marker genes most of time, while Mctr 
up-regulated PGC marker genes (Fig.43). Copper sulfate increased the knock down 
significantly at all-time points for M-dnd rather than moderating knock down as 
hypothesized.  
 
93 
 
 
 
Fig.43. Effect of different promoter yeast (copper specific transcriptional repression) CTR3 promoter (M) 
and CTR3 promoter but less sensitive (Mctr) on channel catfish dead end (dnd) shRNA structure in knock 
down PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) embryos. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 120 h post fertilization 
(hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using knockdown constructs 
with shRNAi. Relative PGC genes expressions were expressed as fold change of transgenic treated over 
transgenic non-treated samples taken at the same time point as normalized to change in the expression of 
18s control. Relative fold changes were expressed as mean ?SE. All the values were significant at the level 
of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
 
Nanos-dnd and vasa-dnd did not function as designed except at 120 hpf down regulation 
was enhanced by the addition of doxycycline (Fig.44) for both the target dnd and the off-
target nanos. The transferrin-dnd did not strongly respond to the repressor, cadmium 
chloride (Fig.45).  
 
94 
 
 
 
Fig.44. Effect of different promoter channel catfish nanos and channel catfish vasa on channel catfish dead 
end (dnd) shRNA structure in knock down PGC marker genes expression in transgenic channel catfish 
(Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 
48 and 120 h post fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, 
using knockdown constructs with shRNAi. Relative PGC genes expressions were expressed as fold change 
of transgenic treated over transgenic non-treated samples taken at the same time point as normalized to 
change in the expression of 18s control. Relative fold changes were expressed as mean?SE. All the values 
were significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. 
 
 
Fig.45. Effect of promoter salmon transferrin on channel catfish dead end (dnd) shRNA structure in knock 
down PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) embryos. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 120 h post fertilization 
(hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using knockdown constructs 
with shRNAi. Relative PGC genes expressions were expressed as fold change of transgenic treated over 
 
95 
 
transgenic non-treated samples taken at the same time point as normalized to change in the expression of 
18s control. Relative fold changes were expressed as mean ?SE. All the values were significant at the level 
of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
3.3.2 cDNA 
Adss-cDNA and RM-cDNA up-regulated nanos early in development (24 and 48 hpf), 
and expression was enhanced rather than repressed by salt, but RM-cDNA was repressed 
by salt at 120 hpf (Fig.46). In general, The M system was not repressed by copper sulfate; 
however the Mctr system did respond to the copper at 48 and 120 hpf (Fig. 47). 
 
Fig.46. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on  channel catfish nanos 
cDNA overexpression structure in knock down PGC marker genes expression in transgenic channel catfish 
(Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 
48 and 120 h post fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, 
using knockdown constructs with shRNAi. Relative PGC genes expressions were expressed as fold change 
of transgenic treated over transgenic non-treated samples taken at the same time point as normalized to 
change in the expression of 18s control. Relative fold changes were expressed as mean ?SE. All the values 
were significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. 
 
96 
 
 
 
Fig.47. Effect of different promoter yeast (copper specific transcriptional repression) CTR3 promoter (M) 
and CTR3 promoter but less sensitive (Mctr) on channel catfish nanos cDNA overexpression in knock 
down PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) embryos. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 120 h post fertilization 
(hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using knockdown constructs 
with shRNAi. Relative PGC genes expressions were expressed as fold change of transgenic treated over 
transgenic non-treated samples taken at the same time point as normalized to change in the expression of 
18s control. Relative fold changes were expressed as mean ?SE. All the values were significant at the level 
of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
Doxycyline enhanced expression of Nanos-cDNA and Vasa-cDNA systems for nanos 
rather than repressing expression (Fig.48).  
 
