Characterization of CRF domain containing ERF genes- Solanum lycopersicum Cytokinin 
Response Factors SlCRF3 and SlCRF5 in tomato development. 
 
by 
 
Sarika Gupta 
 
 
 
 
A dissertation submitted to the Graduate Faculty of 
Auburn University 
in partial fulfillment of the 
requirements for the Degree of 
Doctor of Philosophy 
 
Auburn, Alabama 
August 03, 2013 
 
 
 
 
Keywords: Tomato, Cytokinin, Development 
 
 
Copyright 2013 by Sarika Gupta 
 
 
Approved by 
 
Aaron M Rashotte, Chair, Assistant Professor of Biological Sciences 
Narendra K Singh, Professor of Biological Sciences 
Joanna W Diller, Associate Professor of Biological Sciences 
Leslie R Goertzen, Associate Professor of Biological Sciences 
David B Weaver, Professor, Department of Agronomy and Soils
 
ii 
 
 
 
 
 
 
Abstract 
 
 
        Cytokinin is an important hormone involved in numerous aspects of plant growth and 
development. A newly identified group of transcription factors- Cytokinin Response Factors 
(CRFs) has been included as a side branch to cytokinin signaling pathway. CRFs constitute a 
subset of the AP2/ERF family of transcription factor proteins found in all land plants. Within the 
ethylene response factor (ERF) subfamily, CRFs are defined by the presence of a group-specific 
domain, known as the CRF domain, several of which were originally identified in Arabidopsis 
microarray experiments as induced by cytokinin. Initial studies of CRF mutants have also linked 
these genes to normal leaf/cotyledon development in Arabidopsis. In this study, two transcription 
factor genes SlCRF3 and SlCRF5 (Solanum lycopersicum Cytokinin Response Factors) were 
identified and characterized to determine their involvement in regulating cytokinin responses in 
tomato development. Additionally, the first transcriptome analysis of cytokinin and auxin 
response in tomato roots was conducted and several novel hormone regulated genes were 
identified through Illumina RNA-seq technology.  
        This project was initiated with the following objectives: 1) To characterize 
SlCRF3 and SlCRF5 and their pattern of regulation by cytokinin and abiotic stresses, 2) To 
determine the roles of SlCRF5 in tomato development, 3) To characterize novel genes involved in 
cytokinin and auxin regulation in tomato root. For the first two objectives, previous unknown full 
length DNA sequences for SlCRF3 and SlCRF5 were determined, cloned into different 
expression vectors, then transformed into plants to study where and when these genes are 
expressed as well as the effects these genes produced in tomato development. Expression analysis 
using GUS reporter transgenic lines revealed that these genes are targeted to the vascular tissue, 
more specifically in the phloem of leaf, stem, root, and floral parts. Knockdown studies, using 
 
iii 
 
antisense lines indicated the potential involvement of SlCRF5 in various aspects of tomato 
development, including leaf size and primary root length as well as the number of lateral roots, 
and number of flowers, fruits, and seeds produced. 
        SlCRF3 and SlCRF5 were also examined at the protein level. Bimolecular florescence 
(BiFC) experiments using a split YFP system in protoplasts revealed the ability of these two 
proteins to form both homo and hetero dimers. In addition cellular localization experiments 
indicated that these proteins were nuclear localized in planta.  
        In order to investigate the responses of SlCRF3 and SlCRF5 to hormones and stress, tomato 
plants were treated with cytokinin and other stress hormones and were exposed to abiotic stress 
conditions. These results revealed that SlCRF3 and SlCRF5 are regulated by cytokinin and also 
by some abiotic stresses. 
        For the third objective, Illumina RNA-sequencing was utilized to analyze the transcriptome 
of tomato roots with the main focus on the spatial patterning and regulation of genes by the 
hormones cytokinin and auxin. The analysis revealed that a number of genes involved in 
mechanisms such as defense, stress response, cytokinin signaling, hormonal crosstalk, and 
metabolism were regulated. 
        Together, these findings indicate that SlCRF3 and SlCRF5 are potential regulators of tomato 
developmental processes associated with cytokinin and abiotic stresses and these results set a 
foundation for future research directed towards tomato development.  
 
  
 
 
 
 
 
 
 
 
 
 
iv 
 
 
 
 
 
 
Acknowledgments 
 
 
        I wish to start by expressing my deep respect and gratitude to my mentor, Dr. Aaron 
Rashotte, for his constant encouragement, meticulous guidance, extreme patience, willingness to 
help, and above all, good humor in the midst of negative results that kept me from feeling 
depressed. I thank my advisor wholeheartedly for providing me the opportunity to work in his lab 
with congenial environment. My doctoral studies have been conducted under the auspices of 
many individuals. I find myself indebted to my advisory committee Drs. Narendra Singh, Joanna 
Diller, and Leslie Goertzen for sharing their experiences and giving constant advices at all the 
stages of my work which helped in the successful completion of my work. I would like to 
acknowledge my lab members: Xiuling, Paul, Erika, Margaret, and Dana for their constant 
support and encouragement during the dissertation work. I am grateful to Ms Sandra Riddle, Ms 
Anjali Dhabade, Dr. Mary Mendon?a, and Dr. John Feminella for providing support at the 
department of Biological Sciences to carry out the studies. I am also thankful for the support of 
many friends, especially Ruijuan, Hongtao, Archana, Arun, Michael, and SaiSree who in one way 
or another were part of my life during my dissertation work and also for enriching my life with 
indelible memories. I would also like to thank all my teachers for making me capable of pursuing 
higher studies in the United States. A special thank also goes to my brother for his support. 
        Of course, no acknowledgement would be complete without giving thanks to my parents 
who always had faith in my capabilities and I dedicate my dissertation to them. I have no words 
to express my gratitude for my mother for her unconditional love who stood by me in thick and 
thin. Last but not the least I thank almighty for providing me strength for nothing is possible 
without his compassion and will. 
 
 
v 
 
 
 
 
 
 
Table of Contents 
 
 
Abstract ......................................................................................................................................... ii 
Acknowledgments ....................................................................................................................... iv 
List of Tables ............................................................................................................................... vi 
List of Figures ............................................................................................................................. vii 
Chapter 1 Introduction and Literature Review ............................................................................. 1 
Chapter 2 Transcriptome Profiling of Cytokinin and Auxin Regulation in Tomato root ........... 14 
Chapter 3 Down-stream components of cytokinin signaling and the role of cytokinin  
throughout the plant .................................................................................................. 39 
Chapter 4 Solanum lycopersicum cytokinin response factor (SlCRF) genes: characterization 
of CRF domain-containing ERF genes in tomato   ................................................... 69 
Chapter 5 Expression patterns and regulation of SlCRF3 and SlCRF5 in response to cytokinin  
and abiotic stresses in tomato  .................................................................................. 95 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
vi 
 
 
 
 
 
 
List of Tables 
 
 
Table 1 Hormone regulated genes commonly induced in all root tissues ................................... 36 
Table 2 Experimental validation of a subset of cytokinin/auxin regulated transcripts ............... 37 
Table 3 Primers sequences for genes induced by cytokinin or auxin used for the verification of 
mRNA-seq results by qRT-PCR .................................................................................... 38 
 
Table 4 SlCRF gene description ................................................................................................. 94 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
vii 
 
 
 
 
 
 
List of Figures 
 
 
Figure 1 Differential expression (DE) of genes in tomato root tip (RT), lateral root (LR), and 
whole root (WR) ........................................................................................................... 34 
 
Figure 2 Principal Component Analysis ..................................................................................... 35 
Figure 3 Schematic representation of Response Regulators: type-A, type-B, type-C and  
Pseudo Response Regulator proteins showing their specific domain regions ............. 66 
Figure 4 Interaction between cytokinin and auxin in the root apical meristem .......................... 67 
Figure 5 Interaction between cytokinin and auxin in the shoot apical meristem ........................ 68 
Figure 6 SlCRF protein form, alignment, and phylogenic relationships .................................... 90 
Figure 7 SlCRF expression patterns in various tomato tissues ................................................... 91 
Figure 8 Expression response of SlCRF genes to hormones and salt ......................................... 92 
Figure 9 SlCRF protein localization and protein?protein interactions ....................................... 93 
Figure 10 SlCRF3 and SlCRF5 expression patterns in three different stages of leaf, stem, 
and root. ................................................................................................................... 115 
Figure 11 Promoter-driven GUS reporter gene expression for SlCRF3 and SlCRF5 is seen  
in the vascular tissues of various organs .................................................................... 116 
 
Figure 12 Expression analyses of SlCRF3 and SlCRF5 in response to cytokinin  
(benzyladenine, BA) .................................................................................................. 118 
 
Figure 13 GUS expression is induced in response to BA in proSlCRF5::GUS transgenic  
plants .......................................................................................................................... 119 
 
Figure 14 Expression analyses of SlCRF3 and SlCRF5 in response to abiotic stresses ........... 120 
Figure 15 SlCRF5 knockdown leads to stunted primary roots and absence of lateral roots ..... 121
 
1 
 
 
 
 
 
 
Chapter I. Introduction and Literature Review 
 
Cytokinins 
        Cytokinins are an important class of plant hormones that have been implicated in numerous 
growth and developmental processes such as stem-cell control in roots and shoots, vascular 
differentiation, plastid division and abundance, root, shoot and inflorescence growth, nutrient 
balance, leaf senescence, responses to environmental stress, seed development and fruit yield 
(Mizuno 2004; Ferreira and Kieber, 2005; M?ller and Sheen, 2007; Sakakibara, 2006; Werner et 
al., 2003; Okazaki et al., 2009). Understanding the regulation of gene expression is important in 
realizing different activities in a developmental- and tissue-specific context, and in this 
connection, several findings from early efforts to identify cytokinin regulated genes were 
summarized by Schm?lling et al., 1997. Since then, several studies towards a comprehensive 
understanding of the early and late events of gene regulation by cytokinin (Kiba et al., 2004; 
Brenner et al., 2005; Shi et al., 2013), and those linking specific transcriptional responses to the 
biological activities of cytokinin have been performed (Dello Ioio et al., 2008; M?ller and Sheen, 
2008; Argueso et al., 2010; Zhao et al., 2010; Bishopp et al., 2011; K?llmer et al., 2011). These 
findings reveal a fine-tuned regulation of gene expression to carry out many different biological 
activities of cytokinin in plant development. 
        Natural cytokinins are adenine derivatives comprising an N6- isoprenoid or aromatic side 
chain, which in plants, gets hydroxylated (Takei et al., 2004) to produce zeatins. Two isomers of 
zeatin are trans-zeatin and cis-zeatin of which trans-zeatin is believed to be the most widespread 
in plants. Other natural cytokinins are dihydrozeatin (with a saturated side chain), N6 
benzyladenine (BA), and topolin (an aromatic cytokinin from poplar plants) (Strnad et al., 1997). 
 
2 
 
Artificial cytokinins can also be produced by utilizing simple chemical synthesis and among them 
the most commonly used forms are kinetin, BA and Isopentenyladenine. 
History of Cytokinin discovery  
        Cytokinins were first discovered as a plant hormone in the laboratory of F. Skoog more than 
a half?century ago, as a cell division factor ?kinetin? (Miller et al., 1955). However, the clue that 
this compound could stimulate cell division came well before this in 1913 from Gottlieb 
Haberlandt who found that phloem diffusates from plants were able to initiate cell division in 
wounded potato parenchyma cells (Solanum tuberosum). In fact, the first naturally occurring 
cytokinin named zeatin was isolated from maize (Zea mays) embryos (Letham et al., 1963). 
Because of their ability to promote cytokinesis, they were termed cytokinins (Mok and Mok, 
1994) and also suggested to be designated as ?phytokinins? indicating both their function and 
belonging to the plant kingdom (K?hler and Conrad 1996). Subsequent finding led to the 
identification of many similar compounds which occur naturally in plants. 
Cytokinin cross-talk  
        An important discovery about the hormone cytokinin is its interaction with auxin to 
coordinate various developmental stages of the plants. It was revealed that interaction between 
cytokinin and auxin stimulates cell division in cultured plant cells (Miller et al., 1955, 1956). 
Subsequent finding by Skoog and Miller (1957) showed that it is the ratio of cytokinin to auxin 
that determines the organ regeneration from undifferentiated callus tissue with a high cytokinin to 
auxin ratio favoring shoot formation and a low cytokinin to auxin ratio favoring roots. Later, 
several findings unveiled the involvement of auxin and cytokinin in various processes such as 
apical dominance, cell cycle control, lateral root initiation, regulation of balance between shoot 
and root growth, and vascular tissue development (Coenen and Lomax 1997; Bangerth et al., 
2000; Swarup et al., 2002). More detailed studies uncovered possible relationships between these 
two hormones. It was observed that elevated levels of auxin have negative effects on cytokinin 
abundance in transgenic tobacco (Ekl?f et al., 1997) and auxin is also involved in cytokinin 
 
3 
 
breakdown by stimulation of cytokinin oxidase activity (Palni et al., 1988; Zhang et al., 1995). On 
the contrary, the effect of cytokinin on auxin abundance has been observed to be positive in some 
cases (Bertell and Eliasson 1992; Werner et al., 2001) while it is still negative in others (Ekl?f et 
al., 1997). Moreover, cytokinin and auxin were also observed to mutually regulate the elements of 
the other hormones signaling pathway components from work of various transcriptome analyses 
(Rashotte et al., 2003; Goda et al., 2004). 
        To further understand the mechanism underlying these interactions, global transcriptional 
expression profiles of plants treated with auxin, cytokinin, and both auxin and cytokinin were 
examined (Rashotte et al., 2005) revealing that very few synergistic or antagonistic interactions 
occurred which suggests that interaction between the two hormones occurs downstream of their 
individual signaling pathways. Cytokinin-auxin antagonistic interactions were also shown to be 
fundamental in controlling root development (Dello et al., 2008) with cytokinin promoting cell 
differentiation by repressing auxin signaling and transport, and auxin favoring cell division and 
hence sustaining root meristem activity (Blilou et al., 2005; Dello et al., 2007). 
        Additionally, antagonistic interactions between cytokinin and auxin, where cytokinin has 
negative effect on auxin distribution, have been found responsible for auxin induced 
organogenesis (Pernisova et al., 2009), lateral root formation (Laplaze et al., 2007) and 
determination of leaf positioning (Lee et al., 2009; Shimizu-Sato et al., 2009). Cytokinin-auxin 
interactions were also found by Muller and Sheen (2008) to be crucial in the establishment of the 
first embryonic root stem cell niche during Arabidopsis embryogenesis. In this study the authors 
showed that auxin antagonizes cytokinin output in the basal cell by transcriptional activation of 
two type-A negative regulators of cytokinin signaling, ARR7 and ARR15. These results suggest 
that auxin gains control of cytokinin output by controlling its negative regulators. However, in the 
shoot apical meristem (SAM), auxin represses ARR7 and ARR15 although, in part, through 
AUXIN RESPONSE FACTOR5/MONOPTEROS (MP) transcription factor and hence controls 
SAM development by integrating with cytokinin signaling elements (Zhao et al., 2010). These 
 
4 
 
results are also consistent with the general roles of auxin and cytokinin in the root and shoot 
development suggesting that proper interactions between cytokinin and auxin are required for a 
complex plant developmental program. 
Cytokinin signaling and two-component elements in plants 
        After cytokinins discovery, various researches were focused on how this hormone is 
perceived and its signal is relayed in a cell. Based on several findings, a model of cytokinin 
perception and signal transduction has emerged which is similar to bacterial two-component 
phosphorelays (Kieber, 2001; Hutchison and Kieber, 2002; Sheen, 2002; Heyl and Schm?lling, 
2003; Kakimoto, 2003; Grefen and Harter, 2004; Mizuno, 2004; Ferreira and Kieber, 2005). The 
binding of the ligand cytokinin to a membrane bound receptors leads to their autophosphorylation 
on a conserved His amino acid residue. This phosphate is then passed on to an Asp in the receiver 
domain of the cytokinin receptor. The signaling cascade continues its multi-step phosphorelay by 
phosphorylating His residues on another set of proteins called His-containing phosphotransfer 
(HP) proteins. (Miyata et al., 1998; Hutchison and Kieber, 2007). Upon phosphorylation, the HPs 
move from the cytosol into the nucleus to transmit the signal by further phosphorylation of 
response regulators (RRs). One group of RRs are the type-B RRs, which are transcription factors 
primarily functioning as positive regulators of cytokinin signaling by binding and activating 
downstream cytokinin regulated genes (Hutchison et al., 2006). Another category of RRs are the 
type-A RRs, which have similar protein sequences to the type-B RRs, but lack a DNA binding 
domain to function as transcription factors. As such they compete with type-B RRs for 
phosphorylation by HPs (Brandstatter and Kieber, 1998) and act as negative regulators of the 
cytokinin signaling pathway (To et al., 2004). These two types of RRs regulate a variety of 
growth and developmental processes by mediating the transcriptional response to cytokinin 
(Reviewed in Gupta and Rashotte, 2012). 
Cytokinin Response Factors (CRFs) 
 
5 
 
        The cytokinin response factors (CRFs) are a family of transcription factor proteins that form 
a side branch of the cytokinin signaling pathway and are found in all land plants. These proteins 
were originally identified in microarray experiments of cytokinin response in Arabidopsis as 
APETALA2/Ethylene Response Factor (AP2/ERF) transcription factor family genes that were 
highly induced at multiple time points after exogenous application of cytokinin (Rashotte et al., 
2003). The AP2/ERF proteins comprise one of the largest families of transcription factors in 
plants and are defined by the presence of an AP2 DNA binding domain of ~ 68 amino acids. 
Currently, there are 147 known gene loci in Arabidopsis (Nakano et al., 2006), 200 in poplar 
(Zhuang et al., 2008), 132 in grapevine (Zhuang et al., 2009), 131 in cucumber (Hu and Liu, 
2011), and 163 loci in the rice genome (Sharoni et al., 2011) that code for members of this family. 
These proteins were classified into AP2 (APETALA2), DREB (dehydration-responsive-element-
binding), RAV (related to ABI3/VP), ERF (ethylene-responsive-element-binding-factor), and 
other proteins (Sakuma et al.2002). Nakano et al. (2006) later presented the modified 
classification of AP2/ERF superfamily with all of the members in the DREB subfamily included 
in the ERF family, hence dividing AP2/ERF superfamily into three families, ERF, AP2, RAV, 
and a soloist gene. 
        The DNA binding domain of AP2/ERF proteins has been shown to interact with specific 
DNA sequences depending upon their subfamily membership, e.g. DREB subfamily members 
have been shown to bind DRE/CRT cis-acting elements and ERF subfamily members bind GCC 
box cis-elements (Sakuma et al., 2002; Fujimoto et al., 2000). These interactions result in the 
regulation of a variety of developmental processes in plants. 
        The ERF subfamily comprises the majority of all AP2/ERF proteins in Arabidopsis (83%), 
rice and other sequenced plant genomes (Zhuang et al., 2008; Nakano et al., 2006). Through 
whole-genome analysis of Arabidopsis, Populus and rice, the ERF subfamily has been divided 
into 12 subgroups with CRFs belonging to subgroup VI and VI-L (Sakuma et al., 2002; Zhuang 
et al., 2008; Nakano et al., 2006; Xu et al., 2008). Because of their cytokinin regulation and clade 
 
6 
 
placement in the ERF subfamily, these genes were designated as cytokinin response factors 
(CRFs) (Rashotte et al., 2006). Further examination of CRFs revealed the presence of a group 
specific domain, the CRF domain and a putative mitogen-activated protein kinase (MAPK) 
phosphorylation motif (Rashotte and Goertzen 2010; Zwack et al., 2012). Phylogenetic analysis 
of CRFs proteins further resulted into their placement in five distinct clades (I-V) represented 
across all major angiosperm lineages, with each clade containing a clade-specific C-terminal 
region distinct from other CRFs (Zwack et al., 2012). Within these C-terminal regions, the novel 
conserved motifs -FQDI of clades I and II, the SGY[D/E]S of I, II and III, and the PX[D/E]XF[F] 
present in all except clade IV proteins, are likely related to the specific function or regulation of 
these proteins (Zwack et al., 2012).   
        Interestingly, one of the clade specific features is their upregulation by cytokinin. It was 
found that members of clades I, III, and IV are cytokinin inducible compared to clades II and V 
that show little to no transcriptional induction by cytokinin (Zwack et al., 2012). This clade 
specific response of CRFs to cytokinin was originally found from the analysis of six AtCRF genes 
(1-6) by northern blot experiments in Arabidopsis and additional experiments in tomato described 
later in this dissertation (Rashotte et al., 2006). 
        Examination of CRF cellular localization via GFP protein constructs in Arabidopsis 
protoplast revealed that CRFs are ubiquitously present in the cell, and upon treatment with 
cytokinin, these proteins move to the nucleus, revealing that CRF proteins are regulated by 
cytokinin (Rashotte et al., 2006). Furthermore, by making use of multiple cytokinin signaling 
knockouts of various parts of pathway it was possible to determine that cytokinin regulated CRF 
nuclear localization is dependent on the early steps of the pathway. This included dependence on 
the AHKs and the AHPs, but not the ARRs and indicated a link between CRFs and other 
members of the signaling pathway. 
        Recent examination of CRF proteins interactions demonstrated their ability to form both 
homo- and hetero-dimers with other CRFs (Cutcliffe et al., 2011). In order to further examine if a 
 
7 
 
specific region or domain of the CRF proteins might be involved in protein?protein interactions, 
both natural variation among CRF proteins and partial version of a CRF protein were created. It 
was observed that neither the C-terminal region nor the AP2/ERF DNA binding domain is 
necessary for protein dimerization and that the CRF domain alone is sufficient for CRF?CRF 
protein interactions. This study further revealed that CRFs not only interact with each other but 
also with AHPs again linking CRFs with the cytokinin signaling pathway. However, CRFs 
neither interacted with AHKs, nor with the type-A or type-B RR proteins. This indicates the 
possible importance of CRF-CRF and CRF-AHP interactions in the cytokinin regulated 
developmental processes. 
        Single loss-of-function mutation analysis for CRF genes in Arabidopsis showed almost no 
phenotypic change except for minor defects in cotyledon development, although the severity of 
this phenotype increases with the additional numbers of disrupted genes in double and triple CRF 
mutants (Rashotte et al., 2006). Beyond the notch-like phenotype that appeared in the cotyledons 
of CRF mutants, development of the cotyledons in the triple mutants was more severely affected 
resulting in a reduced size and translucent or white color. Another role for CRF genes is in the 
development of embryo, as observed in the crf5, crf6 double mutant that displayed embryo-lethal 
phenotype, where the embryo arrests at the heart stage of development. Recently, through 
promoter-driven reporter gene expression analysis of transgenic lines in Arabidopsis and tomato, 
it has been shown that CRFs belonging to the clades I-IV are expressed in the vasculature of 
various aerial organs, with the strongest expression in phloem (Zwack et al., 2012). This suggests 
a potential phloem-related role of these genes in possibly mediating cytokinin regulated growth 
and developmental processes such as sink/source regulation, senescence, and responses to abiotic 
and biotic stresses (Mok and Mok, 2001; Werner and Schm?lling, 2009). Some of the 
Arabidopsis CRFs have recently been shown to be involved in normal leaf vasculature patterning, 
plant growth and development and senescence (Zwack et al., 2012; 2013). Since these affected 
 
8 
 
CRF genes are also cytokinin inducible, this suggests a link between cytokinin regulation of 
CRFs and these developmental processes. 
Cytokinin regulation of plant growth and development 
        The role of cytokinin in various organ developmental processes is crucial. Either cytokinin 
or cytokinin interactions with other signaling pathways regulates the growth and development of 
essential plant organs including the root, stem, leaf, and flower. For the details of regulatory 
mechanisms and a more detailed discussion of this topic please refer to chapter 3: Down-stream 
components of cytokinin signaling and the role of cytokinin throughout the plant. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
9 
 
Literature Cited 
Argueso CT, Raines T, Kieber JJ (2010) Cytokinin signaling and transcriptional networks. Curr. 
Opin. Plant Biol. 13:533?539 
Bangerth F, Li Chun-Jan, Gruber J?rg (2000) Mutual interaction of auxin and cytokinins in 
regulating correlative dominance. Plant Growth Reg. 32:205?217 
Bertell G, Eliasson L (1992) Cytokinin effects on root growth and possible interactions with 
ethylene and indole-3-acetic acid. Physiol Plant. 84:255?261 
Bishopp A, Lehesranta S,Vat?n A, Help H, El-Showk S, Scheres B, Helariutta K, M?h?nen A P, 
Sakakibara H, Helariutta Y (2011) Phloem-transported cytokinin regulates polar auxin transport 
and maintains vascular pattern in the root meristem. Curr. Biol. 21:927?932 
Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, 
Scheres B (2005) The PIN auxin efflux facilitator network controls growth and patterning in 
Arabidopsis roots. Nature. 433, 39?44 
Brandstatter I, Kieber JJ (1998) Two genes with similarity to bacterial response regulators are 
rapidly and specifically induced by cytokinin in Arabidopsis. Plant Cell. 10:1009?1020 
Brenner WG, Romanov GA, K?llmer I, Burkle L, Schm?lling T (2005) Immediate early and 
delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression 
profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through 
transcriptional cascades. Plant J. 44:314?333 
Coenen C, Lomax TL (1997) Auxin?cytokinin interactions in higher plants: old problems and 
new tools. Trends Plant Sci. 2:351?356 
Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM (2011) CRFs form protein?protein interactions 
with each other and with members of the cytokinin signalling pathway in Arabidopsis via the 
CRF domain. J Exp Bot. 62:4995?5002 
Dello Ioio R, Linhares FS, Scacchi E, Casamitjana-Martinez E, Heidstra R, Costantino P, 
Sabatini S (2007) Cytokinins determine Arabidopsis root-meristem size by controlling cell 
differentiation. Curr. Biol. 17:678?682 
Dello Ioio R, Nakamura K, Moubayidin L, Perilli S, Taniguchi M, Morita MT, Aoyama T, 
Costantino P, Sabatini S (2008) A genetic framework for the control of cell division and 
differentiation in the root meristem. Science. 322:1380?1384 
Ekl?f S, ?stot C, Blackwell J, Mortiz T, Olsson O, Sandberg G (1997) Auxin?cytokinin 
interactions in wild-type and transgenic tobacco. Plant Cell Physiol. 38:225?235 
Ferreira FJ, Kieber JJ (2005) Cytokinin signaling. Curr. Opin. Plant Biol. 8:518?525 
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-
responsive element binding factors act as transcriptional activators or repressors of GCC box-
mediated gene expression. Plant Cell. 12:393?404 
Goda H, Sawa S, Asami T, Fujioka S, Shimada Y, Yoshida S (2004) Comprehensive comparison 
of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. Plant Physiol. 134:1555?
1573 
 