97 
 
 
 
Fig.48. Effect of different promoter channel catfish nanos and channel catfish vasa on channel catfish 
nanos cDNA overexpression structure in knock down PGC marker genes expression in transgenic channel 
catfish (Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were 
measured at 24, 48 and 120 h post fertilization (hpf) during embryonic development of channel catfish, 
Ictalurus Punctatus, using knockdown constructs with shRNAi. Relative PGC genes expressions were 
expressed as fold change of transgenic treated over transgenic non-treated samples taken at the same time 
point as normalized to change in the expression of 18s control. Relative fold changes were expressed as 
mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk using 
Pairwise Fixed Reallocation Randomisation Test. 
 
Transferrin-cDNA showed promise for functioning as designed as cadmium chloride 
strongly repressed expression at 24hpf, but had little effect later in development (Fig.49).  
 
98 
 
 
 
Fig.49. Effect of promoter salmon transferrin on channel catfish nanos cDNA overexpression structure in 
knock down PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) embryos. 
Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 120 h post fertilization 
(hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using knockdown constructs 
with shRNAi. Relative PGC genes expressions were expressed as fold change of transgenic treated over 
transgenic non-treated samples taken at the same time point as normalized to change in the expression of 
18s control. Relative fold changes were expressed as mean ?SE. All the values were significant at the level 
of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation Randomisation Test. 
3.3.3 N1 and N2 
Expression of the knock down and its repression was inconsistent for all systems for N1 
(Fig.16, 20, 24,28,32,36 and 40). However, T-N1showed some promise as N1 was 
strongly (118X) repressed at 120 hpf (Fig. 50). RM-N2 systems exhibited promise as salt 
had a small repressing effect on target expression at 24 and 48 hpf (Fig.51). ADSS-N2 
was repressed by salt at 48 hpf and 120 hpf (Fig.51).  
 
99 
 
 
 
Fig.50. Effect of promoter salmon transferrin on channel catfish nanos1 ds-sh RNA (N1) (targeting 5? 
nanos) structure in knock down PGC marker genes expression in transgenic channel catfish (Ictalurus 
punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 
120 h post fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using 
knockdown constructs with shRNAi. Relative PGC genes expressions were expressed as fold change of 
transgenic treated over transgenic non-treated samples taken at the same time point as normalized to change 
in the expression of 18s control. Relative fold changes were expressed as mean ?SE. All the values were 
significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. Relative expression of nanos (120 hpf) in T-N1: 118.45? 10.001. 
 
 
Fig.51. Effect of different promoter zebrafish ADSS2 (adss) and racemase (rm) on channel catfish nanos1 
ds-sh RNA (N2) (targeting 3? nanos) structure in knock down PGC marker genes expression in transgenic 
channel catfish (Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were 
measured at 24, 48 and 120 h post fertilization (hpf) during embryonic development of channel catfish, 
 
100 
 
Ictalurus Punctatus, using knockdown constructs with shRNAi. Relative PGC genes expressions were 
expressed as fold change of transgenic treated over transgenic non-treated samples taken at the same time 
point as normalized to change in the expression of 18s control. Relative fold changes were expressed as 
mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk using 
Pairwise Fixed Reallocation Randomisation Test. 
 
Copper sulfate was inconsistent in repressing M-N2 and Mctr-N2 as it either had no 
effect or at one time point for each construct it repressed knock down as expected 
(Fig.52). Doxycycline did not repress N2 except it strongly repressed nanos-N2 at 120 
hpf (Fig.53). Cadmium chloride did not repress T-N2, and had the opposite effect, but 
strongly repressed down regulation at 120 hpf (Fig.54).    
 
 
 
Fig.52. Effect of different promoter yeast (copper specific transcriptional repression) CTR3 promoter (M) 
and CTR3 promoter but less sensitive (Mctr) on channel catfish nanos1 ds-sh RNA (N2) (targeting 3? 
nanos) in knock down PGC marker genes expression in transgenic channel catfish (Ictalurus punctatus) 
embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 120 h post 
fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using knockdown 
constructs with shRNAi. Relative PGC genes expressions were expressed as fold change of transgenic 
treated over transgenic non-treated samples taken at the same time point as normalized to change in the 
expression of 18s control. Relative fold changes were expressed as mean ?SE. All the values were 
significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. 
 