10 
 
Grefen C, Harter K (2004) Plant two-component systems: principles, functions, complexity and 
cross talk. Planta. 219: 733?742 
Gupta S, Rashotte AM (2012). Down-stream components of cytokinin signaling and the role of 
cytokinin throughout the plant. Plant Cell Rep. 31:801?812 
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways by AP2/ERF 
transcription factors. Curr. Opin. Plant Biol. 7:465?471 
Haberlandt G (1913) Zur physiologie der zellteilung. Sitzungsber Akad Wiss Berlin Phys Math C 
l:318?345 
Heyl A, Schm?lling T (2003) Cytokinin signal perception and transduction. Curr. Opin. Plant 
Biol. 6:480?488 
Heyl A, Schm?lling T (2003) Cytokinin signal perception and transduction. Curr. Opin. Plant 
Biol. 6:480?488 
Hu L and Liu S. 2011. Genome-wide identification and phylogenetic analysis of the ERF gene 
family in cucumbers. Genetics and Molecular Biology. 34:624-33. 
Hutchison CE, Kieber JJ (2002) Cytokinin signaling in Arabidopsis. Plant Cell. (Suppl) 14: S47?
S59 
Hutchison CE, Kieber JJ (2007) Signaling via histidine-containing phosphotransfer proteins in 
Arabidopsis. Plant Signal Behav. 2:287?289 
Hutchison CE, Li J, Argueso C, Gonzalez M, Lee E, Lewis MW, Maxwell BB, Perdue TD, 
Schaller GE, Alonso JM, Ecker JR, Kieber JJ (2006) The Arabidopsis histidine phosphotransfer 
proteins are redundant positive regulators of cytokinin signaling. Plant Cell. 18:3073?3087 
Kakimoto T (2003) Perception and signal transduction of cytokinins. Annu Rev Plant 
Biol. 54:605?627 
Kiba T, Aoki K, Sakakibara H, Mizuno T (2004) Arabidopsis response regulator, ARR22, ectopic 
expression of which results in phenotypes similar to the wol cytokinin- receptor mutant. Plant 
Cell Physiol. 45:1063?1077 
Kieber JJ (2001) Cytokinin. In C Somerville, EM Meyerowitz, eds, The Arabidopsis Book. 
American Society of Plant Biologists, Rockville, MD, doi/10.1199/tab.0063, 
http://www.aspb.org/publications/arabidopsis/ 
Kieber JJ, Schaller GE (2010) The perception of cytokinin: A story 50 years in the making. Plant 
Physiol. 154:487-492 
K?hler KH, Conrad K (1966) Ein quantitativer Phytokinintest, Biol. Rundschau, 5:36?37 
K?llmer I, Werner T, Schm?lling T (2011) Ectopic expression of different cytokinin-regulated 
transcription factor genes of Arabidopsis thaliana alters plant growth and development. J. Plant 
Physiol. 168:1320?1327 
Laplaze L, Benkova E, Casimiro I, Maes L, Vanneste S, Swarup R, Weijers D, Calvo V, Parizot 
B, Herrera-Rodriguez M B, Offringa R, Graham N, Doumas P, Friml J, Bogusz D, Beeckman T, 
 
11 
 
Bennett M (2007). Cytokinins act directly on lateral root founder cells to inhibit root initiation. 
Plant Cell. 19:3889? 3900 
Lee BH, Johnston R, Yang Y, Gallavotti A, Kojima M, Travencolo BAN, Costa LDF, Sakakibara 
H, Jackson D (2009).. Studies of aberrant phyllotaxy1 mutants of maize indicate complex 
interactions between auxin and cytokinin signaling in the shoot apical meristem. Plant Physiol. 
150:205?216 
Letham DS (1963) Zeatin, a factor inducing cell division from Zea mays. Life Sci. 8:569?573 
Miller CO, Skoog F, Okomura FS, von Saltza MH, Strong FM (1956) Isolation, structure and 
synthesis ofkinetin, a substrance promoting cell division. J. Am. Chem. Soc. 78:1345?1350 
Miller CO, Skoog F, Von Saltza MH, Strong F (1955) Kinetin, a cell division factor from 
deoxyribonucleic acid. J. Am. Chem. Soc. 77:1392 
Miyata S, Urao T, Yamaguchi-Shinozaki K, Shinozaki K (1998) Characterization of genes for 
two-component phosphorelay mediators with a single HPt domain in Arabidopsis thaliana. FEBS 
Lett. 437:11?14 
Mizuno T (2004) Plant response regulators implicated in signal transduction and circadian 
rhythm. Curr. Opin. Plant Biol. 7:499 
Mizuno T (2004) Plant response regulators implicated in signal transduction and circadian 
rhythm. Curr Opin Plant Biol. 7: 499?505 
Mok DW, Mok MC (2001) Cytokinin metabolism and action. Annu Rev Plant Physiol Plant Mol 
Biol. 89:89?118 
Mok DWS, Mok MC (1994) Cytokinins: Chemistry, Activity and Function, CRC Press Boca 
Raton. 
M?ller B, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification during 
early embryogenesis. Nature. 453:1094?1097 
M?ller B, Sheen J, Cytokinin signaling pathway. Sci. STKE (Connections Map, as seen October 
2007) 
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene 
family in Arabidopsis and rice. Plant Physiology. 140:411?432 
Okazaki K, Kabeya Y, Suzuki K, Mori T, Ichikawa T, Matsui M, Nakanishi H, Miyagishimaa S 
(2009) The PLASTID DIVISION1 and 2 components of the chloroplast division machinery 
determine the rate of chloroplast division in land plant cell differentiation. Plant Cell. 21:1769?
1780 
Palni LMS, Burch L, Horgan R (1988) The effect of auxin concentration on cytokinin stability 
and metabolism. Planta. 194:439?442 
Pernisova M,  Pernisova? M, Kl?ma P, Hor?k J, V?lkov? M, Malbeck J, Sou?ek P, Reichman P, 
Hoyerov? K, Dubov? J, Friml J, Za??malov? E, Hej?tko J (2009) Cytokinins modulate auxin-
induced organogenesis in plants via regulation of the auxin efflux. Proc. Natl. Acad. Sci. U. S. A. 
106:3609?3614 
 
12 
 
Rashotte AM, Carson SD, To JP, Kieber JJ (2003) Expression profiling of cytokinin action in 
Arabidopsis. Plant Physiol. 132:1998?2011 
Rashotte AM, Chae HS, Maxwell BB, Kieber JJ (2005) The interaction of cytokinin with other 
signals. Physiologia Plantarum. 123:184?194 
Rashotte AM, Goertzen LR (2010) The CRF domain defines cytokinin response factor proteins in 
plants. BMC Plant Biol. 10:74 
Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ (2006) A subset of 
Arabidopsis AP2 transcription factors mediates cytokinin responses in concert with a two-
component pathway. Proc. Natl. Acad. Sci. USA. 103:11081?11085 
Sakakibara H (2006) Cytokinins: activity, biosynthesis, and translocation. Annu. Rev. Plant 
Biol. 57:431 
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-
binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved 
in dehydration and cold-inducible gene expression. Biochemical and Biophysical Research 
Communications. 290:998?1009 
Sharoni A, Nuruzzaman M, Satoh K, Shimizu T, Kondoh H, Sasaya T, Choi IR, Omura T, and 
Kikuchi S. 2011. Gene structures, classification and expression models of the AP2/EREBP 
transcription factor family in rice. Plant and Cell Physiology. 52:344-360 
Sheen J (2002) Phosphorelay and transcription control in cytokinin signal transduction. Science. 
296: 1650?1652 
Shi X, Rashotte AM (2012) Advances in upstream players of cytokinin phosphorelay: receptors 
and histidine phosphotransfer proteins. Plant Cell Reports. 31:789-799 
Shi X, Gupta S, Lindquist IE, Cameron CT, Mudge J, Rashotte AM. (2013) Transcriptome 
analysis of cytokinin response in tomato leaves. Plos ONE. 8:e55090   
Shimizu-Sato S, Tanaka M, Mori H (2009) Auxin?cytokinin interactions in the control of shoot 
branching. Plant Mol Biol. 69:429-435 
Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissues 
cultured in vitro. Symp Soc Exp Biol. 11:118-30 
Strnad M (1997) The Aromatic Cytokinins. Physiol. Plant. 101:674?688  
Swarup R, Parry G, Graham N, Allen T, Bennett M (2002) Auxin cross-talk: integration of 
signaling pathways to control plant development. Plant Mol Biol. 49:411?426 
Takei K, Yamaya T, Sakakibara H (2004) Arabidopsis CYP735A1 and CYP735 A2 Encode 
Cytokinin Hydroxylases That Catalyze the Biosynthesis of trans-Zeatin. J Biol Chem. 279:41 
866?41872 
To JP, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM, Ecker JR, Kieber 
JJ (2004). Type-A Arabidopsis response regulators are partially redundant negative regulators of 
cytokinin signaling. Plant Cell. 16:658?671 
 
13 
 
Werner T, Motyka V, Laucou V, Smets R, Oncytokininelen HV, Schm?lling T (2003) Cytokinin-
deficient transgenic arabidopsis plants show multiple developmental alterations indicating 
opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant 
Cell 15:2532-2550 
Werner T, Motyka V, Strnad M, Schm?lling T (2001) Regulation of plant growth by cytokinin. 
Proc. Natl. Acad. Sci. USA. 98:10487?10492 
Werner T, Schm?lling T (2009) Cytokinin action in plant development. Curr Opin Plant Biol. 
12:527?538 
Xu DQ, Huang J, Guo SQ, Yang X, Bao YM, Tang HJ, Zhang HS (2008) Overexpression of a 
TFIIIA-type zinc finger protein gene ZFP252 enhances drought and salt tolerance in rice (Oryza 
sativa L.). FEBS Lett. 582 1037?1043.  
Zhang R, Zhang X, Wang J, Letham DS, McKinney SA, Higgins TJV (1995) The effect of auxin 
on cytokinin levels and metabolism in transgenic tobacco tissue expressing an ipt gene. Planta. 
196:84?94 
 
Zhao Z, Andersen SU, Ljung K, Dole?al K, Miotk A, Schultheiss S, Lohmann JU (2010) 
Hormonal control of the shoot stem-cell niche. Nature. 465:1089?1092 
Zhuang J, Cai B, Peng RH, Zhu B, Jin XF, Xue Y, Gao F, Fu X-Y, Tian Y-S, Zhao W, Qiao Y-
S , Zhang Z, Xiong A-S, Yao Q-H (2008) Genome-wide analysis of the AP2/ERF gene family in 
Populus trichocarpa. Biochem Biophys Res Commun. 371:468-474 
Zhuang J, Peng R-H, Cheng Z-M (Max), Zhang J, Cai B, Zhang Z, Gao F, Zhu B, Fu X-Y, and 
Jin X-F. 2009. Genome-wide analysis of the putative AP2/ERF family genes in Vitis vinifera. 
Scientia Horticulturae. 123(1):73-81. 
Zwack PJ, Robinson BR, Risley MG, Rashotte AM (2013) Cytokinin Response Factor 6 
Negatively Regulates Leaf Senescence and is Induced in Response to Cytokinin and Numerous 
Abiotic Stresses. Plant Cell Physiol. 54: 971-981 
Zwack PJ, Shi X, Robinson BR, Gupta S, Compton MA, Gerken DM, Goertzen LR, Rashotte 
AM (2012) Vascular Expression and C-Terminal Sequence Divergence of Cytokinin Response 
Factors in Flowering Plants. Plant Cell Physiol. 53:1683?1695 
 
 
 
 
 
 
 
14 
 
 
 
 
 
 
Chapter II. Transcriptome Profiling of Cytokinin and Auxin Regulation in Tomato Root 
 
Abstract 
        Tomato is a model and economically important crop plant with little information available 
about gene expression in roots. Currently, there have only been a few studies that examine 
hormonal responses in tomato roots and none at a genome-wide level. In this study we examine 
the transcriptome atlas of tomato root regions (root tip, lateral roots, and whole roots) and the 
transcriptional regulation of each root region in response to the plant hormones cytokinin and 
auxin using Illumina RNA sequencing. More than 165 million 1x54 base pair reads were mapped 
onto the Solanum lycopersicum reference genome and differential expression (DE) patterns in 
each root region in response to each hormone were assessed. Many novel cytokinin and auxin 
induced and repressed genes were identified as significantly differentially expressed and the 
expression levels of several were confirmed by qPCR. A number of these regulated genes 
represent tomato orthologs of cytokinin or auxin regulated genes identified in other species 
including: CKXs, type-A RRs, Aux/IAAs, and ARFs. Additionally, our data confirms some of the 
hormone regulation studies for recently examined genes in tomato such as: SlIAAs and SlGH3s. 
Moreover, genes expressed abundantly in each root region were identified which provide a spatial 
distribution of many classes of genes, including plant defense, secondary metabolite production, 
and general metabolism across the root. Overall this study presents the first global expression 
patterns of hormone regulated transcripts in tomato roots which will be functionally relevant for 
future studies directed towards tomato root growth and development. 
Introduction 
 
15 
 
        Tomato (Solanum lycopersicum) is one of the main crops grown throughout the world. Many 
studies toward the improvement and increase in yield of this plant have focused on flower 
(Gom?z et al., 1999; Molinero-Rosales et al., 2003) and fruit development (Pattison and Catal?, 
2012; de Freitas et al., 2012). Roots in tomato, on the other hand, which constitute an important 
system to carry out water conduction, mineral uptake, anchorage, synthesis of bio-active 
substances, gravitropic responses, and sensing stress have not been studied in detail. This is 
particularly true for gene expression patterns in tomato roots that will be essential for any future 
studies focused on growing, breeding, or engineering plants with more desirable root traits. 
        The root system is comprised of different regions that are involved in specific functions for 
the overall plant sustenance. Two essential regions are the root tip and lateral roots. The root tip 
encompasses the root apical meristem which provides all the cells and base organization for the 
growing root (Scheres et al., 2002). Moreover, this is a region of active cell division, elongation 
(Dolan et al., 1993), and is also the region where synthesis of important hormones (Feldman, 
1979; Muller et al., 1998) occurs which are transported to different locations in the plant. Lateral 
roots on the other hand extend from the primary root in horizontal manner to provide support and 
increased water and nutrient uptake. 
        Two key hormones that play pivotal roles in root growth and development are cytokinin and 
auxin. Both of these hormones have been implicated to have roles in several processes such as in 
root vascular development, initiation of lateral roots, and root gravitropism (Aloni et al., 2006; 
Vanneste and Friml, 2009). Quite often, cytokinin displays crosstalk with auxin during root 
development, such as in the establishment of root stem-cell niche (M?ller and Sheen, 2008), 
meristem size and root growth, (Dello Ioio et al., 2008; Zhang et al., 2011), and lateral root 
organogenesis (Marhav? et al., 2011), although sometimes in an antagonistic manner. Through 
several studies, the regulatory roles of hormones in plant development have been elucidated. This 
includes several cytokinin induced genes such as, the CRE1/AHK4 cytokinin receptor (Che et al., 
2002), CRFs that are involved in Arabidopsis cotyledon and leaf development (Rashotte et al., 
 
16 
 
2006), and a rice O-glucosyltransferase in rice that catalyzes the inactivation of zeatin-type CKs 
by O-glucosylation (Hirose et al., 2007). Numerous auxin regulated genes have similar important 
roles such as, SAURs that are strongly expressed in epidermal and cortical cells (Vanneste and 
Friml, 2009) and AUF1that is involved in crosstalk between cytokinin and auxin during 
Arabidopsis root growth (Zheng et al., 2011). 
        With the availability of the complete tomato genome (The Tomato Genome Consortium, 
2012), it has become possible to perform genome-wide transcriptome analysis to study gene 
expression patterns across different plant tissues under different conditions without de novo 
assembly. Next-generation high-throughput RNA sequencing technology (RNA-seq) using 
massively parallel sequencing has revolutionized transcriptome analysis and, when compared to 
microarrays, RNA-seq can detect all expressed genes without the generation of an array of 
probes, with reduced background noise and large dynamic range. This is particularly important in 
species such as tomato, where publically available microarrays cover only one third of the 
complete genome. 
        Here, we utilized Illumina RNA sequencing on 15 days old hydroponically grown Micro-
Tom plants to analyze the transcriptome of tomato roots with the main focus on the spatial 
patterning and regulation of genes in the root by the hormones cytokinin and auxin. This study is 
one of only a few tomato genome-wide expression profiles and generates a transcriptome atlas of 
tomato root regions: root tip, lateral roots, and whole roots. Additionally, this transcriptome 
analysis of hormone regulation in tomato root reveals novel genes regulated by each of these 
hormones. This comprehensive analysis of tomato root transcriptome can further be utilized as a 
reference to conduct future research on tomato roots. 
Materials and methods 
Plant materials, growth conditions, and hormone treatment 
        The tomato dwarf cultivar Micro-Tom plants were grown hydroponically in CYG 
germination pouches from Mega International under a 16:8 h light: dark photoperiod at 150?E, 
 
17 
 
with a 26? C day (light), 22 ? C night (dark) temperatures. Seedlings at 14 DAS (days after 
sowing) were treated with exogenous 5?M cytokinin (N6 -benzyladenine; BA) or 5?M auxin 
(Naphthalene acetic acid; NAA) dissolved in Dimethyl sulfoxide (DMSO), for 24 h by directly 
adding the hormones or control DMSO to the growth pouches, such that 15d old plant tissues 
were collected. 
RNA extraction, Library preparation, and Illumina GAIIX sequencing 
        Root tips (RT, encompassing the meristem and the elongation zone), Lateral roots (LR), and 
whole roots (WR, including RT and LR) were collected from 15-day-old Micro-Tom plants from 
seedlings with or without treatment with cytokinin, auxin, and DMSO and immediately flash-
frozen in liquid nitrogen and ground to obtain fine powder. Total RNA was extracted from the 
tissue using a Qiagen RNeasy Kit as per manufacturer?s instructions and used for messenger 
RNA isolation with polyA selection and subsequent library construction with the TruSeq RNA 
sample preparation protocol from Illumina (San Diego, CA). Two biological replicates were 
sequenced and analyzed for each of the 9 tissue-treatment combinations. Single-end sequencing 
was performed on the 18 samples by the Illumina GAIIX platform, generating 165,894,496 
1x54bp reads, totaling 8.99 Gbps. Raw sequence data is available for download at NCBI 
Sequence Read Archive under the number SRA058709. 
Differential expression analysis with Solanum lycopersicum (ITAG2.3) reference  
        Reads for each of the 18 samples were aligned to the Solanum lycopersicum genome 
reference with GSNAP (Wu and Nacu, 2010). The high throughput sequencing data was managed 
using the AlpheusTM pipeline and database resource (Miller 2008). Gene expression was 
quantified as the total number of reads for each sample that uniquely aligned to the reference, 
binned by gene coordinate. On average, each sample had 7.6 million uniquely aligning reads. 
Differential expression analysis was performed with the negative binomial test of DESeq 
(Anders 2010) on three partitions of the dataset: 3 tissues DMSO-only treatment, 3 tissues DMSO 
vs cytokinin treatments, and 3 tissues DMSO vs auxin treatments. To perform robust analyses, 
 
18 
 
each set was normalized, filtered, and tested within DESeq separately with recommended 
settings. The first experiment interrogated tissue specific signals with the DMSO treated samples 
from root tip, lateral root, and whole root (n=6). The second experiment investigated the effect of 
cytokinin treatment in each root tissue in reference to the corresponding DMSO control (n=12). 
The final experiment looked at the effect of auxin treatment in each root tissue in reference to the 
corresponding DMSO control (n=12). A multiple testing correction (the Benjamini-Hochberg 
False Discovery Rate method; (Benjamini 1995)) was applied and genes with an adjusted p-value, 
padj ? 0.05 were considered to be significantly differentially expressed. For multiple tissue DE 
we show comparisons with a log2 Fold Change (Log2FC) that were significant (p-adj ? 0.05) in 
one or more of the root regions, indicating padj in all regions. 
Verification of mRNA-seq results by qPCR 
        A 500ng aliquot of the total RNA for each tissue type (see above) was used for reverse 
transcription using Quanta qScript cDNA supermix and the cDNA was diluted 20 times before it 
was used for quantitative real-time PCR analysis. Each qPCR reaction consisted of 2?l of a 20-
fold cDNA, 9?l of SYBR-Green supermix, 1?l of 6?M forward and reverse primers, and 7?l of 
sterile water. qPCR was performed in a Eppendorf Mastercycler ep realplex with the following 
parameters: initial one cycle of 2 min at 95? C, followed by 40 cycles of 15s at 95? C, 45s at 57? 
C, and 35s at 68?C. The last step for each reaction was melting curve generation to test the 
amplicon specificity. All qPCR reactions were performed in two technical and two biological 
replicates. All samples were compared with the control gene TIP41 (Exp?sito-Rodr?guez et al., 
2008). The primer sequences for the genes which were verified through qPCR are presented in 
Table 3. 
Results and Discussion 
Tomato Root Transcriptome Analysis 
        To obtain a global view of genes expressed across the tomato root, single-end Illumina 
GAIIX RNA sequencing was performed on samples derived from root-tip (RT, encompassing the 
 
19 
 
meristem and elongation zone), lateral root (LR), and whole root tissue (WR, including RT and 
LRs) after 24 hours of treatment with cytokinin (5?M BA) or auxin (5?M NAA) vs the vehicle 
control DMSO. This generated a total of 165,894,496 1x54bp reads from all root tissue samples 
that were aligned to the Solanum lycopersicum reference genome. On average, samples generated 
7.6 million uniquely aligning reads from which gene expression was quantified as the total 
number of reads for each sample that uniquely aligned to the reference, binned by gene. 
        Based on reads and filtering (see methods for details) ~17300 genes were robust enough to 
be used for differential expression (DE) analysis on three subsets of the data: tissue level 
expression patterns by utilizing untreated (DMSO) RT, LR, and WR samples; and the hormone 
expression in these tissues of cytokinin as well as auxin in reference to DMSO. Since a large 
number of genes were found to be significantly regulated (padj ? 0.05) we focused our DE 
analysis on genes with a high Log2FC >2.0, that we designated as hormone or tissue regulated 
(Table 1). We have concentrated our discussion of these results on genes regulated commonly 
across the different tissues examined, as they represent some of the most highly regulated 
hormone responsive genes with important known gene function in each root region. Furthermore 
we performed qPCR in order to confirm the results of RNA sequencing on 12 DE regulated genes 
affected by cytokinin and auxin treatments. This comparison yielded very similar expression 
directionality and level of regulation for all genes examined across all root tissues, indicating that 
Log2FC values obtained from RNA sequencing are accurate (Table 2). 
        Principal component analysis (PCA) and variance decomposition (both as implemented in 
SAS JMP Genomics 5.1) of the overall, full transcriptome dataset (n=18), shows distinct 
differences between the auxin and cytokinin hormone response treatments, responsible for 68.6% 
of the variance (Fig. 2). With regards to tissue differences, 19.5% of the variance, there was 
greater similarity between LR and WR samples, while the RT has a more distinct profile. 
Cytokinin induced genes 
 
20 
 
        Genes were determined to be cytokinin regulated if they were DE above 2.0 Log2FC in at 
least one root region sampled. We identified 89 genes that were cytokinin regulated in all root 
tissues, while 87, 24, 34 were specifically regulated in RT, LR, and WR tissues respectively. 
Additionally, there were 24 genes commonly regulated in RT and LR tissues, 23 between LR and 
WR tissues, and 81 between RT and WR tissues (Fig.1). 
        DE cytokinin induced genes found in this study appear to be mainly involved in metabolism, 
development, defense, transport, and tissue specific related processes. One of the commonly 
found highly cytokinin regulated genes are the cytokinin oxidase/dehydrogenases (CKX) (Brenner 
et al., 2012). Three CKX genes (SlCKX2; SlCKX4; SlCKX6) were found to be induced in all root 
tissues (Table 1), while SlCKX1 was induced specifically between RT and LR and SlCKX5 
between RT and WR. CKX genes across plant genera are involved in the breakdown and 
catabolism of cytokinin (Fr?bort et al., 2011), so it is not surprising to see several CKXs induced 
with the application of exogenous cytokinin. CKXs have also been linked to a number of 
cytokinin-related growth and developmental process and recently, it was shown that over-
expression of CKX genes enhanced root growth, drought tolerance, and leaf mineral enrichment 
in Arabidopsis and Tobacco (Werner et al., 2010). Since we have shown in this study that CKXs 
can be highly induced in roots it would be interesting to see if similar growth and developmental 
effects could be seen from CKX overexpression in tomato.  
        Seven type-A Response Regulator (RR) genes were found induced in this study, which we 
have named as SlRRAs: three were induced in all root tissues, SlRRA2, SlRRA6, SlRRA7 (Table 
1), SlRRA4 specifically in LR, and SlRRA1, SlRRA3, SlRRA5 induced between LR and WR. 
Type-A RRs are commonly found to be highly induced by cytokinin treatment as they are 
negative regulators of cytokinin signaling (Brenner et al., 2012). It can be proposed that induction 
of these genes probably occurred to dampen the increased exogenous cytokinin levels added to 
the roots. Since cytokinin is a negative regulator of root growth, it would be interesting to know 
 
21 
 
how the levels of cytokinin are maintained to appropriate amounts by the genes involved in 
cytokinin catabolism and the cytokinin signaling pathway components. 
        Defense genes, including those that produce volatile compounds in response to pathogens or 
predators were among those induced by cytokinin, including the sesquiterpene synthase gene 
TPS14 and (E)-beta-ocimene synthase (Solyc01g105960) (Table 1; Par? and Tumlinson, 1999). 
Sesquiterpenes such as alpha-humulene are widely distributed in plants and have been shown to 
function as insect/pathogen repellent in direct defense (Suga et al., 1993). In support of our 
results, TPS14 has been shown to be highly expressed in tomato roots (Bleeker et al., 2011). (E)-
beta-ocimene synthase produces a monoterpene released upon herbivory, mechanical wounding, 
or jasmonic acid treatment (Faldt et al., 2003). Cytokinin induction of these defense genes 
supports previous studies of cytokinin eliciting defense response and defense response linked to 
the cytokinin signaling pathway (Naseem et al., 2012; Choi et al., 2010), although the underlying 
molecular mechanism behind this connection in tomato roots is obscure and needs further 
investigation. 
        Genes associated with abiotic environmental stresses were differentially induced, such as 
Deoxyhypusine synthase SlDHS and six Laccase genes: Solyc06g076760 among RT, LR, and 
WR, Solyc05g052360, Solyc05g052370, and Solyc06g082240 in RT, Solyc05g052400 in LR, 
and Solyc03g083900 in WR (Table 1). DHS is an enzyme that catalyzes enzymatic reactions 
leading to the activation of a eukaryotic translation initiation factor-5A (eIF-5A) (Park et al., 
1993, 1997). In a study it was shown that transcript levels of SlDHS increased due to osmotic 
stress and chilling injury in tomato leaves (Wang et al., 2001) and the induction of SlDHS by 
cytokinin as reflected in our data suggests that the hormone possibly has a role in abiotic stress 
response mediated by DHS.  
        Laccases are multi-copper containing glycoproteins that have been proposed to be involved 
in lignin synthesis in plants (O?Malley et al., 1993). In maize roots, ZmLAC1, was shown to be 
induced by NaCl (Liang et al., 2006). A similar increased transcript level was observed for a 
 
22 
 
tomato laccase gene by salt that were even more abundantly produced when treated with both salt 
and ABA likely suggesting an involvement in stress response (Wei et al., 2000). Interestingly, in 
maize, it has been proposed that apoplastic laccases may have a role in cytokinin breakdown 
(Galuszka et al., 2005). How this group of genes mediates cytokinin response in responding to 
stress conditions remains unclear. 
        Several genes involved in different hormone biosynthesis, degradation, and signaling 
pathways were also induced. This includes the ethylene biosynthesis enzymes 1-
aminocyclopropane-1-carboxylate (ACC) synthase (Solyc12g008740) and ACC oxidase 1 
(Solyc06g073580) (Lin et al., 2009), an Auxin-regulated protein (Solyc04g010330), and two 
Gibberellic acid  (GA) related genes in involved in GA degradation, Gibberellin 2-beta-
dioxygenase 7 (Solyc02g080120) (Thomas et al., 1999), and GA signaling  (GA), a GAI-like 
protein 1 (Solyc01g059950) (Table 1; Thomas and Sun, 2004). Induction of these other hormone 
genes by cytokinin indicates the existence of a complex hormonal crosstalk pathway in tomato 
roots. Additionally two genes of the LATERAL ORGAN BOUNDARIES family (Solyc12g100150; 
Solyc06g082770) (Table 1) were found to be induced by cytokinin. This gene family has been 
linked to a range of developmental processes; including lateral root formation, as well as 
regulation by auxin and even cytokinin in one case, further supporting hormone connections to 
root development (Majer and Hochholdinger, 2011).  
Cytokinin repressed genes 
        More than 50 genes were repressed by cytokinin treatment and can be broadly categorized 
into processes related to metabolism, development, and transport. There are a wide range of 
metabolic processes linked to Cytochrome P450 genes of which four were found to be repressed 
in the root (Nelson and Werck-Reichhart, 2011). There were several different types of 
transporters or channel proteins that were repressed including, two aquaporins and proteins 
associated with potassium, manganese, and malate. While these transporters all facilitate the 
movement of water or important solutes into the root, it is unclear why they would be repressed in 
 
23 
 
the presence of additional cytokinin. One additionally interesting class of genes was the 
peroxidases, several of which were found as repressed while others were found to be induced by 
cytokinin. Peroxidases are known to have a variety of roles in developmental and defense related 
processes and the altered regulation of different peroxidases indicates a complex role for 
cytokinin in their regulation (Passardi et al., 2005). 
Auxin induced genes 
        There were 107 genes induced among all root tissues over 2.0 Log2FC by auxin from a total 
of 17,299 DE genes, whereas, 175, 20, 35 genes were specifically regulated in RT, LR, and WR 
tissues respectively (Fig. 1). Also, there were 46 genes commonly regulated genes in RT and LR 
tissues, 18 between LR and WR tissues, and 15 between RT and WR tissues. Overall, the number 
of auxin induced genes outnumbered the cytokinin induced genes in the root tip. Interestingly, 
several genes induced by auxin were also induced by cytokinin including the Cytokinin 
oxidase/dehydrogenase, ACC synthase, Gibberellin 2-oxidase genes (same IDs as mentioned 
above). This supports a range of findings that indicates there is a complex crosstalk among 
hormones during root growth and development (Depuydt and Hardtke, 2011). 
        Among the auxin DE induced genes were four GH3 family genes involved in Indole-3-acetic 
acid (IAA)-amido synthetase (Solyc01g107400, SlGH3-3, SlGH3-4, and SlGH3-9) with Log2FC 
ranging from 2.10-8.22 (Table 1). Of these, SlGH3-3, SlGH3-4, and SlGH3-9 genes were recently 
found as being group III members of the GH3 and were 3 of the 5 strongest auxin induced GH3 
family members in tomato etiolated seedlings treated with hormone for 1 or 3 hours (Kumar et 
al., 2012), supporting our finding of the strong auxin induction of these genes. As these genes are 
involved in controlling auxin homeostasis levels in the plant, conjugating excess active IAA to an 
inactive form their induction from the addition of exogenous auxin is not surprising, although 
their endogenous role in the in root is not well known (Kumar et al., 2012).     
Auxin induction was also seen in a number of genes belonging to two major auxin-
responsive transcriptional regulator families: Auxin/indole-3-acetic acid (Aux/IAA) and Auxin 
 
24 
 
response factor (ARF). These gene family members are essential players in auxin signaling with 
ARFs acting to active auxin regulated targets and Aux/IAA functioning as transcriptional 
repressor by binding to ARF and preventing their transcription factor activity, numerous of which 
has been identified in tomato (Kumar et al., 2011; Wu et al., 2012). In this study the Aux/IAA 
genes, SlIAA2, SlIAA5, SlIAA10, SlIAA11, SlIAA19, SlIAA21, and SlIAA23 were induced among 
all root tissues (Table 1), while three ARFs were specifically induced in RT: SlARF2, SlARF3, 
and SlARF9. The induction of these SlIAA genes would also be expected in response to the 
addition of exogenous auxin, in a manner parallel to the induction of SlRRAs by cytokinin, as 
both are acting to block excess hormone pathway signaling. Interestingly a recent report revealed 
that SlIAA genes can also be transcriptionally regulated by ethylene in tomato seedlings (Audran-
Delalande et al., 2012) suggesting they may function in other signaling pathways and contribute 
towards complex hormonal crosstalk. Several genetic approaches have been utilized that 
implicate the importance of Aux/IAA and ARFs in lateral root formation (De Smet, 2012). While 
we do find these genes induced by auxin in the root, they are not found uniquely induced in LR 
tissues; potentially because of LR tissues were not sampled during LR initiation when they are 
often required. 
        Auxin also induced SlAGO7, a member of the recently described tomato Argonaute (AGO) 
gene family (Table 1; Bai et al., 2012). Argonaute proteins are components of the RNA-induced 
silencing complex (RISC) involved in small RNA mediated silencing to regulate gene expression. 
In tomato it was shown that several members of this group were differentially regulated in 
response to abiotic and viral stresses. Although, SlAGO7 in particular, was not observed to be 
differentially regulated by abiotic or viral stress conditions, its induction by auxin provides a new 
basis for further research. Interestingly miRNAs that are utilized by RISC have been shown to be 
involved in root cap and LR formation by targeting specific ARFs (Wang et al., 2005), and can be 
regulated by auxin in LR development (Yoon et al., 2010) suggesting a potential role for SlAGO7 
in this process.  
 
25 
 
        Another gene, BREVIS RADIX (BRX, Solyc12g096110) that has a role in root development 
was induced by auxin (Table 1). BRX was first implicated as a regulator of cell proliferation and 
elongation in the growth zone of root tip (Mouchel et al., 2004), whose protein function is 
unknown so far to our knowledge. It has been shown in Arabidopsis that BRX has a role in 
cytokinin mediated inhibition of lateral root initiation which occurred due to loss of auxin 
response in presumptive founder cells in brx-2 with indirect involvement of brassinosteroid in the 
process (Li et al., 2009). How auxin regulation of BRX is involved in root development needs to 
be further explored.  
Interestingly, two NPH3 (non-phototropic hypocotyl 3, Solyc03g044090; Solyc07g048000) 
genes were also induced by auxin (Table 1). The function of most NPH3 family genes is still 
being investigated; however, recently this group has been linked to the proper localization of PIN 
protein auxin transporter (Furutani et al., 2011). The addition of exogenous auxin might result in 
a change in the endogenous auxin transport throughout the root, although this finding does further 
connect NPHs to auxin regulated processes.  
A range of different transcription factor families genes, involved in diverse plant metabolic 
and developmental roles were induced by auxin in all root tissues. These include two ERFs 
(Solyc05g050830; Solyc04g072300), SlCRF4, a WRKY (Solyc01g079260), and a GRAS family 
transcription factor (Solyc11g017100) (Table 1). In addition, there was induction by auxin of 
some transcription factor genes in a root tissue specific manner. Root tip specific transcription 
factors include six MYB family members, an AP2/ERF (Solyc02g092050), Heat stress 
transcription factor A3 (Solyc09g082670), and CYCLOIDEA. There were two lateral root 
specific auxin induced transcription factors: GATA transcription factor 22 (Solyc01g100220) and 
SlCRF6. The transcription factor bHLH151 (Solyc06g009510) was induced in WR, but not in the 
other specific tissues, suggesting that it may be induced in the non-RT or LR parts of the primary 
root. 
Auxin repressed genes 
 
26 
 
Auxin was found to repress a larger number of genes, more than 110, compared to the ~50 in 
cytokinin. Five different 2-oxoglutarate-dependent dioxygenase (ODDs) class of genes with a 
range of functions from catalyzing the production of alkaloids in roots to regulating GA 
biosynthesis were repressed. A previous report has shown that auxin can inhibit the production of 
alkaloid production in Hyoscyamus niger and this finding would supports that link (Hashimoto et 
al., 1986). There are also numerous instances connecting auxin and GA in hormone crosstalk, and 
since ODDs can function to both activate and inactive GAs in the biosynthesis pathway these 
genes could also support this relationship (Yamaguchi, 2008).  
A number of other genes repressed by auxin belong to several of the same gene families or 
categories that were also repressed by cytokinin such as CYP p450s, peroxidases, hormone 
regulation (ACC and GA), transporters (aquaporins and solute/nutrient transporters), as well as 
genes involved in the biosynthesis of secondary metabolites, and other metabolic and 
developmental processes. Other auxin repressed genes belong to various classes of transcription 
factors that are involved in protein turnover and stress. 
Common genes induced/repressed by both cytokinin and auxin among all root tissues 
We identified several genes that were commonly induced (5) or repressed (28) by cytokinin 
and auxin in all root three tissues that can be broadly categorized into metabolic and 
developmental processes. One of the commonly auxin and cytokinin induced genes is an expansin 
(Solyc01g090810) that was further verified as induced by both hormones using qPCR (Table 2). 
Interestingly this gene is highly related to the beta-expansin CIM1 from soybean that has 
previously been shown to be induced by both auxin and cytokinin, indicating that both hormones 
can be involved in regulating expansin genes and potentially function to control cell growth in the 
root (Downes et al., 2001). We also confirmed by qPCR the common repression by auxin and 
cytokinin of Ferric reductase oxidase (Solyc01g094910) involved in iron uptake by roots and a 
Proline rich protein (Solyc12g009650) involved in multiple processes including root nodule 
formation and response to external stimuli (Sheng et al., 1991; Table 2). The joint regulation of 
 
27 
 
these genes by these two hormones indicates that they are likely have vital roles in the root 
connected to hormone crosstalk.    
Transcriptome atlas of tomato root regions: Root-tip, Lateral root and Whole root  
        In addition to examining the auxin and cytokinin hormone response in root tissues, we used 
differential expression analysis on non-hormone treated (DMSO) root samples to identify genes 
expressed in specific regions of the root. We identified RT, LR, or WR abundantly expressed 
genes using DE comparisons between: RT and WR, LR and WR, and RT and LR with a >2.0 
Log2FC and padj ? 0.05 criteria. 
        Among the DE genes in RT, there were several classes of genes involved in defense 
response, pectin modification, CYP p450, transcription factors (MYB, GATA, and BHLH), Root 
cap proteins, an expansin, nodulin, cell division, and genes involved in other metabolic processes. 
The differential expression of many of these genes in the RT is not surprising as they are involved 
in active processes that occur in the RT such as expansion, cell division, as well as the 
encountering of a variety of biotic/abiotic stresses. 
        DE genes in the LR revealed a number of genes normally play roles in metabolism processes 
including Decarboxylase family protein, UDP-glucosyltransferases, Alcohol and Aldehyde 
dehydrogenases, Long-chain-fatty-acid-CoA ligase, Fatty acid elongase 3-ketoacyl-CoA 
synthase, and ER glycerol-phosphate Acyltransferase. In addition to these metabolic genes, a 
number of auxin related genes were also DE in LR, such as Aux/IAAs and SAURs that are 
known to be linked to LRs initiation and development (De Smet, 2012). 
        Since WR in our study comprised of RT and LRs, there were common genes expressed 
between these regions that are involved in metabolism and development. Compared to RT, WR 
and LR displayed similar profile with more than 120 common genes expressed indicating 
similarity in functionality of these regions. In addition, there was over-representation of genes 
expressed in WRs related to a range of function such as: ACC oxidases, transport of 
solute/minerals, CYP p450s, protein turnover, Receptor like kinases, and different transcription 
 
28 
 
factors related to ethylene, auxin, and cytokinin. Other interesting genes expressed in WRs were 
three class I heat shock proteins, three Water-stress inducible proteins, and two Phloem protein. 
As these genes cover a wide range of functional classes it is possible that they may work as 
individuals or have combinatorial effects for the overall root development in tomato. 
        In conclusion, in order to identify the genes expressed and/or regulated by the hormones 
cytokinin and auxin in the tomato root, transcriptome analysis was performed using RNA 
sequencing. These results present the first genome-wide root tissue analysis of gene response to 
these hormones. We revealed numerous significantly DE novel genes as well as tomato orthologs 
of auxin and cytokinin regulated transcripts. In addition this RNA sequencing analysis confirmed 
hormone regulation of some previous identified tomato auxin and cytokinin regulated gene from 
other studies. Several interactions were identified between different plant hormones and have 
been discussed in the context of hormonal crosstalk in the root. We also generated an atlas of root 
tissue specific transcripts and their auxin and cytokinin regulation in whole roots, root tips, and 
lateral roots. This expression atlas indicates several classes of genes that may have specific roles 
in different root tissues. Taken together, this study provides a solid foundation of gene expression 
in tomato roots, both in different tissues and in response to different hormones which should 
allow future investigations to more easily study and work to improve tomato roots, plant 
efficiency, and fruit yield. 
 
 
 
 
 
 
 
 
 
29 
 
Literature Cited 
Aloni R, Aloni E, Langhans M, Ullrich CI (2006) Role of cytokinin and auxin in shaping root 
architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and 
gravitropism. Annals of Botany 97:883-893 
 
Anders S, Huber W (2010) Differential expression analysis for sequence count data. Genome 
Biology 11:R106 
 
Audran-Delalande C, Bassa C, Mila I, Regad F, Zouine M, Bouzayen M (2012) Genome-Wide 
Identification, Functional Analysis and Expression Profiling of the Aux/IAA Gene Family in 
Tomato. Plant and Cell Physiology 53:659-672 
 
Bai M, Yang GS, Chen WT, Mao ZC, Kang HX, Chen GH, Yang YH, Xie BY (2012) Genome-
wide identification of Dicer-like, Argonaute and RNA-dependent RNA polymerase gene families 
and their expression analyses in response to viral infection and abiotic stresses in Solanum 
lycopersicum. Gene 501:52-62 
 
Benjamini Y, Hochberg Y (1995) Controlling the False Discovery Rate: A Practical and Powerful 
Approach to Multiple Testing. Journal of the Royal Statistical Society. Series B (Methodological) 
57:289-300 
 
Bleeker PM, Spyropoulou EA, Diergaarde PJ, et al (2011) RNA-seq discovery, functional 
characterization, and comparison of sesquiterpene synthases from Solanum lycopersicum and 
Solanum habrochaites trichomes. Plant Molecular Biology 77:323-336 
 
Brenner WG, Ramireddy E, Heyl A, Schm?lling T (2012) Gene Regulation by Cytokinin in 
Arabidopsis. Frontiers in Plant Sciences 3:1-22 
 
Che P, Gingerich DJ, Lall S, Howell SH (2002) Global and hormone-induced gene expression 
changes during shoot development in Arabidopsis. The Plant Cell 14:2771?2785 
 
Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The cytokinin-activated 
transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid 
signaling in Arabidopsis. Developmental Cell 19:284-295 
 
de Freitas ST, HandaAK, Wu Q, Park S, Mitcham EJ (2012) Role of pectin methylesterases in 
cellular calcium distribution and blossom-end rot development in tomato fruit. The Plant 
Journal doi: 10.1111/j.1365-313X.2012.05034 
 
De Smet I (2012) Lateral root initiation: one step at a time. New Phytologist 193:867-873 
 
Dello Ioio R, Nakamura K, Moubayidin L, Perilli S, Taniguchi M, Morita MT, Aoyama T, 
Costantino P, Sabatini S (2008) A genetic framework for the control of cell division and 
differentiation in the root meristem. Science 322:1380-1384 
 
Depuydt S, Hardtke CS (2011) Hormone Signalling Crosstalk in Plant Growth Regulation. 
Current Biology 21:R365-R373 
 
Dolan L, Janmaat K, Willemsen V, Linstead P, Poethig S, Roberts K, Scheres B (1993) Cellular  
organisation of the Arabidopsis thaliana root. Development 119:71?84 
 
30 
 
 
Downes BP, Steinbaker CR, Crowell DN (2001) Expression and Processing of a Hormonally 
Regulated ?-Expansin from Soybean. Plant Physiology 126:244-252 
 
Exp?sito?Rodr?guez M, Borges AA, Borges-P?rez A, P?rez JA (2008) Selection of internal 
control genes for quantitative real-time RTPCR studies during tomato development process. 
BMC Plant Biology 8:131 
 
Faldt J, Arimura G, Gershenzon J, Takabayashi J, Bohlmann J (2003) Functional identification of 
AtTPS03 as (E)-?-ocimene synthase: a monoterpene synthase catalyzing jasmonate- and wound-
induced volatile formation in Arabidopsis thaliana. Planta 216:745-751 
 
Feldman LJ (1979) Cytokinin biosynthesis in roots of corn. Planta 145:315-321 
 
Fr?bort I, Kowalska M, Hluska T, Fr?bortov? J, Galuszka P. 2011) Evolution of cytokinin 
biosynthesis and degradation. Journal of Experimental Botany 62:2431-2452 
 
Furutani M, Sakamoto N, Yoshida S, Kajiwara T, Robert HS, Friml J, Tasaka M (2011) Polar-
localized NPH3-like proteins regulate polarity and endocytosis of PIN-FORMED auxin efflux 
carriers. Development 138:2069-2078 
 
Galuszka P, Fr?bortov? J, Luhov? L, Bilyeu KD, English JT, Fr?bort I (2005) Tissue localization 
of cytokinin dehydrogenase in maize: possible involvement of quinine species generated from 
plant phenolics by other enzymatic systems in the catalytic reaction. Plant and Cell Physiology 
46:716-2 
 
Gom?z P, Jamilena M, Capel J, Zurita S, Angosto T, Lozano R (1999) Stamenless, a tomato 
mutant with homeotic conversions in petal and stamens. Planta 209:172-179 
 
Hashimoto T, Yukimune Y, Yamada Y (1986) Tropane alkaloid production in Hyoscyamus root 
cultures. Journal of Plant Physiology 124:61-75 
 
Hirose N, Makita N, Kojima M, Kamada-Nobusada T, Sakakibara H (2007) Overexpression of a 
type-A response regulator alters rice morphology and cytokinin metabolism. Plant and Cell 
Physiology 48:523-539 
 
Kumar R, Tyagi AK, Sharma AK (2011) Genome-wide analysis of auxin response factor (ARF) 
gene family from tomato and analysis of their role in flower and fruit development. Molecular 
Genetics and Genomics 285:245-260 
 
Kumar R, Agarwal P, Tyagi AK, Sharma AK (2012) Genome-wide investigation and expression 
analysis suggest diverse roles of auxin-responsive GH3 genes during development and response 
to different stimuli in tomato (Solanum lycopersicum). Molecular Genetics and Genomics 
287:221-235 
 
Li J, Mo X, Wang J, Chen N, Fan H, Dai C, Wu P (2009) BREVIS RADIX is involved in 
cytokinin-mediated inhibition of lateral root initiation in Arabidopsis. Planta 229, 593-603.  
Liang M, Haroldsen V, Cai X, Wu Y. 2006. Expression of a putative laccase gene, ZmLAC1 , in 
maize primary roots under stress. Plant, Cell and Environment 29:746-753 
 
 
31 
 
Lin Z, Zhong S, Grierson D (2009) Recent advances in ethylene research. Journal of 
Experimental Botany. 60:3311-3336 
 
Majer C, Hochholdinger F (2011) Defining the boundaries: structure and function of LOB 
domain proteins. Trends in Plant Sciences 16:47-52 
 
Marhav? P, Bielach A, Abas L, et al (2011) Cytokinin modulates endocytic trafficking of pin1 
auxin efflux carrier to control plant organogenesis. Developmental Cell 21:796-804 
 
Miller NA, Kingsmore SF, Farmer AD, et al (2008) Management of high-throughput DNA 
sequencing projects: Alpheus. Journal of Computer Science & Systems Biology 1:132-148 
 
Molinero-Rosales N, Latorre A, Jamilena M, Lozano R (2003) SINGLE FLOWER TRUSS 
regulates the transition and maintenance of flowering in tomato. Planta 218:427-434 
 
Mouchel CF, Briggs GC, Hardtke CS (2004) Natural genetic variation in Arabidopsis identifies 
BREVIS RADIX, a novel regulator of cell proliferation and elongation in the root. Genes & 
Development 18:700-714 
 
M?ller B, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification during 
early embryogenesis. Nature 453:1094-1097 
 
Muller A, Hillebrand H, Weiler EW (1998) Indole-3-acetic acid is synthesized from L-tryptophan 
in roots of Arabidopsis thaliana. Planta 206:362?369 
 
Naseem M, Philippi N, Hussain A, Wangorsch G, Ahmed N, Dandekar T (2012) Integrated 
Systems View on Networking by Hormones in Arabidopsis Immunity Reveals Multiple Crosstalk 
for Cytokinin Plant Cell 24:1793-1814 
 
Nelson D, Werck-Reichhart D (2011) A P450-centric view of plant evolution. The Plant Journal 
66:194-211 
 
O?Malley DM, Whetten R, Bao W, Chen CL, Sederoff R (1993) The role of laccase in 
lignification. The Plant Journal 4:751?757 
 
Par? PW, Tumlinson JH (1999) Plant volatiles as a defense against insect herbivores. Plant 
Physiology 121:325-331 
 
Park MH, Lee YB, Joe YA (1997) Hypusine is essential for eukaryotic cell proliferation. 
Biological Signals 6:115?123 
 
Park MH, Wolff EC, Folk JE (1993) Hypusine: its post-translational formation in eukaryotic 
initiation factor 5A and its potential role in cellular regulation. Biofactors 4:95?104 
 
Passardi F, Cosio C, Penel C, Dunand C (2005) Peroxidases have more functions than a Swiss 
army knife. Plant Cell Reports 24:255-265 
 
Pattison RJ, Catal? C (2012) Evaluating auxin distribution in tomato (Solanum lycopersicum) 
through an analysis of the PIN and AUX/LAX gene families. The Plant Journal 70:585-598  
 
 
32 
 
Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ (2006) A subset of 
Arabidopsis AP2 transcription factors mediates cytokinin responses in concert with a two-
component pathway. Proceedings of the National Academy of Sciences USA 103:11081-11085  
 
Scheres B, Benfey P, Dolan (2002) Root development. In The Arabidopsis Book, C.R. 
Somerville and E.M. Meyerowitz, eds (Rockville, MD: American Society of Plant Biologists), 
doi/10.1199/tab.0101, http://www.aspb.org/publications/arabidopsis 
 
Sheng J, D?Ovidio R, Mehdy MC (1991) Negative and positive regulation of a novel proline-rich 
protein mRNA by fungal elicitor and wounding. The Plant Journal 1:345-354 
 
Suga T, Ohta S, Munesada K, Ide N , Kurokawa M, Shimizu M, Ohta E (1993) Endogenous pine 
wood nematicidal substance in pines, Pinus massoniana, P.strobus and P. Palustris. 
Phytochemistry 33:1395-1401 
 
The Tomato Genome Consortium (2012) The tomato genome sequence provides insights into 
fleshy fruit evolution. Nature 485:635-641 
 
Thomas SG, Sun TP (2004) Update on Gibberellin signaling. A tale of the tall and the short. Plant 
Physiology 135:668-676 
 
Thomas SG, Phillips AL, Hedden P (1999) Molecular cloning and functional expression of 
gibberellin 2-oxidases, multifunctional enzymes involved in gibberellin deactivation. Proceedings 
of the National Academy of Sciences, USA 96:4698-4703 
 
Vanneste S, Friml J (2009) Auxin: A Trigger for Change in Plant Development. Cell 136:1005-
1016 
 
Wang TW, Lu L, Wang D, Thompson JE (2001) Isolation and characterization of senescence-
induced cDNAs encoding deoxyhypusine synthase and eukaryotic translation initiation factor 5A 
from tomato. The Journal of Biological Chemistry 276:17541-17549 
 
Wang JW, Wang LJ, Mao YB, Cai WJ, Xue HW, Chen XY (2005) Control of Root Cap 
Formation by MicroRNA-Targeted Auxin Response Factors in Arabidopsis. The Plant Cell 
17:2204-2216 
 
Wei JZ, Tirajoh A, Effendy J, Plant AL (2000) Characterization of salt-induced changes in gene 
expression in tomato (Lycopersicon esculentum) roots and the role played by abscisic acid. Plant 
Science 159:135?148 
 
Werner T, Nehnevajova E, K?llmer I, Novak O, Strnad M, Kr?mer U, Schm?lling T (2010) Root-
specific reduction of cytokinin causes enhanced root growth, drought tolerance, and leaf mineral 
enrichment in Arabidopsis and tobacco. The Plant Cell 22:3905-3920 
 
Wu TD, Nacu S (2010) Fast and SNP-tolerant detection of complex variants and splicing in short 
reads. Bioinformatics 26:873-881 
 
Wu J, Peng Z, Liu S, He Y, Cheng L, Kong F, Wang J, Lu G (2012) Genome-wide analysis of 
Aux/IAA gene family in Solanaceae species using tomato as a model. Molecular Genetics and 
Genomics 87:295-311 
 
 
33 
 
Yoon EK, Yang JH, Lim J, Kim SH, Kim SK, Lee WS (2010) Auxin regulation of the 
microRNA390-dependent transacting small interfering RNA pathway in Arabidopsis lateral root 
development. Nucleic Acids Research 38:1382-1391 
 
Zhang W, To JPC, Cheng CY, Schaller GE, Kieber JJ (2011) Type-A response regulators are 
required for proper root apical meristem function through post-transcriptional regulation of PIN 
auxin efflux carriers. The Plant Journal 68:1-10 
 
Zheng X, Miller ND, Lewis DR, Christians MJ, Lee KH, Muday GK, Spalding EP, Vierstra RD 
(2011) AUXIN UPREGULATED F-BOX PROTEIN1 regulates the cross talk between auxin 
transport and cytokinin signaling during plant root growth. Plant Physiology 156:1878-1893 
 
 
 
 
 
 
 
 
 
 
 
 
 
34 
 
               
Fig. 1 Differential expression (DE) of genes in tomato root tip (RT), lateral root (LR), and whole 
root (WR). Treatment of root regions are noted as the prefixes C (for the cytokinin, BA) and A 
(for the auxin, NAA) or D (for DMSO control) before RT, LR, and WR. (A) and (B) show venn 
diagrams illustrating DE and significantly induced genes in tomato root either between or unique 
to specific tissues. Gene details are presented in Table 1. (C) MvA DE analysis plots indicating 
genes log2 fold change (vertical axis) vs the log2 base mean (horizontal axis) for root tissues 
treated with cytokinin (top), auxin (middle), and control (DMSO, bottom). Genes with > 2.0 log2 
fold change values were identified as differentially regulated as noted in plots by lines (red, above 
as induced; blue, below as repressed). Significantly (padj? 0.05) DE genes are red dots 
 
35 
 
 
 
 
Fig. 2 Principal Component Analysis. Principle component analysis (PCA, JMP Genomics 5.1) 
depicts hormone treatment as the main variable producing the majority (68.6%) of the 
transcriptional variance. Treatment of root regions (root tip (RT), lateral root (LR), and whole 
root (WR)) are noted as the prefixes C (for the cytokinin, BA) and A (for the auxin, NAA) or D 
(for DMSO control) before RT, LR, and WR. Plots of these component principles in 2D and 3D 
reveal a strong clustering of individual sample replicates, I and II, as well as distinguishing 
treatments.  
 