101 
 
 
Fig.53. Effect of different promoter channel catfish nanos and channel catfish vasa on channel catfish 
nanos1 ds-sh RNA (N2) (targeting 3? nanos) structure in knock down PGC marker genes expression in 
transgenic channel catfish (Ictalurus punctatus) embryos. Expression of PGC genes (nanos, vasa and dead 
end) were measured at 24, 48 and 120 h post fertilization (hpf) during embryonic development of channel 
catfish, Ictalurus Punctatus, using knockdown constructs with shRNAi. Relative PGC genes expressions 
were expressed as fold change of transgenic treated over transgenic non-treated samples taken at the same 
time point as normalized to change in the expression of 18s control. Relative fold changes were expressed 
as mean ?SE. All the values were significant at the level of p < 0.05 unless marked with asterisk using 
Pairwise Fixed Reallocation Randomisation Test. 
 
Fig.54. Effect of promoter salmon transferrin on channel catfish nanos1 ds-sh RNA (N2) (targeting 3? 
nanos) structure in knock down PGC marker genes expression in transgenic channel catfish (Ictalurus 
punctatus) embryos. Expression of PGC genes (nanos, vasa and dead end) were measured at 24, 48 and 
120 h post fertilization (hpf) during embryonic development of channel catfish, Ictalurus Punctatus, using 
knockdown constructs with shRNAi. Relative PGC genes expressions were expressed as fold change of 
transgenic treated over transgenic non-treated samples taken at the same time point as normalized to change 
 
102 
 
in the expression of 18s control. Relative fold changes were expressed as mean ?SE. All the values were 
significant at the level of p < 0.05 unless marked with asterisk using Pairwise Fixed Reallocation 
Randomisation Test. 
3.4 Sexual maturity of 3-year-old channel catfish 
The percentage of gravid males and females at 3 years of age for fish treated with or 
without repressor compounds is found in Table 7. Some trends emerged, such as 80% of 
ADSS-cDNA females treated with salt being gravid, and 56% of the knockout 
electroporated controls being gravid, but this observed difference was not significant 
(P>0.05). Mctr-dnd and Mctr-N2 demonstrated expected trends, but the means of the 
treated and control fish were not different (P>0.05). If Mctr knockouts and sexes are 
pooled, percentage of fish gravid, 58%, was higher (P<0.10) for repressed fish than fish 
that did not receive the repressor compounds, 26%. When treatments and sexes were 
pooled by the knockout type, N1, percentage of fish gravid, 37%, was lower (P<0.05) for 
repressed fish than fish that did not receive the repressor compounds, 66%. When 
treatment and sex were pooled by the knockdown type N2, gravid female from treatment 
showed higher percentage of gravid (P>0.05).  
4. Discussion 
Normal expression 
From 24 to 120 hpf levels of nanos mRNA dropped naturally. Vasa and dead end mRNA 
levels also dropped at a slightly faster rate from 24 to 48 hours, and then were 
dramatically reduced about 50X between 48 and 120 hpf. mRNA of these PGC markers 
is either being down-regulated or mRNA that is either maternally derived mRNA or  
being generated earlier in embryogenesis is being degraded. Since, several of the 
constructs in this study further reduce mRNA levels of nanos, dead end and vasa, some 
transcription of these genes must be occurring throughout embryogenesis, and 
degradation of mRNA for these genes cannot be the only explanation for the decreasing 
levels of mRNA. Maternally derived nanos mRNA in zebrafish degrades rapidly before 
gastrulation (Koprunner, et al., 2001), supporting the conclusion that the decreases in the 
 
103 
 
Table 7. Percentage of gravid, 3-year-old male and female channel catfish, Ictalurus punctatus, 
electroporated with knockout constructs for nanos and dead end and then receiving (t) or not receiving 
repressor compounds. These constructs were driven by promoters included, Zebrafish ADSS2(ADSS) and 
racemase (RM) (both salt responsive),  yeast CTR3 (M) (copper sensitive) and Mctr (copper less sensitive), 
Salmon transferrin (T) (cadmium sensitive), channel catfish nanos (nanos) and vasa (vasa). The main genes 
fused in the constructs included, double stranded short hair-pin structure RNAis, sh-nanos targeting the 5? 
nanos sequence (N1) and sh-nanos targeting the 3? nanos sequence (N2), a full length nanos cDNA 
(cDNA) and a double stranded short hair-pin structure  RNAi targeting channel catfish dead end (dnd). * 
Means significantly different (P=0.05, Fisher?s Exact Test). ** Means significantly different (P=0.10, 
Fisher?s Exact Test).  NG: not gravid individual. G: gravid. 
 