 
 
 
A L R  I,I IA R T  I,I I A W R  I, II
D L R  I, IID R T  I, II D W R  I,II
C W R  I,IIC L R  I, IIC R T  I, II
 
36 
 
Table 1  Hormone regulated genes commonly induced in all root tissues. Shown are the Log2 
Fold Change values for genes commonly induced (> 2.0 ) by cytokinin (above) and auxin (below) 
among root tip (RT), lateral root (LR), and whole root (WR) with adjusted p-values ? 0.05 in one 
or more tissue. 
 
 
 
 
 
 
  
Gen e I D  D e sc r i pt i o n  RT  LR  WR  
In
d
u
c
e
d
 b
y
 C
y
to
ki
n
i
n
 
 L o g 2 F C  p a d j  L o g 2 F C  p a d j  L o g 2 F C  p a d j  
S o l y c 0 1 g 0 8 8 1 6 0  S l C KX 2  2 . 5 8  0 . 0 4 6 3 2 1  3 . 1 4  0 . 0 0 7 7 1  3 . 3 2  0 . 0 0 3 4 2 6  
S o l y c 0 4 g 0 8 0 8 2 0  S l C KX 4  2 . 9 0  8 . 5 6 E - 06  3 . 0 4  2 . 1 2 E - 06  2 . 1 8  0 . 0 0 0 7 2 5  
S o l y c 1 2 g 0 0 8 9 0 0  S l C KX 6  5 . 3 9  0 . 0 2 7 1 2 7  7 . 3 1  0 . 0 0 4 3 4  7 . 3 2  0 . 0 0 2 3 0 8  
S o l y c 0 2 g 0 7 1 2 2 0  S l R R A 2  2 . 3 1  3 . 4 8 E - 05  3 . 1 8  7 . 9 8 E - 09  3 . 0 3  2 . 0 1 E - 08  
S o l y c 0 6 g 0 4 8 9 3 0  S l R R A 6  2 . 5 3  0 . 1 1 7 3 3 2  2 . 9 0  0 . 0 5 1 3 3  3 . 8 5  0 . 0 0 7 1 1 5  
S o l y c 0 6 g 0 4 8 6 0 0  S l R R A 7  2 . 5 5  0 . 0 0 0 1 6 4  2 . 8 8  2 . 0 0 E - 05  3 . 1 7  2 . 2 5 E - 06  
S o l y c 0 9 g 0 9 2 4 7 0  T PS 1 4  6 . 2 2  2 . 0 7 E - 26  5 . 2 1  1 . 2 6 E - 22  3 . 8 5  2 . 7 5 E - 14  
S o l y c 0 1 g 1 0 5 9 6 0  ( E ) - b et a - o c i m e n e s y n t h a s e  4 . 4 2  9 . 0 2 E - 14  3 . 6 1  2 . 6 6 E - 11  3 . 0 8  3 . 8 6 E - 09  
S o l y c 0 2 g 0 8 0 7 9 0  S l D HS  3 . 4 5  0 . 0 0 0 2 9 3  6 . 0 5  4 . 9 4 E - 10  5 . 6 9  2 . 6 1 E - 09  
S o l y c 0 6 g 0 7 6 7 6 0  L a c c a s e 1 a   3 . 7 5  8 . 3 9 E - 07  2 . 2 7  0 . 0 0 2 6 4 8  2 . 6 3  0 . 0 0 0 3 4 8  
S o l y c 0 6 g 0 7 3 5 8 0  1 - a m i n o c y c l o p r o p a n e - 1 - c a r b o xy l a t e o x i d a s e 1   2 . 6 8  0 . 0 1 6 6 2 2  2 . 8 1  0 . 0 1 4 6 2 3  2 . 4 7  0 . 0 2 2 6 9 4  
S o l y c 1 2 g 0 0 8 7 4 0  1 - a m i n o c y c l o p r o p a n e - 1 - c a r b o xy l a t e s y n t h a s e  3 . 0 2  8 . 9 6 E - 12  4 . 2 6  1 . 1 5 E - 14  3 . 2 1  1 . 3 8 E - 08  
S o l y c 0 4 g 0 1 0 3 3 0  A u xi n - r eg u l a t e d  p r o t ei n   2 . 1 8  0 . 3 5 1 0 4 7  2 . 7 3  0 . 1 6 3 1 8 5  3 . 7 8  0 . 0 2 9 7 8  
S o l y c 0 2 g 0 8 0 1 2 0  G i b b erel l i n  2 - b e t a - d i o x y g e n a s e 7  3 . 0 6  6 . 7 6 E - 05  3 . 1 6  5 . 3 4 E - 06  2 . 3 7  0 . 0 0 0 4 5 9  
S o l y c 0 1 g 0 5 9 9 5 0  GAI - l i k e p r o t ei n  1  4 . 8 7  2 . 5 3 E - 27  3 . 5 0  2 . 8 7 E - 14  2 . 3 7  1 . 2 5 E - 08  
S o l y c 0 6 g 0 8 2 7 7 0  L O B  d o m a i n  f a m i l y  p r o t e i n  2 . 6 0  1 . 1 6 E - 06  3 . 3 4  4 . 0 0 E - 18  2 . 4 5  7 . 7 0 E - 10  
S o l y c 1 2 g 1 0 0 1 5 0  L O B  d o m a i n  p r o t ei n  4   4 . 3 4  1 . 2 4 E - 05  4 . 8 4  2 . 3 9 E - 07  5 . 9 9  5 . 7 1 E - 09  
        
In
d
u
c
e
d
 b
y
 A
u
x
i
n
 
S o l y c 0 1 g 1 0 7 4 0 0  I n d o l e - 3 - a c et i c  ac i d  ( I A A ) - a m i d o  s y n t h et a s e  3 . 1 5  1 . 2 4 E - 06  2 . 2 0  0 . 0 0 1 2 1 6  2 . 1 1  0 . 0 0 3 2 0 9  
S o l y c 0 2 g 0 6 4 8 3 0  S l G H3 - 3  7 . 3 1  8 . 6 5 E - 1 0 7  6 . 6 1  4 . 4 9 E - 98  8 . 2 2  1 . 0 3 E - 1 0 8  
S o l y c 0 2 g 0 9 2 8 2 0  S l G H3 - 4  6 . 5 6  1 . 5 6 E - 55  6 . 7 6  2 . 6 6 E - 57  7 . 1 6  3 . 7 0 E - 59  
S o l y c 0 7 g 0 6 3 8 5 0  S l G H3 - 9  4 . 9 5  7 . 9 8 E - 34  4 . 9 3  7 . 2 0 E - 33  4 . 5 1  2 . 7 0 E - 28  
S o l y c 0 6 g 0 8 4 0 7 0  S l I A A 2  2 . 5 7  3 . 3 4 E - 11  3 . 6 4  7 . 4 9 E - 20  3 . 3 1  9 . 3 1 E - 16  
S o l y c 1 2 g 0 9 6 9 8 0  S l I A A 5  3 . 9 9  3 . 0 1 E - 45  3 . 5 3  1 . 5 0 E - 38  3 . 4 5  1 . 8 5 E - 36  
S o l y c 0 6 g 0 0 8 5 9 0  S l I A A 1 0  3 . 7 8  7 . 0 8 E - 05  3 . 6 4  0 . 0 0 0 2 6 5  2 . 9 9  0 . 0 0 4 3 6 9  
S o l y c 0 3 g 1 2 0 3 8 0  S l I A A 1 1  4 . 9 1  1 . 4 7 E - 32  5 . 6 9  8 . 8 6 E - 37  5 . 6 0  3 . 6 8 E - 29  
S o l y c 0 7 g 0 0 8 0 2 0  S l I A A 1 9  7 . 5 8  1 . 4 1 E - 50  6 . 9 2  7 . 0 3 E - 46  7 . 1 7  2 . 9 5 E - 41  
S o l y c 0 8 g 0 2 1 8 2 0  S l I A A 2 1  5 . 4 7  9 . 7 0 E - 09  5 . 0 6  2 . 0 1 E - 07  4 . 2 6  1 . 0 9 E - 05  
S o l y c 0 9 g 0 8 3 2 8 0  S l I A A 2 3  2 . 2 2  2 . 6 2 E - 25  2 . 5 0  7 . 2 2 E - 31  2 . 4 5  6 . 0 8 E - 29  
S o l y c 0 1 g 0 1 0 9 7 0  S l A G O7  2 . 3 5  1 . 0 5 E - 16  2 . 2 4  5 . 9 8 E - 15  2 . 0 2  1 . 2 3 E - 12  
S o l y c 1 2 g 0 9 6 1 1 0  Pr o t ei n  B R E VI S  R A D I X  4 . 1 9  9 . 5 6 E - 33  3 . 6 7  1 . 4 2 E - 29  3 . 5 2  1 . 9 2 E - 20  
S o l y c 0 7 g 0 4 8 0 0 0  Ph o t o t r o p i c - r es p o n s i v e N PH 3   3 . 2 9  4 . 5 4 E - 15  2 . 9 7  2 . 1 5 E - 11  2 . 2 7  6 . 3 4 E - 07  
S o l y c 0 3 g 0 4 4 0 9 0  Ph o t o t r o p i c - r es p o n s i v e N PH 3  f a m i l y  p r o t ei n   2 . 4 4  1 . 7 0 E - 10  2 . 7 4  3 . 0 4 E - 12  2 . 4 3  1 . 6 7 E - 09  
S o l y c 0 4 g 0 7 2 3 0 0  E t h y l e n e - r es p o n s i v e t r a n s c r i p t i o n  f a c t o r  4  3 . 4 9  5 . 5 7 E - 05  4 . 5 2  9 . 3 9 E - 07  3 . 7 2  0 . 0 0 0 1 0 7  
S o l y c 0 5 g 0 5 0 8 3 0  E t h y l e n e - r es p o n s i v e t r a n s c r i p t i o n  f a c t o r  4  5 . 9 9  3 . 0 7 E - 09  6 . 1 7  4 . 3 6 E - 09  4 . 8 2  3 . 8 1 E - 06  
S o l y c 0 3 g 0 0 7 4 6 0  S l C R F 4  2 . 6 3  5 . 2 5 E - 21  2 . 7 0  1 . 3 1 E - 22  2 . 3 6  1 . 0 4 E - 15  
S o l y c 0 1 g 0 7 9 2 6 0  W R KY  t r a n s c r i p t i o n  f a c t o r  4   2 . 2 2  3 . 1 1 E - 23  2 . 0 7  5 . 7 7 E - 20  2 . 2 1  2 . 0 2 E - 21  
S o l y c 1 1 g 0 1 7 1 0 0  G R A S  f a m i l y  t r a n s c r i p t i o n  f a c t o r  3 . 2 7  0 . 0 0 0 1 1 2  3 . 5 4  5 . 3 5 E - 05  2 . 1 2  0 . 0 2 6 7 3 9  
 1  
 
37 
 
Table 2 Experimental validation of a subset of cytokinin/auxin regulated transcripts. Shown are 
the Log2 Fold Change values from qRT-PCR vs RNA sequencing in root tip (RT), lateral root 
(LR), and whole root (WR) for genes (A) induced by cytokinin, (B) induced by auxin (C) 
repressed by cytokinin and auxin. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
38 
 
Table 3 Primers sequences for genes induced by cytokinin or auxin used for the verification of 
mRNA-seq results by qRT-PCR 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
F o r w a r d  R e v e r s e
S o l y c 0 4 g 0 7 8 9 0 0 Cy t P 4 5 0 5 '  A G G CT G T A G CT G A T G T G G A A  3 ' 5 '  G CA T G T A CA CCA CT G CCA A A  3 '
S o l y c 1 2 g 0 0 8 9 0 0 S l C K X 6 5 '  T T CCA T T A G G G G A CA A G CCA  3 ' 5 '  A CCA CCA A CG G T A A G G T A CA  3 '
S o l y c 0 1 g 1 1 1 9 0 0 O - me th y l tr a n s f e r a s e 5 '  A CA CCT G T T T CT CG T CT G CT  3 ' 5 '  CA G T G CG T CG T T G A T CA G T T  3 '
S o l y c 0 1 g 0 9 0 8 1 0 E x p a n s i n 5 '  A CCA A CCA CCA T T CT CG T CT  3 ' 5 '  G CT CCA A A A G A A G T G CCA CT  3 '
S o l y c 1 2 g 1 0 0 1 5 0 L O B  d o ma i n 5 '  T CA A CG A G G A G A T G CA G T G A  3 ' 5 '  T G T T G A G A T G A CG G T G A CCA  3 '
F o r w a r d  R e v e r s e
S o l y c 0 1 g 0 9 0 8 1 0 E x p a n s i n 5 '  A CCA A CCA CCA T T CT CG T CT  3 ' 5 '  G CT CCA A A A G A A G T G CCA CT  3 '
S o l y c 0 3 g 1 2 0 3 8 0 S l I A A 1 1 5 '  G CA G CA G CA A CA A CA A CA A C 3 ' 5 '  CA A A A A CG G T G CT CCA T CCA  3 '
S o l y c 0 7 g 0 0 8 0 2 0 S l I A A 1 9 5 '  A G T G G T G G CA G A G G A T CA A T  3 ' 5 '  CT CT G CA CT G A CCCA A CA A A  3 '
S o l y c 0 3 g 1 2 0 0 6 0 Cy toc h r o me  P 4 5 0 5 '  T A A CT G T CT G T G G A G CA CG T  3 ' 5 '  T CG T T A G CA T CT T G T CCCC A  3 '
S o l y c 0 2 g 0 6 4 8 3 0 S l G H 3 - 3 5 '  T A CG CA T CG T CCG A G T G T T A  3 ' 5 '  T T CCCA CT T CCA CG T T A G CT  3 '
F o r w a r d  R e v e r s e
S o l y c 1 2 g 0 0 9 6 5 0 P r o l i n e  r i c h  p r o te i n 5 '  T CCCA T T CT T G G A T G T G G CT  3 ' 5 '  G T G G CA A T T T G A CT G G T G G T  3 '
S o l y c 0 1 g 0 9 4 9 1 0 F e r r i c  r e d u c ta s e  o x i d a s e 5 '  T G T T CCA G T CA CA A G A G G CT  3 ' 5 '  T G CCA A T T CA CCA G CCA A A T  3 '
P r i me r  s e q u e n c e s  f o r  g e n e s  i n d u c e d  b y  c y tok i n i n  
P r i me r  s e q u e n c e s  f o r  g e n e s  i n d u c e d  b y  a u x i n  
P r i me r  s e q u e n c e s  f o r  g e n e s  r e p r e s s e d  b y  c y tok i n i n  a n d  a u x i n  
 
39 
 
 
 
 
 
 
Chapter III. Down-stream components of cytokinin signaling and the role of cytokinin 
throughout the plant 
 
Abstract  
        Cytokinins constitute a class of plant hormones influencing numerous aspects of growth and 
development. These processes occur through the downstream components of the cytokinin 
signaling pathway after its perception and signal transduction. The importance of these 
downstream signaling components has been revealed through the use of both traditional genetic 
and advanced molecular approaches studying mutants and transgenic lines involving cytokinin 
and diverse plant growth and developmental processes. Interestingly, these effects are not always 
directly via cytokinin, but by interactions with other plants hormones or transcription factor 
cascades, which can involve regulatory loops that affect transcription as well as hormone 
concentrations. This review covers recent advancements in understanding the role of cytokinin 
via its signaling components, specifically the downstream responses regulators in controlling vital 
plant growth and developmental processes. 
Introduction 
        Cytokinins are a group of N6-substituted adenine derivatives that were first discovered in the 
laboratory of F. Skoog over a half-century ago, as a cell division factor ??kinetin?? (Miller et al. 
1955). Since then, cytokinin has been shown to be involved in numerous developmental 
processes from meristem specification to cell division and expansion. Much of the work done to 
understand the complex process of cytokinin regulation of plant development has focused on its 
two-component system (TCS). This plant system resembles a modified bacterial two component 
signaling system comprised of receptor histidine kinases (HKs), phosphotransfer proteins (HPts) 
 
40 
 
and response regulators (RRs) (Ferreira and Kieber 2005; Heyl and Schm?lling 2003; Kakimoto 
2003; Maxwell and Kieber 2005). In the TCS, once cytokinin binds to the receptor it becomes 
autophosphorylated and then passes this phosphate on to a HPt, which ferries the phosphate 
signal into the nucleus and on to a RR. The RRs then are involved in translating this signal into 
cytokinin-regulated growth and developmental processes. This review centers on the downstream 
cytokinin signaling pathway components, primarily the RRs, and presents the present status of 
our understanding of the role of these components in plant development. 
Response regulators in cytokinin signaling 
        Response regulators (RRs) are the downstream nuclear localized components of the TCS 
that are believed to be the major regulators of cytokinin response in plants. TCS cytokinin 
signaling from the receptors to RR occurs through a conserved phosphorelay receiver protein 
domain,with required DDK amino acid residues characteristic of similar receiver domains found 
in prokaryotes and yeast (Fig. 3; Hwang et al. 2002). Through sequence analysis, it was shown 
that there are 22 RRs in Arabidopsis, which were  originally divided into two large classes, type-
A and  type-B ARRs based on protein sequence and domain structure in addition to 
transcriptional induction by cytokinin (Brandstatter and Kieber 1998; Kiba et al. 1999; Taniguchi 
et al. 1998; Imamura et al. 1999). Additional phylogenic analysis on all receiver domain 
containing proteins has classified RR members into four different groups: type-A, type-B, type-C, 
and pseudo RRs (Fig. 3; Sakai et al. 1998, 2000, 2001; Mizuno and Nakamichi 2005). The type-A 
and type-C ARRs contain only a phospho-accepting receiver domain, whereas the type-B ARRs 
contain both a receiver domain and a C-terminal output domain containing a GARP family myb-
like DNA binding and a transactivating region. Type-B ARRs also have a conserved region 
containing a nuclear localization signal (NLS) responsible for their subcellular localization 
(Imamura et al. 2001; Hosoda et al. 2002). Five additional proteins in Arabidopsis are related to 
RRs, but cannot function as phosphate receivers as their required phosphate receiving aspartate is 
changed to a glutamate. These proteins are called the pseudo RRs (PRR). Similar to type-B 
 
41 
 
ARRs, PRRs also have a C-terminal extension, however, it contains a CCT plant specific motif 
(CONSTANS, CONSTANS-like and TOC1) (Makino et al. 2000; Matsushika et al. 2000; 
Putterill et al. 1995) not a GARP domain. As such, PRRs are not directly involved in TCS and are 
linked instead to circadian regulation (Mizuno and Nakamichi 2005) in plants which is beyond 
the scope of this review. 
Type-B ARRs 
        The type-B RR family in Arabidopsis is comprised of 11 members, ARR1, 2, 10, 11, 12, 13, 
14, 18, 19, 20 and 21 which can be further divided into three subfamilies based on the 
phylogenetic analysis of their receiver domains (Mason et al. 2004). It is important to note that 
none of the type-B RRs are  transcriptionally induced by cytokinin. Subfamily I comprises the 
members: ARR 1, 2, 10, 11, 12, 14, and 18, most of which have been shown to be involved in 
mediating cytokinin response (Argyros et al. 2008; Hwang and Sheen 2001; Imamura et al. 2003 
Ishida et al. 2008; Sakai et al. 2001; Yokoyama et al. 2007). Subfamily I members appear to be 
the primary players in TCS response, since as yet there is no convincing information that the 
other subfamily members: ARR 13 and 21 (subfamily II) and ARR 19 and 20 (subfamily III) are 
involved in cytokinin responses. 
        Intracellular localization studies, utilizing GFP- or GUS fusion proteins, revealed that 
localization of all type-B ARRs is within the nucleus, even for truncated protein versions lacking 
a receiver domain (Lohrmann et al. 1999, 2001; Sakai et al. 2000; Hwang and Sheen 2001; 
Hosoda et al. 2002; Mason et al. 2004). Additional examination of  ARR2-GFP after exogenous 
cytokinin treatment in Arabidopsis protoplasts showed no change in intracellular position (Hwang 
and Sheen 2001) suggesting that the type-B ARRs likely are expressed and move to the nucleus 
to mediate cytokinin responses. 
        Tissue and organ specific expression patterns of type-B ARRs appear to be overlapping 
during different developmental stages (Mason et al. 2004; Tajima et al. 2004). Studies based on 
ARR::GUS fusions for subfamily I members: ARR1, ARR2, ARR10, and ARR12 showed that 
 
42 
 
they are expressed throughout young leaves and as the leaves mature their expression becomes 
restricted to the vascular tissue and hydathodes. ARR2 and ARR12 are also expressed in 
trichomes. Similar overlapping patterns were seen in case of roots where these ARRs display 
variable expression in the root apical meristem (RAM), zone of elongation and in mature root 
(Mason et al. 2004; Birnbaum et al. 2003). Despite having unique tissue expression patterns 
subfamily II and III members were observed to overlap with subfamily I in young trichomes 
(subfamilies I and III) and in aerial tissues (subfamilies I and II) (Mason et al. 2004). 
        ARR1 and ARR2 were the first RRs to be recognized as transcription factors (TFs) because 
of the presence of the essential characteristics of a GARP Myb-like transcriptional activator 
domain (Sakai et al. 2000; Fig. 3). Study of RRs as TFs included examination of direct promoter 
binding of the TF domain (Lohrmann et al. 2001), and identification of RR DNA binding 
sequence 50AGATT30 in ARR10 (Hosoda et al. 2002). Further investigations identified specific 
amino acids in ARR10 responsible for the DNA binding interaction (Hosoda et al. 2002). ARR11 
was also shown to receive a phosphoryl group from an AHP in vitro and then bind to the DNA 
sequence 50GGATT30 (Imamura et al. 2003). Recently it has been proposed that type-B ARRs 
must also be expressed at more than a minimal threshold level to activate the entire signaling 
pathway (M?ller 2011). 
        Type-B ARRs appear to act as positive regulators of cytokinin signaling, in contrast to type-
A ARRs that act as negative regulators, which together form a negative feedback loop (Hwang 
and Sheen 2001). Several different groups have utilized transgenic approaches to demonstrate the 
positive role of type-B ARRs in the pathway, including initially showing that ARR2 
overexpressing plants stimulated cell proliferation and shoot formation in vitro in the absence of 
exogenous cytokinin (Hwang and Sheen 2001). Argyros et al. 2008 observed the arr1, 10, 12 
triple mutant had reduced expression of CYCD3;1, a D-type cyclin that regulates cytokinin 
effects on cell division. Type-B ARRs were also found to regulate the expression of the type-A 
RRs (Hwang and Sheen 2001; Sakai et al. 2001). Observations also show that the type-B ARRs 
 
43 
 
(1, 2, and 10) induced ARR6 expression in the absence of cytokinin, in contrast to several type-A 
ARRs that repressed ARR6 (Hwang and Sheen 2001). Somewhat similar studies examined 
cytokinin sensitivity of arr1 mutant and ARR1 overexpression lines. These revealed that arr1 
displayed reduced sensitivity to cytokinin and reduced expression of ARR6, whereas ARR1 
overexpression lines showed increased sensitivity to cytokinin and increased expression of ARR6 
(Sakai et al. 2001). Further evidence of type-B RR positive role has come from mutant analyses 
where the generation of increasing higher order type-B RR multiple mutants resulted in greater 
reduction in sensitivity to cytokinin (Argyros et al. 2008; Ishida et al. 2008; Mason et al. 2005; 
Yokoyama et al. 2007). 
        Several type-B RRs may function in roles outside of the cytokinin signaling. For example, 
ARR2 has also been shown to mediate ethylene response, in both, analyses of loss-of-function 
and overexpressing lines (Hass et al. 2004). Another recent finding has shown that type-B ARRs 
can act by binding with the Salicylic acid (SA) response factor TGA3 to boost resistance against 
Pseudomonas syringae pv. Tomato (Pst) in Arabidopsis (Choi et al. 2010). These findings 
indicate that type-B RRs might act as a link between other signaling pathways to coordinate 
different developmental processes. More investigations on the RRs are needed to fully understand 
their potential roles in indirect or independent cytokinin-regulated growth and development. 
Type-A ARRs  
        Type-A ARRs were initially observed as members of the TCS pathway whose expression is 
rapidly induced in response to cytokinin. They are now known to be negative regulators of 
cytokinin signaling, in direct contrast to type-B RRs. There are generally considered to be 10 
type-A RRs in Arabidopsis: ARR3, 4, 5, 6, 7, 8, 9, 15, 16, 17 (To et al. 2004), however, 
sometimes the type-C RRs are also included in this group. Type-A RRs have the most basic RR 
protein form containing only a receiver domain, and no transcription factor domain like type-B 
RRs (Fig. 3). Although all type-A RRs are up-regulated by cytokinin, some type-As, ARR5, 6, 7, 
and 15 are greatly induced in response to cytokinin, while others, ARR4, 8, and 9 have relatively 
 