 Construct Male Female Pooled sexes 
  G NG % G NG % G NG % 
ADSS-cDNA (t) 3 1 75 4 1 80 7 2 78 
ADSS-cDNA  5 2 71 5 4 56 10 6 63 
MCTR-dnd (t) 2 0 100 - - - 2 0 100 
MCTR-dnd  3 5 38 0 2 0 3 7 30 
MCTR-N2 (t) 3 3 50 2 2 50 5 5 50 
MCTR-N2 2 4 33 0 3 0 2 7 22 
N2 pooled (t)  10 10 50 5 9 36 15 19 44 
N2 pooled 10 8 56 1 9 10 11 17 39 
N1 pooled  16 8 67 11 6 65 27 14 66 
N1 pooled (t)  3 4 43 4 8 33 7 12 37* 
MCTR pooled (t)  5 3 63 2 2 50 7 5 58 
MCTR pooled 5 9 36 0 5 0 5 14 26** 
nanos, vasa and dead end mRNA levels in channel catfish are due to natural and 
transgenic down regulation and not just degradation. 
The decrease in mRNA for these 3 proteins  in channel catfish embryos was similar to 
that of  common carp embryos (Su, 2012) for nanos and dead end, except that the down 
regulation of vasa was like that of dead end and  accelerated almost identically during the 
last half of embryonic development. Regulation of the PGC markers was not exactly the 
same in common carp and channel catfish and it is possible that the role of vasa is not 
exactly the same in these two species. 
These observations on embryonic expression and levels of nanos, vasa and dnd mRNA 
might have implications for different knock down strategies to prevent migration of 
PGCs and their potential success. Effectiveness of the knockdown may be tempered by 
the naturally decreasing levels of nanos, dead end and vasa. In light of these findings, a 
 
104 
 
more detailed study of the temporal expression of these 3 proteins might be beneficial for 
identifying the transgenic sterilization constructs with the best probability of success. 
Knock down 
Several of the knockdown constructs were able to reduce the expression of dead end. 
Adss-dnd and vasa-dnd were able to down regulate dead end early in embryonic 
development, but oddly, not at 120 hpf. It is not known, when are the most critical time 
points to potentially disrupt the migration and kill the PGCs. RM-dnd, Mctr-dnd, M-dnd 
and T-dnd were able to down regulate dead end at all 3 time points. Nanos-dnd was not 
able to down-regulate dnd at 24 hpf, but functioned as expected during the rest of 
development. Levels of knock down were similar for all constructs with MCTR giving 
slightly more consistent and stronger down regulation.  As expected, the zebrafish, 
salmon, channel catfish and yeast promoters were able to drive transcription in channel 
catfish embryos. 
The Adss promoter was able to overexpress nanos cDNA increasingly over time reaching 
a 300X up regulation by 120 hpf, and a similar results were observed for RM-cDNA, 
vasa cDNA and nanos cDNA in varying fashion at different time points. Mctr up-
regulated nanos at all the times a little more consistant than did M-cDNA , M-cDNA up 
regulated nanos at all 3 time points with a peak of 700X at 48 hpf. The most dramatic up 
regulation of the cDNA constructs was driven by the T promoter, which elevated nanos 
levels 250-1741X. 
N1 was the 5? target for the nanos shRNAi. Adss, RM, nanos, and T N1 constructs were 
relatively ineffective in changing nanos expression. Mctr-N1 had inconstistant effect 
knockdown nanos, only knockdown at 120 hpf whereas m-N1 had little effect early in 
development, but then strongly up-regulated nanos at 120 hpf. Vasa N1 had little effect 
early in development, but then down regulated nanos as expected at 120 hpf. Overall, this 
series of constructs designed to cleave a 5? mRNA target of nanos were ineffective. 
N2 was the 3? target for the nanos shRNAi. RM-N2 had significant but small (-2X) down 
regulation of nanos early in development, but up-regulated nanos at 120hpf, and a similar 
 