44 
 
high basal level of expression and are induced by cytokinin to a lesser degree (Brandstatter and 
Kieber 1998; D?Agostino et al. 2000; Imamura et al. 1998; Kiba et al. 1999; Rashotte et al. 2003). 
Similar findings are true for type-A RRs from a range of species beyond  Arabidopsis, such as 
maize and rice (Asakura et al. 2003; Jain et al. 2006). 
        Type-A ARRs have been shown to have different intracellular localization patterns from 
studies utilizing GFP-fusion proteins (Hwang and Sheen 2001; Imamura et al. 2001; Kiba et al. 
2002). While GFP-fusion proteins for ARR5, ARR6, ARR7 and ARR15 have been detected just 
in the nucleus, ARR4 and ARR16 have been observed both in the cytoplasm and in nucleus 
indicating potentially broader roles in TCS signaling. 
        Type-A ARRs also display overlapping tissue expression patterns in the presence of 
exogenous cytokinin as seen in the root by promoter::GUS analysis (To et al. 2004). Induction 
levels of reporter gene activity paralleled previous transcriptional expression induction finding for 
the type-A RRs noted above. Interestingly, cytokinin treatment caused an expansion of reporter 
expression to tissues surrounding their normal localization. Type-A ARRs have been shown to 
respond to exogenous cytokinin across a range of tissues from the root to shoot apical meristem 
(SAM) in numerous studies (D?Agostino et al. 2000; To et al. 2004). In fact the ARR5 
promoter::GUS fusion has been routinely used as the most predominant marker/proxy of 
cytokinin response in plants. 
        After activation and prolonged cytokinin signal transduction, there is also a need to mitigate 
the signaling pathway. This is done through the negative regulation of the TCS by induction of 
the type-A RRs. Cytokinin induced expression activation of type-A RRs has been observed in a 
variety of tissues in maize (Zea mays) and rice (Oryza sativa) along with Arabidopsis (Asakura et 
al. 2003; Jain et al. 2006; D?Agostino et al. 2000; Rashotte et al. 2003). It has also been shown 
that the transcriptional activation of type-A RRs by cytokinin occurs in the absence of de novo 
protein synthesis (Brandstatter and Kieber 1998; Sakakibara et al. 1999; D?Agostino et al. 2000) 
suggesting that type-A ARRs are cytokinin primary response genes. While type-A RRs can be 
 
45 
 
directly activated via TCS signaling through the HKs and HPts, they have also been shown to be 
direct transcriptional targets of type-B RRs as part of the TCS feedback regulation (Hwang and 
Sheen 2001; Sakai et al. 2001). Recently, six type-A ARR proteins (ARR5, ARR7, ARR8, 
ARR15, ARR16 and ARR17) have also been shown to be regulated by a combinatorial 
mechanism which involves proteasome pathways along with cytokinin (Ren et al. 2009). This 
indicates that other pathways can interact with downstream components of the TCS to regulate 
various developmental processes. 
        There have been a number of studies that have focused on determining the primary function 
of type-A RRs in addition to those studies initially linking them to the TCS and cytokinin 
induction. More recent investigations of type-A ARRs as negative regulators of the TCS found 
that phosphorylation of ARR5 and ARR7 at an aspartate phosphate receiver domain is necessary 
for them to act as negative regulators and that cytokinin itself regulates their stability (Lee et al. 
2008; To et al. 2007). Additional studies also indicate the importance of this phosphorylation. 
Specifically, as shown for the overexpression of ARR7 that reduces root growth inhibition and 
callus formation by cytokinin, whereas overexpression of ARR7 mutated to prohibit ASP 
phosphorylation resulted in no phenotypes (Lee et al. 2007, 2008). Similar findings were shown 
regarding the importance of phosphorylation for ARR5 including mutation of the conserved ASP 
residue to prohibit phosphorylation, which was unable to complement phenotype functionality in 
an arr3, 4, 5, 6 mutant, when an unaltered ARR5 could (To et al. 2007). Furthermore, partial 
complementation could be seen in an ARR5 ASP mutated to be a phosphor-mimic line. An 
additional mechanism for type-A RRs to act as negative regulators in the TCS could occur by 
competitively taking phosphates that would otherwise activate type-B RRs as positive regulators; 
however, the exact mechanism is currently unknown. 
Type-C ARRs 
        Type-C ARRs, ARR22 and ARR24, have been added as a separate group of RRs that are 
also basic RRs, like type-A RRs, lacking any domain other than a receiver domain. However, 
 
46 
 
from sequence analysis this domain in type-C RRs has less similarity with other RRs and appears 
to be more related to the receiver domain found in the hybrid histidine kinase receptors (Kiba et 
al. 2004; To and Kieber 2008). Additionally, type-C RRs are not induced by cytokinin, making 
them distinct from the type-A RRs. ARR22 has been shown to be induced transcriptionally as a 
result of wounding, indicating a possible role of type-Cs in response to other signals (Gattolin et 
al. 2006). As type-C RRs do not appear to be directly linked to TCS processes, a role in cytokinin 
mediated growth and developmental processes remains to be found. 
Other downstream components: cytokinin response factors (CRFs)  
        Cytokinin signaling components directly downstream of the receptors and phosphorelay 
proteins are usually limited to the response regulators as noted above. One other identified group 
has been sometimes included as a side branch to this signaling pathway is the cytokinin response 
factors or CRFs. These genes were originally identified as highly related cytokinin induced 
AP2/ERF-like transcription factors in microarray experiments to identify cytokinin-regulated 
genes (Rashotte et al. 2003). Additional examination of CRFs in relation to the TCS indicates that 
they are downstream of the receptors and phosphorelay proteins and form branch in the pathway 
parallel to the response regulators (Rashotte et al. 2006). More recently CRFs were also shown to 
directly interact via protein?protein interactions with AHPs, in a pattern that is similar to 
interactions seen for both type-A and -B ARRs, further supporting the finding of these proteins as 
a side branch of the TCS pathway (Cutcliffe et al. 2011). Rare specific CRF-RR interactions 
could be found in that same study for both type-A and -B ARRs potentially suggesting that 
another complex set of interactions between downstream components could exist to additionally 
regulate cytokinin signaling, although this will require more study. 
        CRFs have also been shown to act as transcription factors targeting many cytokinin-
regulated genes that type-B RRs also act upon, although CRFs do have cytokinin-regulated 
targets independent of RR targets (Rashotte et al. 2006). It is not too surprising that each of these 
groups acts on different targets, since they are entirely different classes of transcription factors 
 
47 
 
with non-overlapping sequences. Phylogenetic analysis has revealed that CRFs are present and 
broadly represented across all land plants with large radiations of CRFs in angiosperms, similar to 
other downstream components (Rashotte and Goertzen 2010). Loss-of-function analyses of CRF 
mutants in Arabidopsis revealed that these genes function in a redundant manner and are likely 
involved in the normal development of embryos, cotyledons, and leaves (Rashotte et al. 2006). 
Recently, a complete analysis of CRF genes has also been described in tomato, named Solanum 
lycopersicum cytokinin response factors (SlCRFs). These 11 SlCRF genes show distinct 
expression patterns in response to exogenous cytokinin (Shi et al. 2012) similar to some of the 
Arabidopsis CRFs and possibly have a role in vascular development in leaves (Zwack et al. 
unpublished results). Although the functional role for CRFs in cytokinin signaling and cytokinin 
developmental processes is still being determined, it is clear that there are direct connections. 
Cytokinin regulation of plant developmental pathways  
        The role of cytokinin in various organ developmental processes is crucial. Either cytokinin 
or cytokinin interactions with other signaling pathways regulates the growth and development of 
essential plant organs including the root, stem, leaf, and flower as discussed in the following 
sections. 
Root development: from stem cell to symbiosis 
        Beginning from the specification of root stem-cell niche, cytokinin is involved in regulating 
many different developmental aspects. Work from Friml et al. (2003) and Sabatini et al. (1999) 
revealed that auxin plays a role in the specification of RAM and this hormone is actively present 
in the basal cell of the embryo. Additional work by M?ller and Sheen (2008) expanded these 
studies on root stem-cell niche specification, utilizing GFP reporter analysis of TCS genes to 
track their activity during this process. Cytokinin signaling output via TCS::GFP was first 
observed in the hypophysis of the 16-cell stage embryo, then after the asymmetric division, its 
activity becomes restricted to the apical lens shaped daughter cell and repressed in the basal cell. 
This indicates that cytokinin is likely required to ensure correct divisions needed to form the 
 
48 
 
RAM. The high levels of endogenous auxin induce the type-A RRs, ARR7 and ARR15 to 
diminish the presence of cytokinin signal in the basal cell (M?ller and Sheen 2008). Hence, the 
interplay between auxin and cytokinin was found to be important for the establishment of root 
stem-cell niche. 
        Along with the establishment of the apical cell in root development, cytokinin has been 
found to have roles in the RAM size via its signaling components. It was observed that TCS 
mutant plants ahk3 and arr1, 12 produce a large RAM (Dello Ioio et al. 2007) indicating that 
cytokinin acts to maintain RAM size (Fig. 4). However, other groups showed that the RAM 
activity was arrested in the arr1, 10, 12 triple mutant and reduced in ahk 2, 3, 4 triple and ahp1, 2, 
3, 4, 5 quintuple mutants (Higuchi et al. 2004; Hutchison et al. 2006; Ishida et al. 2008; 
Nishimura et al. 2004; Yokoyama et al. 2007). Meristem size and root length were also observed 
to be decreased in plants with complete absence of cytokinin perception (Higuchi et al. 2004; 
Nishimura et al. 2004) suggesting a minimum threshold level of cytokinin is necessary; possibly 
to interact with other signals and have normal RAM growth and development, although the exact 
relation is unclear. 
        Crosstalk between cytokinin and auxin also has an influence on meristem size and root 
growth, as seen in a number of gene regulation linkages. Specifically, the type-B RR, ARR1 was 
found to be involved in the regulation of RAM size via direct regulation of the SHORT 
HYPOCOTYL 2 (SHY2/IAA3) gene (Dello Ioio et al. 2008; Taniguchi et al. 2007) that 
negatively regulates auxin transport by decreasing PIN expression (Fig. 4). Also cytokinin has 
recently been shown to regulate the levels of PIN efflux carriers via type-A RRs (Zhang et al. 
2011). Auxin, in turn, stimulates SHY2 breakdown allowing its PIN-mediated 
transport/distribution, which ensures cell expansion in the RAM (Mockaitis and Estelle 2008). 
Cytokinin levels have further been shown to be regulated by SHY2 via down-regulation of the 
cytokinin biosynthesis gene, isopentenyltransferase5 (IPT5) (Dello Ioio et al. 2008). These results 
 
49 
 
indicate that cytokinin and auxin  appear to interact in an antagonistic manner to maintain the 
level of each other and hence proper RAM development. 
        Several studies have shown that mutants of CRE1/AHK4 (de Leon et al. 2004; M?h?nen et 
al. 2000; Scheres et al. 1995) or multiple ahk and ahp mutants (Higuchi et al. 2004; Hutchison et 
al. 2006; M?h?nen et al. 2006; Nishimura et al. 2004) displayed an extremely stunted primary 
root phenotype. Roots of these mutants had fewer vascular cell files with abnormal development, 
resulting in a root with only protoxylem. This strongly suggests that cytokinin plays a role in 
vascular initial cell differentiation. Overexpression of ARR22 also led to a similar root 
phenotype, but the role of this type-C RR in the root vascular process could not be determined 
(Kiba et al. 2004). These findings reflect the positive role of cytokinin in normal root vascular 
development. 
        A variety of transgenic lines with altered cytokinin levels have revealed a negative role for 
cytokinin in lateral root formation (Lohar et al. 2004; Mason et al. 2005; Riefler et al. 2006; To et 
al. 2004; Werner et al. 2001, 2003). Exogenous application of cytokinin has also been shown to 
inhibit lateral root formation (Kuderova et al. 2008; Laplaze et al. 2007; Li et al. 2006). Detailed 
studies revealed that cytokinin specifically affects the pericycle cell (anticlinal) divisions in the 
lateral root founder cells (Li et al. 2006; Laplaze et al. 2007); however, later developmental stages 
are not affected. This indicates that the role of cytokinin in lateral root development may be 
restricted to the stages of initiation. AHK receptor mutants have also been shown to have 
enhanced emergence of lateral roots (Dello Ioio et al. 2007, 2008; Li et al. 2006; Nishimura et al. 
2004; Riefler et al. 2006) indicating that cytokinin inhibits lateral root formation, although the 
requirement for a basal level of cytokinin in this process cannot be ruled out. Other hormones 
such as auxin and ethylene have also been suggested to regulate lateral root development through 
their respective pathways or interactions with cytokinin (Aloni et al. 2006; Laplaze et al. 2007; 
Kuderova et al. 2008). Recently, interactions between cytokinin and auxin have been shown to 
regulate lateral root organogenesis where cytokinin reduces the amount of PIN1 at the plasma 
 
50 
 
membrane indicating that auxin is required in a particular concentration to promote this 
organogenesis (Marhav? et al. 2011). 
        In leguminous plants, cytokinin has been observed to play a role in root nodulation. 
Transgenic plants with either reduced cytokinin level by overexpressing CYTOKININ OXIDASE 
(CKX) genes or reduced perception by mutating cytokinin receptor genes resulted in decreased 
numbers or absence of nodulation in Lotus japonicus and Medicago truncatula plants (Lohar et al. 
2004; Gonzalez-Rizzo et al. 2006; Murray et al. 2007). Additionally, at least one RR, a type-A, 
has also been linked to root nodulation in Medicago in connection with an ethylene response 
factor and the reduction of cytokinin levels (Verni? et al. 2008). Moreover, cytokinin was shown 
to have opposite effects on nodulation and in lateral root formation, as the plants with reduced 
cytokinin levels and reduced nodulation developed more lateral roots (Lohar et al. 2004; 
Gonzalez-Rizzo et al. 2006). From the number of other downstream TCS components that are 
actively expressed and directly affect other important root functions, it seems likely that more 
RRs and possibly CRFs may be critical players in this process. More studies directed towards this 
may help determine cytokinin role here and help to develop better varieties of leguminous 
species. 
Shoot development: the shoot apical meristem and beyond 
        Skoog and Miller 1957, originally demonstrated that a high cytokinin to auxin ratio 
promotes shoot formation from callus. Since then continued work in this area, especially over the 
last decade has led to the finding that cytokinin has a positive role in regulating SAM size and 
activity (Higuchi et al. 2004; Tucker and Laux 2007; Werner et al. 2001, 2003; Werner and 
Schm?lling 2009). In agreement, studies of ahk triple receptor mutant also displayed decreased 
SAM activity and as a result a much smaller SAM size with fewer cell layers and fewer cells per 
layer (Higuchi et al. 2004). Moreover, studies of IPT mutants further strengthened the positive 
role of cytokinin in the SAM development where ipt1, 3, 5, 7 quadruple mutants and the ipt1, 3, 
5, 6, 7 quintuple mutants appeared to havereduced SAM size (Miyawaki et al. 2006). 
 
51 
 
        Several transcription factors have been observed to have a role in the normal SAM function, 
such as STIMPY (STIP/WOX9) and WUSCHEL (WUS) required for the establishment of both 
root and shoot meristematic tissue (Wu et al. 2005). STIP was observed to have reduced 
expression in the SAM of ahk and type-B arr mutants, indicating its expression is dependent on 
cytokinin (Skylar et al. 2010). Another TF, SHOOT MERISTEMLESS (STM), a class I 
KNOTTED1-like homeobox is expressed in the central zone (CZ) and peripheral zone (PZ) of the 
SAM, where it functions to maintain cell division and prevention of cell differentiation. In 
Arabidopsis, STM and cytokinin are positive regulators of each other (Fig. 5), where STM 
regulates cytokinin levels via activation of IPT7 indicating that cytokinin is required in the SAM 
for the maintenance of cell division and prevention of cell differentiation (Jasinski et al. 2005; 
Rupp et al. 1999; Sablowski 2007; Yanai et al. 2005). Other TF families also regulate STM 
expression in the SAM, such as the CUP-SHAPED COTYLEDONS (CUC) family involved in 
positive regulation and ASYMMETRIC EAVES2/LATERAL ORGAN BOUNDARIES 
(AS2/LOB) involved in negative regulation (Semiarti et al. 2001). CUC2 and CUC3 genes are 
themselves regulated by cytokinin in the inflorescence meristem indicating positive feedback 
regulation in the SAM during its development (Li et al. 2010). LONELY GUY (LOG), which 
was identified in rice is confined to the shoot apical regions and regulates cytokinin levels by the 
conversion of inactive cytokinin nucleotides to active free bases. The log mutants also have 
SAMs that are defective in size and activity (Kurakawa et al. 2007) further confirming the role of 
cytokinin in the SAM development. 
        Effects of cytokinin in shoot development through type-A RRs have been observed in 
several plant species including rice where OsRR6 overexpression resulted in complete meristem 
arrest (Hirose et al. 2007). Effects have also been seen in the alteration of phyllotaxy and shoot 
organ initiation in both the maize type-A RR mutant abphyl1 (ABERRANT PHYLLOTAXY1) 
(Giulini et al. 2004; Jackson and Hake. 1999) and in the Arabidopsis septuple  type-A ARR 
mutant, arr3, 4, 5, 6, 7, 8 and 9 (Leibfried et al. 2005). Additionally, it has been shown that WUS, 
 
52 
 
which is required to keep SAM stem cells in an undifferentiated state (Laux et al. 1996; Mayer et 
al. 1998), is involved in doing so by repressing the expression of several type-A ARRs (Leibfried 
et al. 2005). Likewise, it has been shown through live imaging in the SAM central zone that 
cytokinin up-regulates WUS expression (Gordon et al. 2009; Lindsay et al. 2006) possibly for its 
own maintenance in the SAM. Consistent with this finding, it was observed that WUS positively 
regulates AHK4 expression and cytokinin abundance and negatively affects the expression of 
type-A ARRs, ARR5, ARR7 and ARR15 (Gordon et al. 2009). In addition to cytokinin and 
WUS, auxin also negatively regulates the expression of two type-A ARRs: ARR7 and ARR15 
(Zhao et al. 2010) via the auxin response factor MONOPTEROS (MP) (Fig. 5). Cytokinin-auxin 
interactions have also been shown to be necessary for shoot apex growth as demonstrated in 
Pisum sativum where PIN mediated flow of auxin basipetally from the shoot apex repressed IPT 
expression. The reduced level of cytokinin in this system results in increased shoot apical 
dominance and inhibition of axillary bud formation (Shimizu-Sato et al. 2009). 
Leaf development: from expansion to senescence 
        Findings that cytokinin plays an important role in leaf development date back to the 1950s 
when it was first shown that kinetin promoted the expansion of excised leaves (Kuraishi and 
Okumura 1956). Increases in leaf expansion after treatment with cytokinin has also been observed 
in isolated leaf discs of sweet pepper (Capsicum annuum) (Nielsen and Ulvskov 1992). In 
tobacco, it was seen that growth under a high gibberellic acid (GA) to cytokinin ratio resulted in 
narrow leaves, whereas a low ratio produced rounded leaves, further supporting a role of 
cytokinin in leaf development (Engelke et al. 1973). Examination of the spatial distribution of 
endogenous cytokinins in pepper leaves revealed that the distribution in young/maturing leaves 
decreased from the base to tip and was very different from fully matured leaves that had an 
almost uniform distribution (Ulvskov et al. 1992). A similar finding was observed over a 
temporal distribution with the highest levels of endogenous cytokinin occurring during 
leaf expansion compared to other stages of development (Ron?zhina 2003). 
 
53 
 
        Cytokinin receptors have also been utilized to link cytokinin to leaf developmental 
processes. The study of different combinations of ahk multiple mutants showed that an ahk2, 3 
double mutant had smaller leaves, while ahk single mutants and ahk2, 4 and ahk3, 4 double 
mutants showed no morphological differences from wild type. The greatest effect was seen by 
completely eliminating cytokinin signaling in the triple receptor mutant ahk2, 3, 4 that showed 
defective growth and reduced leaf size and number, due to reduced cell numbers and size 
(Higuchi et al. 2004; Nishimura et al. 2004). One additional cytokinin regulated group that has 
been linked to leaf and cotyledon development in mutant studies is the CRFs where altered shape 
was found in these organs (Rashotte et al. 2006). 
        Cytokinin is also involved in compound leaf development in tomato. This was found by 
altering cytokinin levels in tomato through the expression of either the cytokinin biosynthesis 
gene IPT7 or the cytokinin degradation gene CKX3 (Shani et al. 2010). IPT7 expression in 
normally compound tomato leaves resulted in increased cytokinin levels and the production of 
super-compound leaves with up to four orders of leaflet complexity compared to wild-type plants 
with two orders of leaflets. In contrast, CKX3 expression resulted in low cytokinin levels and 
production of simplified leaves with only primary leaflets. Several additional studies of KNOX1 
proteins, which have been linked to cytokinin, showed that these proteins are involved in the 
regulation of compound leaf development (Hareven et al. 1996; Janssen et al. 1998; Jasinski et al. 
2005; Hay and Tsiantis 2006; Shani et al. 2009, 2010; Yanai et al. 2005). KNOX1 genes were 
found to be expressed in the SAM of simple-leaved species (maize, rice, tobacco, Arabidopsis) 
and their expression is down-regulated after leaf initiation starts (Vollbrecht et al. 1991; Lincoln 
et al. 1994; Nishimura et al. 1999; Waites et al. 1998). In contrast, in tomato compound leaves, 
KNOX1 genes show up-regulation in leaf primordia and as the leaf matures, expression is down-
regulated (Hareven et al. 1996; Chen et al. 1997; Janssen et al. 1998). Relation between cytokinin 
and KNOX1 proteins was shown in tomato where cytokinin was observed to act downstream of 
KNOX1 proteins hence regulating compound leaf development (Shani et al. 2010). Cytokinin 
 
54 
 
was also shown to suppress the effect of GA (Fleishon et al. 2011) which otherwise results in less 
complex and non-serrated leaves in tomato (Hay et al. 2002) indicating the interaction between 
cytokinin and other hormones in compound leaf development. 
        Leaf senescence is another important area where cytokinin is involved. It was shown that 
leaf senescence could be manipulated by changing endogenous cytokinin levels (Smart et al. 
1991) or delayed by external application of cytokinin to the leaves (Mok and Mok 1994). 
Involvement of cytokinin in delayed senescence was further strengthened by the expression of 
IPT driven by a senescence-specific promoter resulting in a later onset of senescence (Gan and 
Amasino 1995). Attempts to find how TCS components are involved in the process led to the 
discovery that AHK3 could be the primary cytokinin receptor regulating leaf senescence. AHK3 
gain-of-function mutants and overexpression lines were found to delay dark-induced leaf 
senescence and reduce expression of senescence associated genes, while loss-of-function ahk3 
mutants were found to senesce early (Kim et al. 2006). Overexpression of type-B ARR2 also 
displays delayed leaf senescence. ARR2 has since been found to be phosphorylated by only 
AHK3 among the three cytokinin receptors, suggesting the initial pathway for cytokinin regulated 
leaf senescence. 
        Cytokinins may also have a role in controlling chloroplast numbers in the cell. It was 
observed in Arabidopsis that CRF2 overexpression results in accelerated division of chloroplasts 
and increased expression of PLASTID DIVISION 2 (PVD2), that is required for plastid division 
(Okazaki et al. 2009). This indicates that cytokinin regulation of CRF2 may increase plastid 
division. Moreover, wild-type Arabidopsis seeds germinated on cytokinin containing medium 
have increased levels of PVD2. Additionally, it was observed that exogenous cytokinin treatment 
induces the transcription of 19 out of 26 tested genes responsible for plastid regulation (Zubo et 
al. 2009) further strengthening the possibility of cytokinin regulation of plastid development. 
Reproductive organ development  
 
55 
 
        Cytokinin has a positive role in reproductive organ development. In Arabidopsis, it has been 
seen that cytokinin levels increase in the SAM after transition to flowering (Corbesier et al. 
2003). TCS components have also been utilized to study the role of cytokinin in reproductive 
organ development. The ahk2, 3, 4 triple mutant as well as plants defective in multiple other TCS 
components often have sterile or delayed floral transition phenotypes (Higuchi et al. 2004; 
Nishimura et al. 2004; Werner et al. 2003). Subsequent work manipulating cytokinin levels via 
the Os-CKX2 gene in rice (Ashikari et al. 2005) and CKX3 and CKX5 genes in Arabidopsis 
(Bartrina et al. 2011) unveiled the positive role of cytokinin in reproductive organ development. 
Reduced expression of Os-CKX2 led to an increased amount of cytokinin in the inflorescence 
meristem that yielded an increased number of reproductive organs. Arabidopsis ckx3,5 double 
mutant, with approximately fourfold WT cytokinin levels, also produced larger inflorescences 
and floral meristems, larger sized flowers, that had supernumerary ovules producing increased 
seed yield. Although this evidence implicates cytokinin in reproductive development more work 
still needs to be done to understand its full role in this complex process. 
Concluding remarks  
        Based on the findings reviewed here, we can clearly say that cytokinin plays multiple vital 
roles in plant growth over the course of development. Many of these roles are linked to the 
cytokinin-signaling pathway, particularly the downstream components known as the Response 
Regulators (RR). In addition to these roles, there is complex regulation of RR in feedback loops 
between members of this group, type-A RRs and type-B RRs, as well as with other TFs and 
hormones such as auxin. Although, we are beginning to understand the role of cytokinin and the 
TCS in hormone cross-talk that controls developmental processes, more studies are still needed to 
make these links clearer. 
 
 
 
 
 
 
56 
 
Literature Cited 
 
Aloni R, Aloni E, Langhans M, Ullrich CI (2006) Role of cytokinin and auxin in shaping root 
architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and 
root gravitropism. Ann Bot 97:883?893 
 
Argyros RD, Mathews DE, Chiang YH, Palmer CM, Thibault DM, Etheridge N, Argyros DA, 
Mason MG, Kieber JJ, Schaller GE (2008) Type B response regulators of Arabidopsis play key 
roles in cytokinin signaling and plant development. Plant Cell 20:2102?2116 
 
Asakura Y, Hagino T, Ohta Y, Aoki K, Yonekura-Sakakibara K, Deji A, Yamaya T, Sugiyama T, 
Sakakibara H (2003) Molecular characterization of His-Asp phosphorelay signalling factors in 
maize leaves: implications of the signal divergence by cytokinin inducible response regulators in 
the cytosol and the nuclei. Plant Mol Biol 52:331?341 
 
Ashikari M, Sakakibara H, Lin SY, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, 
Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 
309:741?745 
 
Bartrina I, Otto E, Strnad M, Werner T, Schmulling T (2011) Cytokinin regulates the activity of 
reproductive meristems, flower organ size, ovule formation, and thus seed yield in Arabidopsis 
thaliana. Plant Cell 23:69?80 
 
Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN (2003) A 
gene expression map of the Arabidopsis root. Science 302:1956?1960 
 
Brandstatter I, Kieber JJ (1998) Two genes with similarity to bacterial response regulators are 
rapidly and specifically induced by cytokinin in Arabidopsis. Plant Cell 10:1009?1020 
 
Chen JJ, Janssen BJ, Williams A, Sinha N (1997) A gene fusion at a homeobox locus: 
alternations in leaf shape and implications for morphological evolution. Plant Cell 9:1289?1304 
 
Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The cytokinin-activated 
transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid 
signaling in Arabidopsis. Dev Cell 19:284?295 
 
Corbesier L, Prinsen E, Jacqmard A, Lejeune P, Van Onckelen H, P?rilleux C, Bernier G (2003) 
Cytokinin levels in leaves, leaf exudate and shoot apical meristem of Arabidopsis thaliana during 
floral transition. J Exp Bot 54:2511?2517 
 
Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM (2011) CRFs form protein?protein interactions 
among each other and with members of the cytokinin-signaling pathway in Arabidopsis via the 
CRF domain. J Exp Bot 62:4995?5002 
 
D?Agostino IB, Deru?re J, Kieber JJ (2000) Characterization of the response of the Arabidopsis 
response regulator gene family to cytokinin. Plant Physiol 124:1706?1717 
 
de LeonBG,Zorrilla JM, RubioV,Dahiya P, Paz-Ares J,LeyvaA(2004) Interallelic 
complementation at the Arabidopsis CRE1 locus uncovers independent pathways for the 
proliferation of vascular initials and canonical cytokinin signalling. Plant J 38:70?79 
 
 
57 
 
Dello Ioio R, Linhares FS, Scacchi E, Casamitjana-Martinez E, Heidstra R, Costantino P, 
Sabatini S (2007) Cytokinins determine Arabidopsis root-meristem size by controlling cell 
differentiation. Curr Biol 17:678?682 
 
Dello Ioio R, Nakamura K, Moubayidin L, Perilli S, Taniguchi M, Morita MT, Aoyama T, 
Costantino P, Sabatini S (2008) A genetic framework for the control of cell division and 
differentiation in the root meristem. Science 322:1380?1384 
 
Engelke AL, Hamzi HQ, Skoog F (1973) Cytokinin-gibberellin regulation of shoot development 
and leaf form in tobacco plantlets. Am J Bot 60:491?495 
 
Ferreira FJ, Kieber JJ (2005) Cytokinin signaling. Curr Opin Plant Biol 8:518?525 
 
Fleishon S, Shani E, Ori N, Weiss D (2011) Negative reciprocal interactions between gibberellin 
and cytokinin in tomato. New Phytol 190:609?617 
 
Friml J, Vieten A, Sauer M, Weijers D, Schwarz H, Hamann T, Offringa R, J?rgens G (2003) 
Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis. Nature 426:147?
153 
 
Gan S, Amasino RM (1995) Inhibition of leaf senescence by autoregulated production of 
cytokinin. Science 270:1986?1988 
 
Gattolin S, Alandete-Saez M, Elliott K, Gonzalez-Carranza Z, Naomab E, Powell C, Roberts JA 
(2006) Spatial and temporal expression of the response regulators ARR22 and ARR24 in 
Arabidopsis thaliana. J Exp Bot 57:4225?4233 
 
Giulini A, Wang J, Jackson D (2004) Control of phyllotaxy by the cytokinin-inducible response 
regulator homologue Abphyl1. Nature 430:1031?1034 
 
Gonzalez-Rizzo S, Crespi M, Frugier F (2006) The medicago truncatula CRE1 cytokinin receptor 
regulates lateral root development and early symbiotic interaction with Sinorhizobium meliloti. 
Plant Cell 18:2680?2693 
 
Gordon SP, Chickarmane VS, Ohno C, Meyerowitz EM (2009) Multiple feedback loops through 
cytokinin signaling control stem cell number within the Arabidopsis shoot meristem. Proc Natl 
Acad Sci USA 106:16529?16534 
 
Hareven D, Gutfinger T, Parnis A, Eshed Y, Lifschitz E (1996) The making of a compound leaf: 
genetic manipulation of leaf architecture in tomato. Cell 84:735?744 
 
Hass C, Lohrmann J, Albrecht V, Sweere U, Hummel F, Yoo SD, Hwang I, Zhu T, Sch?fer E, 
Kudla J (2004) The response regulator 2 mediates ethylene signalling and hormone signal 
integration in Arabidopsis. EMBO J 23:3290?3302 
 
Hay A, Tsiantis M (2006) The genetic basis for differences in leaf form between Arabidopsis 
thaliana and its wild relative Cardamine hirsuta. Nat Genet 38:942?947 
 
Hay A, Kaur H, Phillips A, Hedden P, Hake S, Miltos T (2002) The gibberellin pathway mediates 
knotted1-type homeobox function in plants with different body plans. Current Biol 12:1557?1565 
 
 
58 
 
Heyl A, Schm?lling T (2003) Cytokinin signal perception and transduction. Curr Opin Plant Biol 
6:480?488 
 
Higuchi M, Pischke MS, M?h?nen AP, Miyawaki K, Hashimoto Y, Seki M, Kobayashi M, 
Shinozaki K, Kato T, Tabata S, Helariutta Y, Sussman MR, Kakimoto T (2004) In planta 
functions of the Arabidopsis cytokinin receptor family. Proc Natl Acad Sci USA 101:8821?8826 
 
Hirose N, Makita N, Kojima M, Kamada-Nobusada T, Sakakibara H (2007) Overexpression of a 
type-A response regulator alters rice morphology and cytokinin metabolism. Plant Cell Physiol 
48:523?539 
 
Hosoda K, Imamura A, Katoh E, Hatta T, Tachiki M, Yamada H, Mizuno T, Yamazaki T (2002) 
Molecular structure of the GARP family of plant Myb-related DNA binding motifs of the 
Arabidopsis response regulators. Plant Cell 14:2015?2029 
 
Hutchison CE, Li J, Argueso C, Gonzalez M, Lee E, Lewis MW, Maxwell BB, Perdue TD, 
Schaller GE, Alonso JM, Ecker JR, 
 
Kieber JJ (2006) The Arabidopsis histidine phosphotransfer proteins are redundant positive 
regulators of cytokinin signaling. Plant Cell 18:3073?3087 
 
Hwang I, Sheen J (2001) Two-component circuitry in Arabidopsis signal transduction. Nature 
413:383?389 
 
Hwang I, Chen HC, Sheen J (2002) Two-component signal transduction pathways in 
Arabidopsis. Plant Physiol 129:500?515 
 
Imamura A, Hanaki N, Umeda H, Nakamura A, Suzuki T, Ueguchi C, Mizuno T (1998) 
Response regulators implicated in his-to-asp phosphotransfer signaling in Arabidopsis. Proc Natl 
Acad Sci USA 95:2691?2696 
 
Imamura A, Hanaki N, Nakamura A, Suzuki T, Taniguchi M, Kiba T, Ueguchi C, Sugiyama T, 
Mizuno T (1999) Compilation and characterization of Arabidopsis response regulators implicated 
in His-Asp phosphorelay signal transduction. Plant Cell Physiol 40:733?742 
 
Imamura A, Yoshino Y, Mizuno T (2001) Cellular localization of the signaling components of 
Arabidopsis His-to-Asp phosphorelay. Biosci Biotechnol Biochem 65:2113?2117 
 
Imamura A, Kiba T, Tajima Y, Yamashino T, Mizuno T (2003) In vivo and in vitro 
characterization of the ARR11 response regulator implicated in the His-to-Asp phosphorelay 
signal transduction in Arabidopsis thaliana. Plant Cell Physiol 44:122?131 
 
Ishida K, Yamashino T, Yokoyama A, Mizuno T (2008) Three type-B response regulators, 
ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction 
throughout the life cycle of Arabidopsis thaliana. Plant Cell Physiol 49:47?57 
 
Jackson D, Hake S (1999) Control of phyllotaxy in maize by the abphyl1 gene. Development 
126:315?323 
 
Jain M, Tyagi AK, Khurana JP (2006) Molecular characterization and differential expression of 
cytokinin-responsive type-A response regulators in rice (Oryza sativa). BMC Plant Biol 6:1 
 
59 
 
 
Janssen B, Lund L, Sinha N (1998) Overexpression of a homeobox gene, LeT6, reveals 
indeterminate features in the tomato compound leaf. Plant Physiol 117:771?786 
 
Jasinski S, Piazza P, Craft J, Hay A, Woolley L, Rieu I, Phillips A, Hedden P, Tsiantis M (2005) 
KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin 
activities. Curr Biol 15:1560?1565 
 
Kakimoto T (2003) Perception and signal transduction of cytokinins. Annu Rev Plant Biol 
54:605?627 
 
Kiba T, Taniguchi M, Imamura A, Ueguchi C, Mizuno T, Sugiyama T (1999) Differential 
expression of genes for response regulators in response to cytokinins and nitrate in Arabidopsis 
thaliana. Plant Cell Physiol 40:767?771 
 
Kiba T, Yamada H, Mizuno T (2002) Characterization of the ARR15 and ARR16 response 
regulators with special reference to the cytokinin signaling pathway mediated by the AHK4 
histidine kinase in roots of Arabidopsis thaliana. Plant Cell Physiol 43:1059?1066 
 
Kiba T, Aoki K, Sakakibara H, Mizuno T (2004) Arabidopsis response regulator, ARR22, ectopic 
expression of which results in phenotypes similar to the wol cytokinin- receptor mutant. Plant 
Cell Physiol 45:1063?1077 
 
Kim HJ, Ryu H, Hong SH, Woo HR, Lim PO, Lee IC, Sheen J (2006) Cytokinin-mediated 
control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. Proc Natl 
Acad Sci USA 103:814?819 
 
Kuderova A, Urbankova I, Valkova M, Malbeck J, Brzobohaty B, Nemethova D, Hejatko J 
(2008) Effects of conditional IPTdependent cytokinin overproduction on root architecture of 
Arabidopsis seedlings. Plant Cell Physiol 49:570?582 
 
Kuraishi S, Okumura S (1956) The effect of kinetin on leaf growth. Bot Mag (Tokyo) 69:300?
306 
 
Kurakawa T, Ueda N, Maekawa M, Kobayashi K, Kojima M, Nagato Y, Sakakibara H, Kyozuka 
J (2007) Direct control of shoot meristem activity by a cytokinin-activating enzyme. Nature 
445:652?655 
 
Laplaze L, Benkova E, Casimiro I, Maes L, Vanneste S, Swarup R, Weijers D, Calvo V, Parizot 
B, Herrera-Rodriguez MB, Offringa R, Graham N, Doumas P, Friml J, Bogusz D, Beeckman T, 
Bennett M (2007) Cytokinins act directly on lateral root founder cells to inhibit root initiation. 
Plant Cell 19:3889?3900 
 
Laux T, Mayer KF, Berger J, J?rgens G (1996) The wuschel gene is required for shoot and floral 
meristem integrity in Arabidopsis. Development 122:87?96 
 
Lee DJ, Park JY, Ku SJ, Ha YM, Kim S, Kim MD, Oh MH, Kim J (2007) Genome-wide 
expression profiling of Arabidopsis response regulator (ARR7) overexpression in cytokinin 
response. Mol Genet Genomics 277:115?137 
 
 
60 
 
Lee DJ, Kim S, Ha YM, Kim J (2008) Phosphorylation of Arabidopsis response regulator 7 
(ARR7) at the putative phospho-accepting site is required for ARR7 to act as a negative regulator 
of cytokinin signaling. Planta 227:577?587 
 
Leibfried A, To JPC, Busch W, Stehling S, Kehle A, Demar M, Kieber JJ, Lohmann JU (2005) 
Wuschel controls meristem function by direct regulation of cytokinin-inducible response 
regulators. Nature 438:1172?1175 
 
Li X, Mo X, Shou H, Wu P (2006) Cytokinin-mediated cell cycling arrest of pericycle founder 
cells in lateral root initiation of Arabidopsis. Plant Cell Physiol 47:1112?1123 
 
Li XG, Su YH, Zhao XY, Li W, Gao XQ, Zhang XS (2010) Cytokinin overproduction-caused 
alteration of flower development is partially mediated by CUC2 and CUC3 in Arabidopsis. Gene 
450:109?120 
 
Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted1-like homeobox gene in 
Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology 
when overexpressed in transgenic plants. Plant Cell 6:1859?1876 
 
Lindsay DL, Sawhney VK, Bonham-Smith PC (2006) Cytokinin induced changes in clavata1 and 
wuschel expression temporally coincide with altered floral development in Arabidopsis. Plant 
Sci 170:1111?1117 
 
Lohar DP, Schaff JE, Laskey JG, Kieber JJ, Bilyeu KD, Bird DM (2004) Cytokinins play 
opposite roles in lateral root formation, and nematode and rhizobial symbioses. Plant J 38:203?
214 
 
Lohrmann J, Buchholz G, Keitel C, Sweere U, Kircher S, B?urle I, Kudla J, Sch?fer E, Harter K 
(1999) Differential expression and nuclear localization of response regulator like proteins from 
Arabidopsis thaliana. Plant Biol 1:495?505 
 
Lohrmann J, Sweere U, Zabaleta E, B?urle I, Keitel C, Kozma-Bognar L, Brennicke A, Sch?fer 
E, Kudla J, Harter K (2001) The response regulator ARR2: a pollen specific transcription factor 
involved in the expression of nuclear-encoded mitochondrial complex I genes. Mol Genet 
Genomics 265:2?13 
 
M?h?nen AP, Bonke M, Kauppinen L, Riikonen M, Benfey PN, Helariutta Y (2000) A novel 
two-component hybrid molecule regulates vascular morphogenesis of the Arabidopsis root. 
Genes Dev 14:2938?2943? 
 
M?h?nen AP, Bishopp A, Higuchi M, Nieminen KM, Ki-noshita K, T?rm?kangas K, Ikeda Y, 
Oka A, Kakimoto T, Helariutta Y (2006) Cytokinin signaling and its inhibitor AHP6 regulate cell 
fate during vascular development. Science 311:94?98 
 
Makino S, Kiba T, Imamura A, Hanaki N, Nakamura A, Suzuki T, Taniguchi M, Ueguchi C, 
Sugiyama T, Mizuno T (2000) Genes encoding pseudo-response regulators: insight into His-to-
Asp phosphorelay and circadian rhythm in Arabidopsis thaliana. Plant Cell Physiol 41:791?803 
 
Marhav? P, Bielach A, Abas L, Abuzeineh A, Duclercq J, Tanaka H, Par?ezova? M, Petra?s?ek J, 
Friml J, Kleine-Vehn J, Benkova? E (2011) Cytokinin modulates endocytic trafficking of pin1 
auxin efflux carrier to control plant organogenesis. Dev Cell 21:796?804 
 
61 
 
 
Mason MG, Li J, Mathews DE, Kieber JJ, Schaller GE (2004) Type-B response regulators 
display overlapping expression patterns in Arabidopsis. Plant Physiol 135:927?937 
 
Mason MG, Mathews DE, Argyros DA, Maxwell BB, Kieber JJ, Alonso JM, Ecker JR, Schaller 
GE (2005) Multiple type-B response regulators mediate cytokinin signal transduction in 
Arabidopsis. Plant Cell 17:3007?3018 
 
Matsushika A, Makino S, Kojima M, Mizuno T (2000) Circadian waves of expression of the 
PRR1/TOC1 family of pseudo response regulators in Arabidopsis thaliana: insight into the plant 
circadian clock. Plant Cell Physiol 41:1002?1012 
 
Maxwell BB, Kieber JJ (2005) Cytokinin signal transduction. In:Davies PJ (ed) Plant hormones: 
biosynthesis, signal transduction, action!, vol 18. Kluwer, Dordrecht, pp 321?349 
 
Mayer KF, Schoof H, Haecker A, Lenhard M, J?rgens G, Laux T (1998) Role of wuschel in 
regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95:805?815 
 
Miller CO, Skoog F, Von Saltza MH, Strong F (1955) Kinetin, a cell division factor from 
eoxyribonucleic acid. J Am Chem Soc 77:1392 
 
Miyawaki K, Tarkowski P, Matsumoto-Kitano M, Kato T, Sato S, Tarkowska D, Tabata S, 
Sandberg G, Kakimoto T (2006) Roles of Arabidopsis ATP/ADP isopentenyltransferases and 
tRNA isopentenyltransferases in cytokinin biosynthesis. Proc Natl Acad Sci USA 103:16598?
16603 
 
Mizuno T, Nakamichi N (2005) Pseudo-response regulators (prrs) or true oscillator components 
(tocs). Plant Cell Physiol 46:677?685 
 
Mockaitis K, EstelleM(2008) Auxin receptors and plant development: a new signaling paradigm. 
Annu Rev Cell Dev Biol 24:55?80 
 
Mok DWS, Mok MC (1994) Cytokinins: chemistry, activity and function, CRC Press, pp 155?
166 
 
M?ller B (2011) Generic signal-specific responses: cytokinin and context-dependent cellular 
responses. J Exp Bot 62:3273?3288 
 
M?llerB, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification during 
early embryogenesis. Nature 453:1094?1097 
 
Murray JD, Karas BJ, Sato S, Tabata S, Amyot L, Szczyglowski K (2007) A cytokinin perception 
mutant colonized by rhizobium in the absence of nodule organogenesis. Science 315:101?104 
 
Nielsen TH, Ulvskov P (1992) Cytokinins and leaf development in sweet pepper (Capsicum 
annuum L.) II sink metabolism in relation to cytokinin-promoted leaf expansion. Planta 188:78?
84 
 
Nishimura A, Tamaoki M, Sato Y, Matsuoka M (1999) The expression of tobacco knotted1-type 
class 1 homeobox genes correspond to regions predicted by the cytohistological zonation model. 
Plant J 18:337?347 
 
62 
 
 
Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C (2004) Histidine kinase homologs 
that act as cytokinin receptors possess overlapping functions in the regulation of shoot and root 
growth in Arabidopsis. Plant Cell 16:1365?1377 
 
Okazaki K, Kabeya Y, Suzuki K, Mori T, Ichikawa T, Matsui M, Nakanishi H, Miyagishima S 
(2009) The plastid division1 and 2 components of the chloroplast division machinery determine 
the rate of chloroplast division in land plant differentiation. Plant Cell 21:1769?1780 
 
Putterill J, Robson F, Lee K, Simon R, Coupland G (1995) The constans gene of Arabidopsis 
promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. 
Cell 80:847?857 
 
Rashotte AM, Goertzen LR (2010) The CRF domain defines cytokinin response factor proteins in 
plants. BMC Plant Bio 10:74  
 
Rashotte AM, Carson SD, To JPC, Kieber JJ (2003) Expression profiling of cytokinin action in 
Arabidopsis. Plant Physiol 132:1998?2011 
 
Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ (2006) A subset of 
Arabidopsis AP2 transcription factors mediates cytokinin responses in concert with a two 
component pathway. Proc Natl Acad Sci USA 103:11081?11085 
 
Ren B, Liang Y, Deng Y, Chen Q, Zhang J, Yang X, Zuo J (2009) Genome-wide comparative 
analysis of type-A Arabidopsis response regulator genes by overexpression studies reveals their 
diverse roles and regulatory mechanisms in cytokinin signaling. Cell Research 19:1178?1190 
 
Riefler M, Novak O, Strnad M, Schmulling T (2006) Arabidopsis cytokinin receptor mutants 
reveal functions in shoot growth, leaf senescence, seed size, germination, root development, and 
cytokinin metabolism. Plant Cell 18:40?54 
 
Ron?zhina ES (2003) Cytokinin-regulated mesophyll cell division and expansion during 
development of Cucurbita pepo leaves. Russ J Plant Phys 50:646?655 
 
Rupp HM, Frank M, Werner T, Strnad M, Schm?lling T (1999) Increased steady state mRNA 
levels of the STM and KNAT1 homeobox genes in cytokinin overproducing Arabidopsis thaliana 
indicate a role for cytokinins in the shoot apical meristem. Plant J 18:557?563 
 
Sabatini S, Beis D, Wolkenfelt H, Murfett J, Guilfoyle T, Malamy J, Benfey P, Leyser O, 
Bechtold N, Weisbeek P, Scheres B (1999) An auxin-dependent distal organizer of pattern and 
polarity in the Arabidopsis root. Cell 99:463?472 
 
Sablowski R (2007) The dynamic plant stem cell niches. Curr Opin Plant Biol 10:639?644 
 
Sakai H, Aoyama T, Bono H, Oka A (1998) Two-component response regulators from 
Arabidopsis thaliana contain a putative DNAbinding motif. Plant Cell Physiol 39:1232?1239 
 
Sakai H, Aoyama T, Oka A (2000) Arabidopsis ARR1 and ARR2 response regulators operate as 
transcriptional activators. Plant J 24:703?711 
 
 
63 
 
Sakai H, Honma T, Aoyama T, Sato S, Kato T, Tabata S, Oka A (2001) ARR1, a transcription 
factor for genes immediately responsive to cytokinins. Science 294:1519?1521 
 
Sakakibara H, Hayakawa A, Deji A, Gawronski SW, Sugiyama T (1999) His-Asp 
phosphotransfer possibly involved in the nitrogen signal transduction mediated by cytokinin in 
maize: molecular cloning of cDNAs for two-component regulatory factors and demonstration of 
phosphotransfer activity in vitro. Plant Mol Biol 41:563?573 
 
Scheres B, Di Laurenzio L, Willemsen V, Hauser MT, Weisbeek P, Benfey PN (1995) Mutations 
affecting the radial organization of the Arabidopsis root display specific defects throughout the 
embryonic axis. Development 121:53?62 
 
Semiarti E, Ueno Y, Tsukaya H, Iwakawa H, Machida C, Machida Y (2001) The asymmetric 
leaves2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of 
venation and repression of meristem-related homeobox genes in leaves. Development 128:1771?
1783 
 
Shani E, Burko Y, Ben-Yaakov L, Berger Y, Amsellem Z, Goldshmidt A, Sharon E, Ori N 
(2009) Stage-specific regulation of Solanum lycopersicum leaf maturation by class 1 knotted1-
like homeobox proteins. Plant Cell 21:3078?3092 
 
Shani E, Ben-Gera H, Shleizer-Burko S, Burko Y, Weiss D, Ori N (2010) Cytokinin regulates 
compound leaf development in tomato. Plant Cell 22:3206?3217 
 
Shi X, Gupta S, Rashotte AM (2012) Solanum lycopersicum cytokinin response factors (SlCRFs) 
genes: characterization of crf domain containing genes in tomato. J Exp Bot 63:973?982 
 
Shimizu-Sato S, Tanaka M, Mori H (2009) Auxin?cytokinin interactions in the control of shoot 
branching. Plant Mol Biol 69:429?435 
 
Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissues 
cultured in vitro. Symp Soc Exp Biol 54:118?131 
 
Skylar A, Hong FX, Chory J, Weigel D, Wu XL (2010) STIMPY mediates cytokinin signaling 
during shoot meristem establishment in Arabidopsis seedlings. Development 137:541?549 
 
Smart CM, Scofield SR, Bevan MW, Dyer TA (1991) Delayed leaf senescence in tobacco plants 
transformed with tmr, a gene for cytokinin production in agrobacterium. Plant Cell 3:647?656 
 
Tajima Y, Imamura A, Kiba T, Amano Y, Yamashino T, Mizuno T (2004). Comparative studies 
on the type-B response regulators revealing their distinctive properties in the His-to-Asp 
phosphorelay signal transduction of Arabidopsis thaliana. Plant Cell Physiol 45: 28?39 
 
Taniguchi M, Kiba T, Sakakibara H, Ueguchi C, Mizuno T, Sugiyama T (1998) Expression of 
Arabidopsis response regulator homologs is induced by cytokinins and nitrate. FEBS Lett 
429:259?262 
 
Taniguchi M, Sasaki N, Tsuge T, Aoyama T, Oka A (2007) ARR1 directly activates cytokinin 
response genes that encode proteins with diverse regulatory functions. Plant Cell Physiol 48:263?
277 
 
 
64 
 
To JPC, Kieber JJ (2008) Cytokinin signaling: two-components and more. Trends Plant Sci 
13:85?92 
 
To JPC, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM, Ecker JR, 
Kieber JJ (2004) Type-A Arabidopsis response regulators are partially redundant negative 
regulators of cytokinin signaling. Plant Cell 16:658?671 
 
To JPC, Deruere J, Maxwell BB, Morris VF, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ 
(2007) Cytokinin regulates type-A Arabidopsis response regulator activity and protein stability 
via two-component phosphorelay. Plant Cell 19:3901?3914 
 
Tucker MR, Laux T (2007) Connecting the paths in plant stem cell regulation. Trends Cell Biol 
17:403?410 
 
Ulvskov O, Nielsen TH, Seiden P, Marcussen J (1992) Cytokinins and leaf development in sweet 
pepper (Capsicum annuum L.). I. Spatial distribution of endogenous cytokinins in relation to leaf 
growth. Planta 188:70?77 
 
Verni? T, Moreau S, de Billy F, Plet J, Combier J-P, Rogers C, Oldroyd G, Frugier F, Niebel A, 
Gamas P (2008) EFD is an ERF transcription factor involved in the control of nodule number and 
differentiation in medicago truncatula. Plant Cell 20:2696?2713 
 
Vollbrecht E, Veit B, Sinha N, Hake S (1991) The developmental gene Knotted-1 is a member of 
a maize homeobox gene family. Nature 350:241?243 
 
Waites R, Selvadurai HR, Oliver IR, Hudson A (1998) The PHANTASTICA gene encodes a 
MYB transcription factor involved in growth and dorsoventrality of lateral organs in antirrhinum. 
Cell 93:779?789 
 
Werner T, Schm?lling T (2009) Cytokinin action in plant development. Curr Opin Plant Biol 
12:527?538 
 
Werner T, Motyka V, Strnad M, Schm?lling T (2001) Regulation of plant growth by cytokinin. 
Proc Natl Acad Sci 98:10487?10492 
 
Werner T, Motyka V, Lancou L, Smets R, van Onckelen H, Schm?lling T (2003) Cytokinin-
deficient transgenic Arabidopsis plants show multiple developmental alterations indicating 
opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell 
15:2532?2550 
 
Wu XL, Dabi T, Weigel D (2005) Requirement of homeobox gene STIMPY/WOX9 for 
Arabidopsis meristem growth and maintenance. Curr Biol 15:436?440 
 
Yanai O, Shani E, Dolezal K, Tarkowski P, Sablowski R, Sandberg G, Samach A, Ori N (2005) 
Arabidopsis KNOXI proteins activate cytokinin biosynthesis. Curr Biol 15:1566?1571 
 
Yokoyama A, Yamashino T, Amano Y, Tajima Y, Imamura A, Sakakibara H, Mizuno T (2007) 
Type-B ARR transcription factors, ARR10 and ARR12, are implicated in cytokinin mediated 
regulation of protoxylem differentiation in roots of Arabidopsis thaliana. Plant Cell Physiol 
48:84?96 
 
 
65 
 
Zhang W, To JPC, Cheng CY, Schaller GE, Kieber JJ (2011) Type-A response regulators are 
required for proper root apical meristem function through post-transcriptional regulation of PIN 
auxin efflux carriers. Plant J 68:1?10 
 
Zhao Z, Andersen SU, Ljung K, Dolezal K, Miotk A, Schultheiss SJ, Lohmann JU (2010) 
Hormonal control of the shoot stem-cell niche. Nature 465:1089?1092 
 
Zubo YO, Yamburenko MV, Kravtsov AK, Kulaeva ON, Kusnetsov VV (2009) Detached barley 
leaves as a model for studying cytokinin control of plastid gene regulation. Russi J Plant Physiol 
56:551?559 
  
    
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
66 
 
                 
 
 
Fig. 3 Schematic representation of Response Regulators: type-A, type-B, type-C and Pseudo 
Response Regulator proteins showing their specific domain regions. Type-A and type-C ARRs 
have only Receiver domains, in pink, shown with conserved phosphorylated amino acid residues 
D, D, and K. Type-B ARRs have a receiver domain, a nuclear localization signal motif (NLS) and 
a C-terminal output domain, which contains a myb-like DNA binding and transactivating domain, 
GARP domain, in orange. The Pseudo Response Regulator proteins have the characteristic 
pseudo-receiver domain, in green, shown with its non-phosphorylated amino acid residue E and a 
C-terminal CCT-Motif 
 
 
 
 
 
67 
 
                                                
 
 
 Fig. 4 Interaction between cytokinin and auxin in the root apical meristem. Cytokinin and auxin 
interact through SHY2 at the signaling level to regulate the level of each other in the process of 
root apical meristem development. Arrows indicate positive regulation, line with blocks indicate 
negative regulation. Auxin negatively regulates SHY2 that in turn negatively regulates PIN 
proteins involved in the transport of auxin that determines this hormones concentration. 
Cytokinin positively regulates ARR1 that in turn positively regulates SHY2, which negatively 
regulates IPT proteins involved in cytokinin biosynthesis controlling these hormones? 
concentration 
 
 
 
 
 
68 
 
                                                
 
Fig. 5 Interaction between cytokinin and auxin in the shoot apical meristem. Shoot apical 
meristem development involves interactions among cytokinin signaling pathway components, 
auxin and different families of transcription factors as further described in the text 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
69 
 
 
 
 
 
 
Chapter IV. Solanum lycopersicum cytokinin response factor (SlCRF) genes: 
characterization of CRF domain-containing ERF genes in tomato 
 
Abstract  
        Cytokinin is an influential hormone in growth and developmental processes across many 
plant species. While several cytokinin regulated genes have been well characterized in 
Arabidopsis, few have been identified in tomato, Solanum lycopersicum. Here we identify and 
characterize a tomato family of 11 highly related Cytokinin Response Factor genes designated as 
SlCRF1 to 11 (Solanum lycopersicum Cytokinin Response Factors). SlCRFs are AP2/ERF 
transcription factors and generally orthologous to Arabidopsis CRF clade members (AtCRFs). 
Some SlCRF genes lack a direct Arabidopsis ortholog and one SlCRF has a unique protein 
domain arrangement not seen in any other CRF protein. Expression analysis of SlCRF1 to 11 
revealed differential patterns and levels across plant tissues examined (leaf, stem, root and 
flower). Several SlCRFs show induction by cytokinin to various degrees, similar to AtCRFs. 
Additionally we show that some SlCRFs can be regulated by other factors, including NaCl, 
ethylene, MeJA, and SA. Examination of SlCRF proteins in transient Agrobacteria infiltration 
experiments indicates they can be nuclear localized in planta. Using a BiFC (Split-YFP) system 
we also show that SlCRF proteins can interact to form homo and heterodimers. Overall this work 
indicates that some SlCRFs resemble previously identified CRFs in terms of structure, expression, 
and cytokinin regulation. However, SlCRFs have novel CRF protein forms and responses to 
abiotic factors suggesting they may have a diverse set of roles in stress and hormone regulation in 
tomato.  
 