105 
 
pattern was observed for the other salt sensitive promoter Adss. Mctr-N2 progressively 
down regulated nanos over time as did M-N2, but more strongly until 120 hfp at which 
time there was no effect on expression. T-N2 did not affect nanos expression. Opposite of 
the expected results, nanos-N2 up-regulated rather than down-regulated nanos. However, 
vasa-N2 down regulated nanos increasingly at all time points. 
Several shRNAi constructs knocked down dead end as expected, and nanos could be 
overexpressed. The approach using a 5? shRNAi target for nanos was not effective, and 
the approach using the 3? shRNAi target appears more promising to decrease expression 
of nanos. 
Repression 
Adss and RM are salt sensitive promoters, which down regulated when exposed to salt in 
zebrafish embryos (Hoshijima and Hirose, 2007). Zebrafish Adss was not very 
responsive when exposed to salt in channel catfish embryos. Opposite of expectations, 
the constructs Adss-cDNA and RM-cDNA strongly up-regulated rather than decreasing 
expression. RM-dnd responded to salt and appeared to be repressed and significantly 
(P=0.05) at 120 hpf. RM-N2 also responded to salt at 24 and 48 hpf, and was repressed at 
these time points. 
The constructs or DNA sequences ligated and downstream of the salt sensitive promoters 
appear to affect their response to salt. Other factors that could affect their sensitivity are 
the insulators and border elements in the constructs. 
Mctr and M are yeast promoters that should be down regulated by copper sulfate (Labbe 
et al. 1997). The Mctr constructs did not repress when exposed to copper sulfate except 
for the N2 and N1 constructs at 120 hpf. Our expectation would be that repression this 
late in development might be too late to restore fertility to the embryos. However, the 
trend for both of these treatments was for the treated fish to have a higher observed rate 
of gravidness at 3 years of age compared to untreated controls, suggesting that repression 
at 120hpf might be adequate to obtaint the desired biological effect. M down regulated 
even more strongly when exposed to copper sulfate instead of being repressed in the case 
 
106 
 
of the dnd shRNAi. Similar to Mctr-N2, one time point for M-N2 was repressed as 
expected. Overall, the Mctr and M constructs were not usually repressed by copper. 
Nanos and vasa drove the tet-off system (Thresher et al. 2009) which is regulated and 
repressed by doxycycline. The vasa and nanos shRNAi constructs did not regularly 
repress as designed. Opposite of expectations and similar to the situation with the salt 
sensitive promoters, the application of the repressor, in this case doxycycline enhanced 
rather than repressed the production of nanos mRNA for both nanos-cDNA and vasa-
cDNA. A similar tet-off approach utilizing early developmental promoters from zebrafish 
that were designed to kill embryos by disrupting body development with cDNA and 
shRNAi knock downs successfully disrupted development and killed channel catfish, 
common carp and zebrafish embryos (Thresher et al. 2009). However, expression 
patterns and mRNA data of these constructs are not available to compare to our results, 
making it more difficult to predict if the biological effects that are desired are possible 
with the unexpected expression patterns. 
T is a cadmium responsive promoter from salmon (Carginale et al. 2002). Similar to the 
other promoter systems, T did not repress when exposed to cadmium chloride, and again 
actually responded to cadmium chloride by enhancing expression of nanos cDNA.  
The results indicate that we can greatly depress the expression of nanos, dead end and 
vasa. This should result in the disruption of migration and the death of PGCs followed by 
sterilization of the fish. It is difficult to predict which constructs would work best as there 
were many off- target knock downs that could result in sterilization from constructs that 
did not function as designed. However, a few constructs such as RM-dnd and RM-N2 
both knocked down and repressed which theoretically, could result in a repressible 
transgenic sterilization system. 
The age of the embryos and thus the changing transcriptome affected the expression of 
the knock downs as the degree of efficacy and direction of regulation changed over time 
for many constructs. These could likely be resolved as a myriad of epistatic effects. In 
 
107 
 
several cases, knockdown occurred at 24 and 48 hpf followed by up-regulation at 120 
hpf. 
The basis of these initial experiments is that foreign DNA initially replicates strongly 
within embryos, expresses in the cytoplasm and degrades later on in development 
(Houdebine and Chourrout, 1991). Copy numbers of plasmid DNA autonomously 
replicates exceeding numbers of embryonic cells number in the embryos development 
(Dunham, et al 1992). Thus, genetic and biological effects of the constructs can be 
observed in P1 embryos even without integration, especially for genes active in 
development. 
Sexual Maturity 
Sterilization was assessed by evaluating the secondary sexual characteristics of the fish. 
If fish treated with repressor compounds have a higher rate of sexual maturity than those 
that are not treated, this would be evidence of the potential for a workable and repressible 
transgenic sterilization system. 
Trends were observed in this regards as percentage of sexually mature and repressor 
treated Adss-cDNA, Mtctr-dnd and Mctr-N2 was numerically, but not statistically higher 
than controls. When Mtcr treatments were pooled the difference between treated and 
control groups was statistically different. The opposite expectation, higher rates of sexual 
maturity for untreated controls was observed for N1 groups pooled. This could be a result 
of the repressing compound, doxcycline, having the unexpected opposite effect of 
enhancing expression making sterilization of the treated fish even more likely than in the 
control. 
5. Conclusions 
Sexual maturity and sterilization of the fish electroporated with these knockout constructs 
for nanos and dead end need to be spawned and the gonads examined to confirm fertility 
or sterilization. F1 transgenic embryos need to be evaluated for two reasons. Any P1 
transgenics generated will be mosaic (Dunham 2011) complicating biological effects and 
 
108 
 
these constructs may behave differently in the nucleus compared to the cytoplasm for 
which the results in the experiment were obtained. Additionally, copy number will be 
much lower in F1 transgenics compared to the transient cytoplasmic transgenics in this 
experiment, which could affect the results. Pleiotropic effects are possible (Muir and 
Howard, 2002; Sundstr?m et al.2007; Guan et al. 2008) and should be evaluated in the 
future. These initial results indicate potential for a repressible transgenic sterilization 
system targeting gametes, but whether or not this system will be 100% effective cannot 
be conclusively demonstrated until the reproductive traits of repressed and untreated F1 
transgenic channel catfish for these knockdowns are evaluated. 
Acknowledgement 
This work was partially funded by USDA-Biotechnology Risk Assessment (grant no: 
2009-33522-05774) and Alabama Agricultural Experiment Station funding. The author 
would like to express thanks to Ron Thresher, Peter Grewe, and Jawahar Patil at CSIRO 
for assistance in constructs design.  
 
 
 
 
 
 
 
 
 