 
70 
 
Introduction  
        Cytokinin is an essential plant hormone known to be involved in numerous plant growth and 
developmental processes (Mok and Mok 2001; Werner and Schm?lling, 2009). Over the last 
decade a model of cytokinin signaling in plants resembling bacterial two-component systems has 
become well-established (To and Kieber, 2008; Werner and Schm?lling, 2009). In this model, the 
binding of a sensor histidine kinase-like receptor to cytokinin initiates a multistep phosphorelay. 
Upon autophosphorylation, the receptor transfers the phosphoryl group to a histidine-containing 
phosphotransfer protein (HPt), which then transfers the phosphate to one of two types of response 
regulators (RR) localized in the nucleus. Type-B RR, transcription factors, then activate the 
expression of their target genes mediating cytokinin-regulated growth and developmental 
processes or other aspects of plant life, whereas type-A RR act as part of a feedback control loop 
to regulate this process (To and Kieber, 2008). 
        Recently the Cytokinin Response Factors (CRFs) were identified as several highly related 
AP2/ERF transcription factor genes induced by cytokinin from global expression analyses in 
Arabidopsis (Brenner et al., 2005; Hirose et al., 2007; Hoth et al., 2003; Kiba et al., 2005; 
Rashotte et al., 2003; 2006). CRFs appear to form a branch pathway of the cytokinin signaling 
pathway and may regulate downstream cytokinin targets independently or in conjunction with 
type-B response regulators (Rashotte et al., 2006; Werner and Schm?lling, 2009). CRFs form a 
unique group of ERF proteins containing a clade specific CRF domain that is always 
accompanied by an AP2/ERF DNA binding domain. Furthermore, CRF domain containing 
proteins are present in all land plants, but not in green algae indicating they may play important 
roles specific to land plants (Rashotte and Goertzen, 2010). Mutant analyses in Arabidopsis has 
implicated CRFs in the development of cotyledons, leaves, and embryos as indicated by reduced 
size of cotyledons of the crf1,2,5 triple mutant and the embryo-lethal phenotype of the crf5,6 
double mutant (Rashotte et al., 2006). In general, little is known of the function of CRFs outside 
of Arabidopsis and very few CRF genes from other species have been examined in any detail. 
 
71 
 
The genes that have been studied, PTI6/SlCRF1 and TSI1, are linked to processes other than 
cytokinin regulation including disease resistance and stress responses (Gu et al., 2002; Park et al., 
2001; Zhou et al., 1997). This study was conducted to completely identify and characterize all 
CRF genes in tomato Solanum lycopersicum, which we have designated as SlCRFs. Eleven 
SlCRF genes were identified through a combination of existing sequence comparison and RACE-
PCR. Once SlCRFs were identified, we examined their expression in different plant tissues, as 
well as regulation by cytokinin, salt, and other hormones. In addition, we determined the cellular 
localization of SlCRFs in planta and the ability of SlCRF proteins to form homo and heterodimers 
with each other. Together this study generates a first complete picture of all CRF genes in any 
species suggesting a broader function for CRF beyond cytokinin regulation and allowing 
functional parallels to be made between related clades of CRFs across species. 
Material and methods 
Plant materials and growth conditions  
        The tomato dwarf cultivar Micro-Tom was used for all experiments. Plants were grown in 
Sunshine Mix #8 soil under a 16:8 h light:dark photoperiod at 150 ?E, with a 26?C day(light), 
22?C night (dark) temperature. 
RNA isolation, cDNA synthesis, and expression analysis 
        Leaves, stems, flowers, and roots were harvested from 52 d old Micro-Tom plants, and 
immediately flash-frozen in liquid nitrogen. RNA was extracted using Qiagen RNeasy Kit 
according to the manufacturer?s instructions. 500 ng of the total RNA was used for each tissue 
type in the subsequent reverse transcription with Qiagen qScript cDNA supermix. The first strand 
of cDNA was diluted 10 or 20 times before it was used in the RT-PCR.  PCR conditions were 
initiated for 2 min at 95 ?C, followed by cycles of 30 sec at 94?C, a 30 sec annealing step, a 35 
extension at 72?C, and a 5 min final extension at 72 ?C. RT-PCR was conducted for SlCRF1-5, 
 
72 
 
11 and TIP41 over 29 cycles with a 56?C annealing temperature step and for SlCRF6-10 over 35 
cycles with a 54?C annealing temperature step. The SlCRF specific primers used in the RT-PCR 
are as follows: SlCRF1forward 5?-GGAAAATTCAGTTCCGGTGA-3? 
SlCRF1reverse 5?-AAAATTGGTAACGGCGTCAG-3? 
SlCRF2 forward 5?-TGCCGGTCCTAGAGTTGTAA-3? 
SlCRF2 reverse 5?-CAGTGGCTGCTCTGCTCTAT-3? 
SlCRF3 forward 5?-AATGATGCAGTCGAGGAACC-3? 
SlCRF3 reverse 5?-CCTGGTCTTCCCATTCTCAA-3? 
SlCRF4 forward5?-TGAATCCCTCTGTTCCAAGG-3? 
SlCRF4 reverse 5?-GTTTTGCCATTTCCACTGCT-3? 
SlCRF5 forward 5?-ACGATGACGACGAGAGGAAT-3? 
SlCRF5 reverse 5?-CTGACACCGCGAAACTTTTT-3? 
SlCRF6 forward 5?-GGTAATGGGAAGAAGCGAGTA-3? 
SlCRF6 reverse 5?- GAAGGAAACGTCTGTGGGTAAG-3? 
SlCRF7 forward 5?-GCTTCACGAAAATGAGGTTG-3? 
SlCRF7 reverse 5?- GGTTGATGGGGTCGATTTC-3? 
SlCRF8 forward 5?-CCACCAAGGATGAGCTAAAG-3? 
SlCRF8 reverse 5?- GTGGCACGGTGTTGATGG-3? 
SlCRF9 forward 5?- TGAGGAAATGGGGGAAATATG-3? 
SlCRF9 reverse 5?- TGTCATCAAAGCCTAGAAGTT-3? 
SlCRF10 forward 5?- TGATGATGAAGGGGT TGATGTA-3? 
SlCRF10 reverse 5?- TGCTGGAGATGTGTGTGAAGTA-3? 
SlCRF11 forward 5?- AAGTGCCTGAGTTGGCTATG-3? 
SlCRF11 reverse 5?- TCACCCTCGATCAGATAAAC-3? 
All samples are compared to the control gene TIP41 (Exp?sito-Rodr?guez et al., 2008).   
 
73 
 
        SlCRFs expression in response to hormone or salt treatment, as described below was 
examined using RT-PCR initiated with 2 min at 95 ?C, followed by 29 to 40 cycles of 30 sec at 
94?C, 45 sec at 57?C, and 40 sec at 72?C, and a 5 min final extension at 72 ?C. RT-PCR at 
different cycle lengths was performed for genes of varying intensities: SlCRF3 (29 cycles), 
SlCRF1, 2, 4, 6, 10, 11 (30 cycles), SlCRF5 (30 cycles for salt, 35 for other treatments), SlCRF7 
(35 cycles for MeJA, 40 for other treatments), SlCRF8, 9 (40 cycles). Primers used to examine 
SlCRF3 to 5, TIP41 were as noted above, RT-PCR primers for SlCRF1, 2, 6-11 are as follows:  
SlCRF1 forward 5?-AACGATGTCGCTTTGTCACC-3? 
SlCRF1 reverse 5?-GGGCAAAATCGTCAAAGTCA-3? 
SlCRF2 forward 5?- ATGCTGCCGGTCCTAGAGTT-3? 
SlCRF2 reverse 5?- GAGCAGTTTCCGACGATGAC-3? 
SlCRF6 forward 5?-AGATGAGCTTTTTGGGCGTA-3? 
SlCRF6 reverse 5?-TCGCTTCTTCCCATTACCAC-3? 
SlCRF7 forward 5?-ACGTTGGTTGGGAAGTTTTG-3? 
SlCRF7 reverse 5?-TAATGGTTGATGGGGTCGAT-3? 
SlCRF8 forward5?-ACGTTGGTTGGGAACTTTTG-3? 
SlCRF8 reverse 5?-GTGTTGATGGGGTTGATTCC-3? 
SlCRF9 forward 5?- GCGTTGCCTAAAGGAGTTAG -3? 
SlCRF9 reverse 5?-ACCAGGGCTCAAATTCTTAC -3?  
SlCRF10 forward 5?- CTCAGAGTTTGGTCTCACATAC -3? 
SlCRF10 reverse 5?- AACATGTCCATCTCCGTATC-3? 
SlCRF11 forward 5?- AAGTGCCTGAGTTGGCTATG-3? 
SlCRF11 reverse 5?- TCACCCTCGATCAGATAAAC-3? 
        For characterizing SlCRF7 response to ethephon and SlCRF8 response to MeJA, primers 
used are the same as those utilized for examining the expression in different organs as noted 
above. 
 
74 
 
        For qRT-PCR analysis, total RNA was extracted from cytokinin or DMSO control treated 
leaves using the same reagents and protocol as described for RT-PCR. 500ng of total RNA was 
converted into cDNA with Qiagen qScript cDNA supermix. 2?L of a 20-fold cDNA dilution was 
used for each reaction in the following qPCR. qPCR was performed with the SYBR-Green 
chemistry in a  Eppendorf Mastercycler ep realplex with the same set of primers used for 
examining salt or hormone responses except SlCRF1-2. Primers for SlCRF1-2 are the same as 
used in the first RT-PCR experiment. Each reaction contains 9?L of SYBR-Green supermix, 2?L 
of cDNA template, 3 ?L of 4?M primers, and 3 ?L of sterile water.  The qPCR program consists 
of one cycle at 95 ?C, followed by 40 cycles of 15 sec at 95?C, 30 sec at 56?C, and 35 sec at 
68?C. The relative expression data used in the figure represent means ? SE of two biological 
replicates. All samples are compared to the control gene TIP41 (Exp?sito-Rodr?guez et al., 2008). 
Hormone and Salt Treatments 
        For all hormone and salt (NaCl) treatments plants were grown as described above and then 
leaves or other tissues were excised from 15 d old Micro-Tom plants, placed in water, and gently 
shaken for 2h prior to treatment. Then treatments or appropriate controls were added to shaking 
tissue for various times as indicated: 5?M cytokinin (N6-benzyladenine, BA), 100?M MeJA 
(methyl jasmonate), 2mM SA (salicylic acid), each with the carrier solvent DMSO and 200mM 
NaCl and 1mM Ethephon (of which ethylene is a break down product) with the appropriate level 
water controls. After designated treatment times (1h or 3h) leaves were removed from solution, 
patted dry, and immediately flash frozen in liquid nitrogen, and stored at -80?C until RNA 
extraction. 
Phylogenetic Analysis 
        Full length sequences of SlCRFs were originally identified by making use of existing 
sequence data from the four full length SlCRFs (SlCRF1, 3, 4, 5) that were previously known 
 
75 
 
either through our 3? RACE-PCR analysis of partial unigene constructs (SlCRF3, 4, 5) or from an 
existing gene sequence for SlCRF1, also known as PTI6. BLAST analysis of the tomato unigene 
collection and now fully sequenced tomato genome was conducted using these four SlCRFs and 
additional CRF sequences from other species, primarily Arabidopsis at http://solgenomics.net 
using publicly available genome sequence data from the International Tomato Genome 
Sequencing Project and from Kazusa Full-length Tomato cDNA Database at 
http://www.pgb.kazusa.or.jp/kaftom. Searches were done primarily using conserved AP2/ERF or 
CRF specific domains regions of the known SlCRFs in a manner similar to that done in the 
identification of CRF genes in a wide range of plant species (Rashotte and Goertzen, 2010). Once 
all full length SlCRF gene sequences were found they were translated and aligned as proteins in 
CLC Sequence Viewer v6.5.1 using default parameters. A phylogenic cladogram was generated 
using Neighbor-Joining method via bootstrap analysis of full length aligned SlCRF proteins again 
in CLC Sequence Viewer v6.5.1 using default parameters. Arabidopsis genes examined in this 
paper are designated as follows: CRF9 (At1g49120), CRF10 (At1g68550), CRF11 (At3g25890), 
CRF12 (At1g25470); and were previously noted as B-clade members of the CRFs in Rashotte 
and Goertzen 2010, CRF9=CRF-B1, CRF10=CRF-B3, CRF11=CRF-B4, CRF12=CRF-B2. 
Protein Examinations 
Vector construction 
        All plasmids for BiFC (Bimolecular fluorescence complementation) were generated using the 
Invitrogen GATEWAY? cloning system according to the manufacturer?s instructions. Entry clones 
for SlCRF1, 2, 3, 5 were prepared/generated via a BP reaction using the pDONR221 and the att-B 
PCR product containing att-B adaptor sites and full length cDNA sequence except the stop codon. 
Through LR reaction, coding sequence was transferred to destination vectors pSAT4-DEST-n (1-174) 
EYFP-C1 and pSAT5-DEST-c (175-end) EYFP-C1 which have N-terminal and C-terminal parts of 
YFP gene respectively. These destination clones were later used to transform Micro-Tom protoplasts. 
 
76 
 
To examine cellular localization in planta, SlCRF1, 2, 5 were transferred, through LR reaction to 
35S:SlCRF:GFP constitutive expression destination vectors pMDC84. These destination clones were 
later used to transform Agrobacterium tumefaciens that was injected into tobacco leaves. All 
destination vectors were obtained through the ABRC at Ohio State University. 
Protoplast Isolation and Transformation for BiFC Analysis 
        For isolating leaf protoplasts, leaves were taken from 15 d old plants and cut into thin strips and 
placed in enzyme solution (2% Cellulase R10, 1% Macerozyme R10, 0.6 M mannitol, 20 mM KCl, 25 
mM MES solution, pH 5.7 that which was heated at 55oC for 10 min, then cooled down to room 
temperature before adding 10 mM CaCl2 and 1% BSA) under vacuum for 30 mins. Next, leaf strips 
were gently shaken for 4 hours or overnight at 40-60 rpm before increased shaking at 90-100 rpm for 
10 mins to release protoplasts. Enzyme solution containing the protoplasts was filtered with a 40 ?m 
cell sifter into a 50 ml conical tube and spun at 100 x g for 2min to pellet the protoplasts. Pelleted 
protoplasts were resuspended in 2ml of cold wash solution (0.6 M mannitol, 5 mM MES pH 5.7, 20 
mM KCl, 10 mM CaCl2) and spun again. After which, the pellet was resuspended in wash solution to 
obtain the final volume for electroporation and kept on ice until transformation. Electroporation of 
protoplast was performed as in Rashotte et al., 2006 and left undisturbed in the dark at RT overnight 
prior to microscopic observation. 
Agrobacteria Infiltration and Transformation for in planta Examination of Cellular Location 
        Tobacco (Nicotiana tabacum) plants were grown under a long day 16h light 26o C, 8h dark 
22o C cycle. Destination vectors used for transformation (SlCRFs in pMDC84, as described 
above) were transformed into Agrobacterium tumefaciens (C58-C1) in a method similar to 
Rashotte et al., 2006 leading to a floral dip. However, once properly antibiotic selected individual 
colonies were identified, further grown up in liquid culture and  spun down they were then 
resuspended in infiltration media (10 mM MgCl2, 10mM MES, 100?M acetosyringone) and left 
 
77 
 
at room temperature for 3h similar to that of Liu et al., 2002. Agrobacteria was then infiltrated 
into the abaxial side of 14-21d old plant leaves using a needle-less 2ml syringe. Plants were then 
examined for transient transformation and GFP expression 48-72h after injection using 
epifluorescence microscopy as in Cutcliffe et al., 2011. 
Epifluorescence Microscopy  
        Bimolecular fluorescence complementation and Agrobacteria infiltrated tobacco leaves were 
examined using a Nikon Eclipse 80i epifluorescence microscope with a UV source in transformed 
protoplast. A standard UV filter was used in addition to 1 ng ml-1 of Hoechst 33342 dye to 
initially observe and identify nuclei in intact cells as a measure of the cells viability. A YFP filter 
that blocks both chlorophyll fluorescence and Hoechst 33342 fluorescence was used to examine 
localization of any split-YFP fusions that occur due to BiFC between proteins. Cytokinin (2?M 
BA) was routinely added to protoplasts prior to examination. A GFP filter that blocks both 
chlorophyll fluorescence and Hoechst 33342 fluorescence was used to examine cellular 
localization of any cells expressing GFP in Agrobacteria infiltrated tobacco leaves. All photos 
were taken with a Qimaging Fast 1394 digital camera and presented as composite images using 
Adobe Photoshop CS3 without altering the original integrity of the picture. 
Results 
Identification of novel Tomato CRFs (SlCRFs) 
        We have identified and characterized a family of eleven Cytokinin Response Factor (CRF) genes 
from tomato, known as Solanum lycopersicum Cytokinin Response Factors or SlCRF1 to 11 (Fig 6; 
Table 4) These genes are members of the AP2/ERF transcription factor family, specifically related to 
clade VI and VI-L of the ERF subfamily of genes, known in Arabidopsis as CRFs (Sakuma et al., 
2002; Nakano et al., 2006; Rashotte and Goertzen, 2010).  These genes were identified from a 
combination of BLAST searches of emerging tomato genome sequence resources using previously 
 
78 
 
identified CRF genes in tomato, orthologous Arabidopsis CRF sequences, and 3?RACE of incomplete 
EST unigene builds of SlCRFs. Previous work identified transcription of four SlCRF sequences 
(SlCRF1, 3 to 5), including the existing PTI6 gene, that we have also designated as SlCRF1 (Rashotte 
and Goertzen, 2010). From this base we have identified ten novel full length expressed CRF genes 
(SlCRF2 to 11), comprising all proteins in tomato containing a CRF domain, a defining characteristic 
of CRF proteins (Fig 6; Table 4).  In several cases 3? RACE was used to generate full length gene 
transcripts from assembled unigenes lacking a 3? end region. Subsequent genome assemblage and 
sequenced BAC contigs have verified the determined sequence we identified from 3?RACE 
experiments. Full length transcripts for SlCRF1 to 11 are presented (Table S1). SlCRFs at a protein 
level fall into three classifications (Fig 6A). One is a standard CRF protein (SlCRF1, 2, 4 to 6, 9 to 11), 
which contains both a CRF and AP2 DNA-binding domain in addition to a putative MAPK 
phosphorylation motif, as seen in a wide range of plant species (Rashotte and Goertzen, 2010). The 
second is a shortened CRF protein (SlCRF7, 8), which contains the CRF and AP2 DNA-binding 
domain, but lacks the 3? third of the protein and the phosphorylation motif, as is also seen in other 
species like Arabidopsis (CRF7, 8). The final classification is a unique CRF protein (SlCRF3), 
containing two CRF and AP2 DNA-binding domains in an alternating pattern. This is the only known 
CRF protein that contains more than a single CRF domain and is expressed, from over 250 identified 
CRF proteins examined across all land plants. Interestingly its chromosomal position is very close to 
the highly related SlCRF8, only 9125 base pairs away, suggesting a possible gene duplication event 
(Table 1).  
        Alignment of these proteins revealed high similarity in domain regions, such as the core 
conserved region DPDATDSSSD of the CRF domain (Fig 6B), similar to that seen in previous 
alignments of CRF proteins from a wide range of land plants (Rashotte and Goertzen, 2010).  For 
ease of alignment and phylogenic analyses in this study the full length SlCRF3 was split into N 
and C-terminal parts each containing a CRF and AP2 domain, although a full length version 
yielded similar results (data not shown). Phylogenetic analysis based on similar domain 
 
79 
 
sequences indicates that some SlCRFs have a paired relation suggesting an ancient duplication as 
well as most SlCRFs have an Arabidopsis ortholog (Fig 6C; D). Tomato and Arabidopsis do not 
have directly orthologous phylogenetic protein pairs since, in some cases a single SlCRF protein 
is grouped with two Arabidopsis proteins (SlCRF2 with CRF1 and CRF2; SlCRF5 with CRF5 
and CRF6). Additionally, SlCRF1 has no orthologous Arabidopsis gene partner (Fig 6D), 
although it is part of a related subclade of CRF proteins found in a number of other species 
(Rashotte and Goertzen, 2010).  
SlCRFs Are Expressed in Different Plant Tissues  
        Previous work identified four SlCRFs (SlCRF 1, 3 to 5) as expressed in leaf tissues 
(Rashotte and Goertzen, 2010). Here we show that SlCRF1 to 11 are expressed in multiple 
different plant tissues throughout the plant (leaf, stem, root, and flowers) to varying degrees 
(Figure 7). Generally, SlCRF expression levels were consistent across plant tissues examined. 
However, some genes showed preferential tissue expression, as seen for roots in SlCRF4, 5 and 
for stems in SlCRF8, 11 (Fig 7). 
SlCRF Transcript Levels Are Regulated by Cytokinin and Salt  
        Knowing that several CRFs in Arabidopsis have previously been shown as induced by 
cytokinin we examined the regulation of SlCRF genes by cytokinin. Tomato leaves (15-d old) 
were treated with cytokinin (5?M BA) or DMSO as a vehicle control for 1h and 3 h and 
examined using real-time PCR. We found three SlCRFs (SlCRF2, 3, 5) that are strongly (4 to 6 
fold) induced by cytokinin (Fig 8A). SlCRF2 showed rapid induction by cytokinin at 1h after 
treatment to 6 fold over untreated levels and by 3h was still induced, although at this point only 
about 3.5 fold over control levels. Both SlCRF3 and 5 showed no induction at 1h, but were highly 
induced (4 to 5 fold) after 3h of cytokinin treatment. A few other SlCRFs showed weaker levels 
(1.5 to 2 fold) of induction at 3h of cytokinin treatment (SlCRF1, 6, 7, 8, 9), whereas SlCRF4, 10, 
11 showed no change in expression (Fig 8A). The results follow a pattern similar to that seen for 
 
80 
 
Arabidopsis CRFs (AtCRFs) that some, but not all members of this group are transcriptionally 
regulated by cytokinin (Rashotte et al., 2006). 
        We also examined SlCRFs for changes in response to salt and other hormones in leaves 
treated at 1h and 3h vs. controls using RT-PCR. The results revealed expression changes in 
several genes although many showed little to no alterations (Fig 8). Expression analysis of salt 
treatment (200mM NaCl) revealed induction of SlCRF1, 4, 6 at both 1h and 3h as well as a minor 
induction of SlCRF2, 5 and 7 at 3h (Fig 8B). This suggests a new potential role of SlCRFs in 
stress regulation. Expression analysis of ethylene treatment (1mM Ethephon) showed some 
induction of SlCRF1 and 4 at both 1h and 3h, while SlCRF2 was repressed at both 1h and 3h and 
SlCRF7 at 1h (Fig 8C). This is some of the first data linking any CRF to ethylene. Expression 
analysis of methyl jasmonate treatment (100?M MeJA) showed only a single transcript change, 
the repression of SlCRF6 at both 1h and 3h (Fig 8D). Expression analysis of salicylic acid 
treatment (2mM SA) revealed induction of SlCRF1 at 3h as well as induction of SlCRF4, 8 at 
both 1h and 3h (Fig 8E). Together these results suggest that SlCRFs can be regulated by factors 
other than cytokinin. 
SlCRF Proteins Show Nuclear Localization in planta 
        We examined the cellular localization of specific SlCRF proteins (SlCRF1, 2, 5) by 
transiently expressing GFP tagged SlCRF proteins in tobacco leaves via an Agrobacteria 
infiltration method (Fig 9A). Leaves infiltrated with 35S:SlCRF:GFP vectors were examined for 
expression after 48h. Each of the SlCRF proteins examined was found localized in the nucleus of 
leaf mesophyll cells and not other organelles in regions adjacent to infiltration sites as compared 
to empty transformed vectors (EV) or WT untransformed plants (Fig 9A). Although localization 
of SlCRFs can be seen in the nucleus of cells, it is not obviously absent from the cytoplasm, 
which is consistent with previous models of AtCRFs that appear to move between the cytoplasm 
and nucleus. This is also in agreement with the cellular localization of SlCRFs as predicted by 
 