 
109 
 
References 
ASEAN (Association of Southeast Asian Nations), 2011. Available online at:  
http://aseanmattersforamerica.org/the-us-seafood-market-and-southeast-asia/570   
Chaimongkol, A. 2009. Disruption of embryonic development in common carp, cyprinus 
carpio, and channel catfish, ictalurus punctatus, via knock down of bmp2 gene 
for repressible transgenic sterilization. Ph.D Dissertation, Auburn University.    
Dunham, R.A. and Devlin, R.. 1998. Comparison of traditional breeding and transgenesis 
in farmed fish with implications for growth enhancement and fitness. In: 
Transgenic Animals in Agriculture. Edited by J.D. Murray, G.B. Anderson, A.M. 
Oberbauer and M.N. McGloughlin. CAB International,Wallingford,UK. Pp 209-
229. 
Dunham, R. A., Ramboux, A. C., Duncan, P. L., Hayat, M., Chen, T. T., Lin, C. M., 
Kight, K., Gonzalez-Villasenor, I., and Powers, D. A.. 1992. Transfer, expression 
and inheritance of salmonid growth hormone genes in channel catfish, Ictalurus 
punctatus, and effects on performance traits. Mol. Mar. Biol. and Biotech. 1:380-
389. 
Dunham, R. A., Warr, G., Nichols, A., Duncan, P.L., Argue, B., Middleton, D., and Liu, 
Z., 2002. Enhanced bacterial disease resistance of transgenic channel catfish, 
Ictlaurus punctatus, possessing cecropin genes. Marine Biotechnology 4:338-344 
Dunham, R.A., Chen, T.T., Powers, D.A., Nichols,A., Argue, B., and Chitmanat, C.,  
1995. Predator avoidance, spawning, and foraging ability of transgenic channel 
catfish with rainbow trout growth hormone gene. In: Biotechnology Risk 
Assessment: Proceedings of the Biotechnology Risk Assessment Symposium, 
June 6-8, 1995. (eds. M. Levin, C. Grim and J.S. Angle). TechniGraphix, Reston, 
VA. Pp. 127-139.. 
 
110 
 
Dunham, R.A. 2003. Status of genetically modified (transgenic) fish: research and 
application. http://www.fao.org/es/ESN/food/risk_biotech_animal_en.stm; Also 
available online at: ftp://ftp.fao.org/es/esn/food/GMtopic2.pdf 
Dunham, R.A. 2004. Chapter 3: Polyploidy. In: R.A. Dunham (author) Aquaculture and 
Fisheries Biotechnology: Genetic Approaches. CABI Publishing, Wallingford, 
UK, pp, 22-53. 
Dunham, R. A.,  Liu, Z. 2006. Transgenic fish ? where we are and where do we go? . 
Israeli Journal of Aquaculture-Bamigdeh, 58(4), 297-319.  
Dunham, R. A. 2009. Transgenic fish resistant to infectious diseases, their risk and 
prevention of escape into the environment and future candidate genes for disease 
transgene manipulation. Comparative Immunology, Microbiology and Infectious 
Diseases, 32(2), 139-161.   
FAO (Food and Agriculture Organization). 2010. The state of world fisheries and 
aquaculture 2010. Available online at: 
http://www.fao.org/docrep/013/i1820e/i1820e.pdf 
Houdebine, L.M., Chourrout, D. 1991.Transgenesis in fish. Experientia. 47:891-897 
Hoshijima, K., Hirose, S. 2007. Expression of endocrine genes in zebrafish larvae in 
response to environmental salinity. Journal of Endocrinology 193: 481-491.  
Guan, B., Hu, W., Zhang, T., Wang, Y. and Zhu, Z., 2008. Metabolism traits of ?all-fish? 
growth hormone transgenic common carp (Cyprinus carpio L.). Aquaculture 284: 
217-223.  
Kelly, A. M. 2004. Broodfish Management. In C. S. H. Tucker, John A. (Ed.), Biology 
and culture of channel catfish (pp. 130-133): Elsevier B.V. 
 
111 
 
Koprunner, M., Thisse, C., Thisse, B., & Raz, E. 2001. A zebrafish nanos-related gene is 
essential for the development of primordial germ cells. Genes Dev, 15(21), 2877-
2885.  
Labbe, S., Zhu, Z., and Thiele, D.J., 1997. Copper-specific transcriptional repression of 
yeast genes encoding critical components in the copper transcription pathway. J. 
Biol. Chem.272:15951-15958. 
Muir, W. M., Hostetler, W. M. 2002. Transgenic Fish: Production, Testing, and Risk 
Assessment Biotechnology in Animal Husbandry. In R. Renaville & A. Burny 
(Eds.), (Vol. 5, pp. 261-281): Springer Netherlands. 
Muir, W. M.,  Howard, R. D. 2001. Fitness components and ecological risk of transgenic 
release: a model using Japanese medaka (Oryzias latipes). Am Nat, 158(1), 1-16.  
Muir, W. M.,  Howard, R. D. 2002. Assessment of possible ecological risks and hazards 
of transgenic fish with implications for other sexually reproducing organisms. 
Transgenic Research 11:101-114.  
National Fisheries Institute (NFI), 2010. Top 10 Consumed Seafoods. Online resources: 
http://www.aboutseafood.com/about/about-seafood/top-10-consumed-seafoods. 
NOAA (National Oceanic and Atmospheric Administration), 2011. Imports and exports 
of fishery products annual summary 2011. Available online at: 
http://www.st.nmfs.noaa.gov/st1/trade/documents/TRADE2011.pdf. Accessed 4 
August 2012 
Powers, D. A., Hereford, L., Cole, T., Chen, T. T., Lin, C. M., Kight, K., Greech, K., 
Dunham, R. 1992. Electroporation: a method for transferring genes into the 
gametes of zebrafish (Brachydanio rerio), channel catfish (Ictalurus punctatus), 
and common carp (Cyprinus carpio). Mol Mar Biol Biotechnol. 1 (4/5), 301-308.  
Silverstein, J. T. S., Brain C. 2004. Reproductive Physiology. In C. S. H. Tucker, John A. 
(Ed.), Biology and culture of channel catfish (1 ed.): Elserier B.V. 
 
112 
 
Su, B., Perera, D.A., Mu,X., and Dunham, R.A., 2012. Effect of Salinity on Hatching 
Rate on Channel Catfish, Ictalurus punctatus, Embryos. Journal of Applied 
Aquaculture.    
Su, B., Perera, D.A., Zohar, Y., Abraham, E., Stubblefield, J., Fobes, M., Beam,R., 
Argue, B., Ligeon,C., Padi, J., Waters, P., Umali-Maceina,G., Chatakondi, N., 
Kristanto,A., Hutson, A., Templeton,C., Ballenger,J., Chaimongkol, A., Gima, A., 
Gima, M., Zuberi, A.,  Lambert, D.M., Kim, S., Mandour, M., and Dunham, R.A., 
2012. Relative Effectiveness of Carp Pituitary Extract, LHRHa Injections and 
LHRHa Implants for Producing Hybrid Catfish Fry. Aquaculture. 
Sundstr?m, L.F., L?hmus, M., Tymchuk, W.E., and Devlin, R.H. 2007. Gene-
environment interactions influence ecological consequences of transgenic 
animals. PNAS. Vol.104, no. 10, 3889-3894.  
Templeton, C. M. 2005. Disruption of Embryonic Development in Channel Catfish, 
Ictalurus Punctatus, Using "Sterile-Feral" Gene Constructs. Master Thesis, 
Auburn University.    
Thresher, R., Hinds, L., Hardy, C., Whyard, S., Vignarajan, S., Grewe, P. M., & Patil, J. 
(2005). Repressible sterility of animals. United States Patent.   
Thresher, R., Grewe, P. M., Patil, J. G., Whyard, S., Templeton, C. M., Chaimongol, A., 
Dunham, R. A. 2009. Development of repressible sterility to prevent the 
establishment of feral populations of exotic and genetically modified animals. 
Aquaculture, 290(1?2), 104-109.   
Weidinger, G., Stebler, J., Slanchev, K., Dumstrei, K., Wise, C., Lovell-Badge, Thisse, 
C., Thisse, B. Raz, E. 2003. Dead end, a Novel Vertebrate Germ Plasm 
Component, Is Required for Zebrafish Primordial Germ Cell Migration and 
Survival. Current Biology, 13(16), 1429-1434.  
 
113 
 
Wong, A. C., Van Eenennaam, A. L. 2008. Transgenic approaches for the reproductive 
containment of genetically engineered fish. Aquaculture, 275(1?4), 1-12.  
Yoon, C., Kawakami, K.,  Hopkins, N. 1997. Zebrafish vasa homologue RNA is 
localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in 
the primordial germ cells. Development, 124(16), 3157-3165.