81 
 
PSORT computer protein localization prediction models (data not shown), indicating preferences 
primarily for nuclear, cytoplasmic, or either nuclear or cytoplasmic protein localization.   
SlCRF Proteins Interact Among Themselves  
        Protein-protein interactions can be important for functional regulation of proteins. In order to 
determine if this level of regulation occurs among SlCRFs we examined potential interactions 
using Bimolecular Fluorescence Complementation (BiFC) analysis split YFP system. SlCRF 
proteins (SlCRF1, 2, 3, 5) were placed into specific vectors which enabled their expression linked 
to either an N or C-terminal half of a YFP protein, such that fluorescence would not be visible 
unless proteins containing each YFP half interact. Proteins were examined for interaction by 
electroporation of tomato leaf mesophyll protoplasts followed by epifluorescence microscopy 
(Fig 9B). We found that homodimers formed between all SlCRFs examined. In addition, 
heterodimers could also form with all SlCRF combinations examined (Fig 9). In these 
experiments, while cytokinin is not required to observe nuclear localization it is easier to 
visualize nuclear localization after its addition, so it is routinely added. Overall these findings are 
consistent with what has been found for AtCRFs and suggest that because there is a pattern for 
potential of all SlCRF proteins to interact that regulation of SlCRFs at the level of protein 
dimerization is unlikely to occur (Cutcliffe et al., 2011).  
Discussion 
        Cytokinin is involved in various plant growth and developmental processes of great 
agronomic importance, yet few cytokinin regulated genes have been studied in crop plants. This 
study presents the first examination of a complete set of cytokinin response factor (CRF) genes in 
a crop species, tomato (Solanum lycopersicum). Eleven SlCRF genes (SlCRF1 to 11) were 
identified in this study as part of a larger group of CRF genes present in all land plants (Rashotte 
and Goertzen, 2010). SlCRF proteins contain the hallmark domains of this group; a CRF and 
AP2-DNA binding domain, as well as a putative MAPK motif found in many other CRF proteins 
 
82 
 
(Fig 6; Rashotte and Goertzen, 2010). One SlCRF, SlCRF3, was found to have a unique protein 
structure containing two CRF and two AP2 domains (Fig 6; Table S1). While several AP2/ERF 
proteins contain two AP2 domains, including the founding member of this group, SlCRF3 is the 
only known protein to contain more than a single CRF domain. Despite this it appears to be 
actively transcribed, induced by cytokinin and able to interact with other SlCRFs proteins.   
        A phylogenetic analysis of SlCRFs shows relationships similar to that seen for Arabidopsis 
CRFs (AtCRFs) and the overall group of CRFs in plants (Rashotte and Goertzen, 2010). Despite 
overall similarities between tomato and Arabidopsis CRFs, there are several differences that may 
suggest functional differences between species. An example is the existence of a single SlCRF 
gene, where there are two paralogs in Arabidopsis, such as SlCRF5 compared to AtCRF5 and 
AtCRF6 (Fig 6D). Another difference is that SlCRF1 has no direct Arabidopsis ortholog. In fact 
most plant species appear to have a SlCRF1 ortholog, indicating that the condition in tomato is 
more common (Rashotte and Goertzen, 2010). It also suggests that the function of SlCRF1 is 
unlikely to be simply determined through studies of CRFs in Arabidopsis. 
        Expression of SlCRF1 to 11 in tissues from roots to flowers suggests a broad role for these 
genes in the plant (Fig 7). There also appears to be a range of transcript levels of SlCRFs 
potentially indicating different functional roles in different tissues. This is the most complete 
tissue analysis of a CRF group of genes from any species excluding Arabidopsis where 
microarray generated data of AtCRFs reveal a pattern of expression across most tissue types and 
development, not unlike that seen for the SlCRFs in this study suggesting that CRFs in most 
plants are likely to be expressed broadly across tissues (data not shown).  
        Several SlCRFs were found to be induced by cytokinin, mirroring a pattern seen in 
Arabidopsis where only some CRFs show strong induction by cytokinin (Rashotte et al., 2006). 
Interestingly these AtCRF genes parallel the SlCRFs strongly induced in this study. SlCRF2, 
highly similar to AtCRF2, shows the most rapid induction of tomato CRFs comparable to very 
rapid induction of AtCRF2 (Fig 8A; Rashotte et al., 2006). SlCRF5, similar to both AtCRF5 and 
 
83 
 
AtCRF6, is also highly induced by cytokinin (Fig 1D; 3A; Rashotte et al., 2006). SlCRF5 is not as 
rapidly induced as SlCRF2, which parallels the slower cytokinin induction of AtCRF6 compared 
to other CRFs (Rashotte et al., 2006). SlCRF3 is a unique gene, occurring only in tomato and as 
such it is difficult to assess its role in cytokinin regulation, although it is clearly induced by 
cytokinin in a similar fashion to SlCRF5. The lack of cytokinin regulation of some highly related 
pairing of SlCRFs also parallels expression studies of other AtCRFs, such as SlCRF4 and 6 
compared to AtCRF3 and 4. Overall the pattern of transcriptional cytokinin regulation of SlCRFs 
is similar to AtCRFs and suggests that there may be similar regulation within specific clades of 
CRF genes. 
        We examined other factors that might transcriptionally affect SlCRFs as they had been 
shown to affect related ERF family members: salt, ethylene, MeJA, and SA (Gu et al., 2000; 
2002; Park et al., 2001; Sakuma et al., 2002; Nakuma et al., 2006; Zarei et al., 2011). Treatment 
with salt (NaCl) induced about half of the SlCRFs to some degree (Fig 8B), revealing that CRFs 
can be induced by abiotic factors. An investigation of related AtCRFs (AtCRF2, 5, 6) also 
indicated induction by NaCl treatment from an examination of publically available microarray 
data. Previous examinations of the Tobacco stress induced 1 (Tsi1) gene (a CRF member) has 
shown transcript induction during high salt stress in both overexpressing and RNAi transgenic 
plants (Park et al., 2001; Han et al., 2006). Our finding that several SlCRFs are induced by salt 
treatment supports the previous finding for Tsi1 and suggests that CRFs play a role in salt stress 
response and may be involved in more general regulation of stress responses. Ethylene treatment 
resulted in a mixed set of responses from SlCRFs from some induction, to repression, with little 
effect on the majority of SlCRFs (Fig 8C). Previous studies have shown that ethylene had little to 
no effect on AtCRFs and SlCRF1/Pti6 consistent with most SlCRFs in this study. The exception, 
SlCRF2 transcript repression, indicates that ethylene may play some role in SlCRF function, 
although a more detailed study is needed to further determine the extent. Methyl jasmonate 
(MeJA) treatment showed almost no effect on any SlCRFs suggesting that it plays little role in 
 
84 
 
CRF function, although specific CRFs such as SlCRF6 may be exceptions (Fig 8D). Salicylic 
acid (SA) treatment resulted in minor induction of three SlCRFs similar to MeJA treatments, 
indicating that SA also appears to have little effect on the transcription of most SlCRFs. Together 
these results suggest that SlCRFs can be regulated by factors other than cytokinin and may fall 
into different groups of regulated genes: some (SlCRF3 and 5) regulated primarily by cytokinin,  
others (SlCRF1, 2, 4, 6, 7, 8) regulated by several factors, and some (SlCRF9-11) show little 
response to factors examined in this study. A broader examination of SlCRF expression patterns, 
beyond this study is needed to determine the functional role of each SlCRF. 
        Previous examinations of non-Arabidopsis CRF genes have shown links to pathogen 
response when overexpressed for Pti6 from Tomato (SlCRF1) and Tsi1 from Tobacco (Zhou et 
al., 1997; Park et al., 2001; Gu et al., 2002). While we did not examine pathogen response in this 
study our finding that SlCRF1 is induced by factors ethylene and salicylic acid linked to this 
process, and supports this previous reported role for SlCRF1 (Zhou et al., 1997; Gu et al., 2002). 
Our finding that several other SlCRFs are affected by these similar treatments may suggest that an 
effect on pathogen response could be a broader functional characteristic of some SlCRFs.  
        Cellular localization is often an important factor for determining the function of proteins 
such as transcription factor localization to the nucleus required for their mode of action: binding 
to DNA. AtCRFs were previously shown in protoplasts to be throughout the cytoplasm and 
localized to the nucleus with the addition of exogenous cytokinin (Rashotte et al., 2006). 
Protoplasts are good single cell systems to examine cellular localization, but lack several aspects 
of a true in planta system that may reflect a more accurate result. To overcome this we transiently 
expressed GFP tagged SlCRF proteins in tobacco leaves where we found SlCRFs to be primarily 
nuclear localized in the absence of exogenous cytokinin, although we cannot rule out some 
cytoplasmic localization as well (Fig 9A). SlCRF localization to both the nucleus and cytoplasm 
would be consistent with previous results of Arabidopsis CRFs and with protein localization 
prediction data for SlCRFs (Rashotte et al., 2006). It may be that CRFs act in a manner similar to 
 
85 
 
the Arabidopsis histo-phospho transfer proteins (AHPs) known to move between the cytoplasm 
and the nucleus relaying a cytokinin signal in that pathway. Initial work examining AHP 
localization in protoplasts showed cytoplasmic expression followed by nuclear localization after 
the addition of exogenous cytokinin, similar to that of the AtCRFs (Hwang and Sheen 2001). 
However, a recent in planta examination of AHPs revealed a strong nuclear expression of these 
proteins in root tissues, where there are high levels of endogenous cytokinin (Punwani et al., 
2010). Although AHPs were also found to a lesser degree in the cytosol, consistent with a cycling 
between nucleus and cytosol needed for these proteins to function as phosphate carriers in 
cytokinin signaling (Punwani et al., 2010). The identification of SlCRFs primarily localized in the 
nucleus, without the addition of exogenous cytokinin, suggests a similar mechanism, in which 
intact leaf mesophyll cells contain levels of endogenous cytokinin high enough to focus SlCRF to 
the nucleus. We contend that protoplasts contain very low levels of endogenous cytokinin, such 
that CRFs are not routinely found localized within their nucleus until exogenous cytokinin is 
added consistent with our findings here. 
        Protein?protein interactions are very common and important in signal transduction, 
including the regulation of transcription factors by patterns of homo- or heterodimerization with 
other partners (Pawson and Scott, 1997; Pawson and Nash, 2000; Kasahara et al., 2001). We 
found that each of the SlCRFs examined were able to form both homodimers and heterodimers 
with the other SlCRFs, suggesting that SlCRFs are unlikely to be regulated at this level. Although 
not all SlCRFs were examined in this study, the result of the representative SlCRFs examined 
here are consistent with a larger study of protein-protein interactions among AtCRFs, showing 
widespread homo and heterodimerization and indicating that the CRF domain itself is likely 
involved in this interaction (Cutcliffe et al., 2011). Interestingly, the presence of an additional 
CRF and AP2 DNA-binding domain in SlCRF3 does not appear to affect these interactions.  
        In summary, this work identifies and characterizes 11 cytokinin response factors in tomato 
(SlCRF1 to 11). We show that SlCRF1 to 11 are expressed at varying levels over a range of 
 
86 
 
tissues. SlCRF proteins appear to show nuclear localization and can interact to form homo and 
heterodimers amongst themselves. Several SlCRFs show strong induction by cytokinin similar to 
that previously noted for Arabidopsis CRFs. Additionally, some SlCRFs were found to be 
regulated by factors other than cytokinin, potentially suggesting a diverse role for CRFs in stress 
and other hormone regulation in plants. This study indicates that SlCRFs appear to have multiple 
regulatory functions in tomato plants. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
87 
 
Literature Cited 
 
Brenner WG, Romanov GA, Kollmer I, Burkle L, Schm?lling T (2005) Immediate-early and 
delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression 
profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through 
transcriptional cascades. Plant Journal 44:314?333 
 
Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM (2011) CRFs form protein-protein interactions 
among each other and with members of the cytokinin-signaling pathway in Arabidopsis via the 
CRF domain. J. Exp. Bot. doi: 10.1093/jxb/err199 
 
Exp?sito-Rodr?guez M, Borges AA, Borges-P?rez A, P?rez JA (2008) Selection of internal 
control genes for quantitative real-time RT-PCR studies during tomato development process. 
BMC Plant Biology 8:131 
Gu, Y-Q, Yang, C, Thara, VK, Zhou J, Martin, GB (2000) Pti4 is induced by ethylene and 
salicylic acid, and its product is phosphorylated by the Pto kinase. Plant Cell 12:771?785 
Gu Y-Q, Wildermuth M, Chakravarthy S, Loh Y-T, Yang C, He X, Han Y, Martin G (2002) 
Tomato transcription Factors Pti4, Pti5, and Pti6 activate defense responses when expressed in 
Arabidopsis. Plant Cell 14:817-831 
Han B-K, Park J, Lee S-B, Kim M, Lee I-J, Kim K-J, Kwon C, Paek K-H (2006) Tobacco Tsip1, 
a DnaJ-type Zn finger protein, is recruited to and potentiates Tsi mediated transcriptional 
activation. Plant Cell 18:2005-2020 
Hoth S, Ikeda Y, Morgante M, Wang X, Zuo J, Hanafey MK, Gaasterland T, Tingey SV, Chua 
NH (2003) Monitoring genome-wide changes in gene expression in response to endogenous 
cytokinin reveals targets in Arabidopsis thaliana. FEBS Letters 554:373?380 
Hwang I, Sheen J (2001) Two-component circuitry in Arabidopsis cytokinin signal transduction. 
Nature 413:383?389 
Kasahara H, Usheva A, Ueyama T, Aoki H, Horikoshi N, Izumo S (2001) Characterization of 
Homo- and Heterodimerization of Cardiac Csx/Nkx2.5 Homeoprotein. Journal of Biological 
Chemistry 276:4570?4580 
Kiba T, Naitou T, Koizumi N, Yamashino T, Sakakibara H, Mizuno T (2005) Combinatorial 
microarray analysis revealing Arabidopsis genes implicated in cytokinin responses through the 
His-Asp Phosphorelay circuitry. Plant and Cell Physiology 46:339-355 
Liu Y, Schiff M, Dinesh-Kumar SP (2002) Virus-induced gene silencing in tomato. Plant Journal 
31:777-786 
Mok DW, Mok MC (2001) Cytokinin metabolism and action. Annual Reviews in Plant 
Physiology and Plant Molecular Biology 89:89-118 
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene 
family in Arabidopsis and rice. Plant Physiology 140:411-432 
 
88 
 
Park J, Park C-J, Lee S-B, Ham B-K, Shin R, Paek K-H (2001) Overexpression of the Tobacco 
Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resistance against 
pathogen attack and osmotic stress in Tobacco. Plant Cell 13:1035-1046 
Pawson T, Scott JD (1997) Signaling through scaffold, anchoring, and adaptor proteins. Science 
278:2075?2080 
Pawson T, Nash P (2000) Protein?protein interactions define specificity in signal transduction. 
Genes and Development 14:1027-1047 
Punwani JA, Hutchison CE, Schaller GE, Kieber JJ (2010) The subcellular distribution of the 
Arabidopsis histidine phosphotransfer proteins is independent of cytokinin signaling. Plant 
Journal 62:473?482 
Rashotte AM, Carson SDB, To JPC, Kieber JJ (2003) Expression profiling of cytokinin action in 
Arabidopsis. Plant Physiology 132:1998-2011 
Rashotte AM, Mason MM, Hutchison CE, Ferreria FJ, Schaller GE, Kieber JJ (2006) A subset of 
Arabidopsis AP2 transcription factors mediate cytokinin responses in concert with a two-
component pathway. Proceedings of the National Academy of Sciences USA 103:11081-11085 
Rashotte AM, Goertzen LR (2010) The CRF domain defines Cytokinin Response Factor proteins 
in plants. BMC Plant Biology 10:74 
Sakuma Y, Liu Q, Dubouzet J, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-
binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved 
in dehydration- and cold-inducible gene expression. Biochemical and Biophysical Research 
Communications 290:998-1009 
To JP, Kieber JJ (2008) Cytokinin signaling: two-components and more. Trends in Plant Sciences 
13:85-92 
Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H, Schmulling T (2003) Cytokinin-
deficient transgenic Arabidopsis plants show multiple developmental alterations indicating 
opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell 
15:2532-2550 
Werner T, Motyka V, Strnad M, Schm?lling T (2001) Regulation of plant growth by cytokinin. 
Proceedings of the National Academy of Sciences USA 98:10487?10492 
Werner T, Schm?lling T (2009) Cytokinin Action in Plant Development. Current Opinions in 
Plant Biology 12:527-538  
Zarei A, K?rbes AP, Younessi P, Montiel G, Champion A, Memelink J (2011) Two GCC boxes 
and AP2/ERF-domain transcription factor ORA59 in jasmonate/ethylene-mediated activation of 
the PDF1.2 promoter in Arabidopsis. Plant Molecular Biology 75:321-331 
 
89 
 
Zhou J, Tang X, Martin G (199) The Pto kinase conferring resistance to tomato bacterial speck 
disease interacts with proteins that bind a cis-element of pathogenesis-related genes. EMBO 
16:3207-3218 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
90 
 
 
 
Fig. 6 SlCRF protein form, alignment, and phylogenic relationships. (A) A model of SlCRF 
protein form including size, domains, and motifs for all 11 SlCRFs. (B) Protein sequence 
alignment of the CRF domain for SlCRF1? SlCRF11 is shown with a sequence consensus, 
including both SlCRF3 CRF domains. (C) Neighbor?Joining tree of SlCRF proteins based on 
alignment of the CRF domain with support values shown out of 1000 bootstrap replicates. (D) 
Neighbor?Joining tree of SlCRF and Arabidopsis CRF (AtCRF) proteins based on alignment of 
both the CRF and AP2 DNA-binding domains with support values shown out of 1000 bootstrap 
replicates. 
 
 
 
 
 
 
91 
 
 
 
 
 
Fig. 7 SlCRF expression patterns in various tomato tissues. RT-PCR analysis of SlCRF1? 
SlCRF11 in leaf, stem, root, and flower tissues of 52-day-old plants is shown. The TIP41 gene 
serves as an internal control.    
 
 
 
92 
 
                
 
 
 
Fig. 8 Expression response of SlCRF genes to hormones and salt. Relative expression in 15-day-
old leaves of SlCRF1?SlCRF11 in response to hormone or salt treatment at 1 h and 3 h after 
treatment versus non-treated controls. (A) qRT-PCR of cytokinin (5 ?M BA) treatment. Data 
presented are a mean6SE (two biological replicates). Light grey bar, 1 h DMSO control; dark 
grey bar, 1 h BA treatment; white bar, 3 h DMSO control; black bar, 3 h BA treatment. (B) RT-
PCR of salt (200 mM NaCl) treatment. (C) RT-PCR of ethylene (1 mM Ethephon) treatment. (D) 
RT-PCR of methyl jasmonate (100 lM MeJA) treatment. (E) RT-PCR of salicylic acid (2 mM 
SA) treatment. Data presented for RT-PCR are from a representative sample of experiments, with 
the TIP41 gene serving as an internal control.  
 
93 
 
  
 
 
Fig. 9 SlCRF protein localization and protein?protein interactions. (A) Cellular localization of 
SlCRF1, SlCRF2, and SlCRF5 in tobacco leaves transiently transformed with 35S:SlCRF:GFP 
vectors via Agrobacterium infiltration. Representative examples of GFP expression from tagged 
SlCRF proteins indicate a strong nuclear localization in regions of transformed leaves visualized 
under UV light using a GFP wavelength filter (panels labelled SlCRF:GFP).The panel labelled 
SlCRF1:GFP (UV) is the same sample as SlCRF1:GFP shown without the GFP filter in the 
presence of Hoechst 33342 dye denoting the nucleus. EV denotes an empty vector control and 
WT leaf denotes an untransformed sample. (B) SlCRF proteins (SlCRF1, SlCRF2, SlCRF3, and 
SlCRF5) were analysed for potential homo- and heterodimerization using BiFC. Representative 
examples of positive SlCRF dimerizations are shown both under UV light in the presence of 
Hoechst 33342 dye denoting the nucleus and using a YFP wavelength filter to visualize BiFC 
interaction. Additionally, representative examples of empty vector (EV) controls for both N- and 
C-terminal BiFC vectors (EVn and EVc) are shown. A table of SlCRF interactions 
is shown, with (+) as positive and (?) for non-interactions. 
 
 
          
 
 
 
94 
 
 Table 4 SlCRF gene description   
                          
Gene name Chromosome/position 
(Build 2.40) 
Gene model Size 
(aminoacids/bp) 
SlCRF1/PTI6          Ch 6 (44654446?44653700) Solyc06g082590 248/747 
SlCRF2 Ch 8 (62045738?62046757) Solyc08g081960 340/1023 
SlCRF3  Ch 1 (2911579?2910313) Solyc01g008890 344/1035 
SlCRF4 Ch 3 (2016125?2014935) Solyc03g007460 396/1191 
SlCRF5 Ch 1 (78502891?78503773) Solyc01g095500 293/882 
SlCRF6 Ch 6 (32043471?32044523) Solyc06g051840 350/1053 
SlCRF7    Ch 1 (14595809?14596333) Solyc01g014720 174/525 
SlCRF8 Ch 1 (2901188?2900649) Solyc01g008880 175/540 
SlCRF9 Ch 3 (62191449?62190256) Solyc03g119580 397/1194 
SlCRF10   Ch 5 (3622457?3621438) Solyc05g009450 339/1020 
SlCRF11   Ch 4 (874453?875505) Solyc04g007180 350/1053 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
     
          
 
 
 
 
 
95 
 
 
 
 
 
 
Chapter V. Expression patterns and regulation of SlCRF3 and SlCRF5 in response to 
cytokinin and abiotic stresses in tomato 
 
Abstract  
 
        Cytokinin is an influential hormone involved in numerous aspects of plant growth and 
development. A group of transcription factors- cytokinin response factors (CRFs) has been 
included as a side branch to cytokinin signaling pathway which also constitute a subset of the 
AP2/ERF family of transcription factor proteins. This study examined the expression patterns of 
two transcription factor genes SlCRF3 and SlCRF5 in tomato to determine their regulation in 
response to cytokinin and a variety of abiotic stress conditions. Analyses conducted during 
different developmental stages by RT-PCR or GUS reporter gene expression revealed that these 
genes are differentially expressed in vegetative and reproductive organs. qRT-PCR experiments 
were also performed to study regulation by the hormone cytokinin and abiotic stress conditions 
such as flooding, drought, osmotic, oxidative, and temperature. These showed that SlCRF3 and 
SlCRF5 have different patterns of regulation in leaf, stem, and roots with SlCRF5 showing greater 
induction in leaf or root tissue compared to SlCRF3 in most cases. Additionally, knockdown 
analysis for SlCRF5 revealed defects across development including leaf morphology, primary 
root growth, and lateral root formation. Together, these findings indicate that SlCRF3 and 
SlCRF5 are potential regulators of tomato developmental processes associated with cytokinin or 
abiotic stresses. 
 
Introduction: 
 
96 
 
        The cytokinin response factors (CRFs) are a subset of the APETALA2/Ethylene Response 
Factor (AP2/ERF) family of transcription factors found in all land plants. These genes were 
originally identified in Arabidopsis microarray experiments of cytokinin response as transcription 
factor family members that were highly induced at multiple time points after exogenous 
application of cytokinin (Rashotte et al., 2003). Recent works have revealed the presence of 12 
CRFs in Arabidopsis (AtCRFs) and also similar numbers in other plant genomes including 11 
(SlCRFs) in tomato (Rashotte and Goertzen, 2010; Cutcliffe et al., 2011; Shi et al., 2012). Much 
of the study of CRFs has focused on the Arabidopsis system (Rashotte et al., 2006; Cutcliffe et 
al., 2011), although initial examinations of CRFs in tomato has shown that some SlCRFs are 
induced by cytokinin in leaves and that one SlCRF gene is expressed in the vasculature of various 
organs similar to AtCRFs (Shi et al., 2012; Zwack et al., 2012). One goal of this study was to 
conduct a more thorough examination of expression patterns and cytokinin induction for the two 
SlCRF genes, SlCRF3 and SlCRF5 in different organs over different stages of tomato 
development. 
        While it is clear that a subset of CRFs is cytokinin regulated, little information is known of 
the roles of CRFs in processes other than cytokinin regulation in any plant species. The genes that 
have been studied in this way in some manner include PTI6/SlCRF1, other SlCRFs 2-11, and 
tobacco stress-induced 1 (TSI1) gene (a CRF member), which are linked to disease resistance and 
some stress responses (Zhou et al., 1997; Park et al., 2001; Gu et al., 2002; Shi et al., 2012). 
Arabidopsis CRF expression data from abiotic stress microarray experiments (Winter et al., 2007) 
or qPCR/GUS analysis also revealed that several AtCRFs appear to be abiotic stress responsive 
(Zwack et al., 2013; Compton 2012). Abiotic stresses can be highly detrimental to plant growth 
and can greatly reduce crop yields in plants, including tomato (reviewed in Pandey et al., 2011; 
Qin et al., 2011; Duque et al., 2013). These stresses cause damage at tissue and cellular levels that 
can rupture membranes, breakdown photosynthetic machinery components, as well as result in 
cell death. As such, the regulation of these stresses to generate stress resistant plants is of great 
 
97 
 
importance to plant growers. Cytokinin has been strongly linked to abiotic stress responses in a 
number of studies examining cytokinin signaling, metabolism and biosynthesis where changes in 
cytokinin levels, responsive genes, or receptors dramatically altered plant growth under stress 
conditions (reviewed in Peleg and Blumwald, 2011; Wilkinson et al., 2012; Nishiyama et al., 
2011). Since some SlCRFs are previously known to be highly induced in response to cytokinin 
treatment (Shi et al., 2012), we conducted here additional study focusing on abiotic stress 
responses of these genes to provide insight into the link between cytokinin regulated transcription 
factors and abiotic stress conditions. 
        Analysis of loss-of-function CRF mutations in Arabidopsis revealed that the CRFs function 
redundantly to regulate the development of embryos, cotyledons, and leaves (Rashotte et al., 
2006). In order to investigate potentially similar development effects of reduced CRF levels 
during tomato development, we generate antisense transgenic plants with decreased expression 
levels of SlCRF5. Phenotypic analysis revealed a potentially critical role for SlCRF5 in overall 
tomato development. Together, this study presents baseline information on the regulation of 
SlCRF3 and SlCRF5 genes relevant for future research focused on the study of tomato 
development. 
 
Materials and Methods: 
 
Plant materials and Growth conditions 
        The tomato dwarf cultivar Micro-Tom plants were grown in Sunshine Mix #8 soil under a 
16:8 h light: dark photoperiod at 150 ?E, with a 26? C day (light), 22? C night (dark) temperature 
in controlled-environment chambers. Sterilized seeds were germinated in magenta boxes 
containing 0.8% agar gel with MS salts (4.8g/L), added Gamborg B5 Vitamins, and 2% sucrose. 
The pH of the medium was adjusted to a final value of 5.7. 
        Arabidopsis thaliana (Col-0) plants were germinated on Petri dishes containing 0.8% agar 
gel with MS salts (4.8g/L) and 1 % sucrose medium of 5.7 pH. Plants were grown under a light: 
 
98 
 
dark photoperiod at 100 ?E, with 22? C day (light), 18? C night (dark) temperature in controlled-
environment chambers. 
Generation of transgenic plants 
        Plasmids for expression analysis and antisense were generated using the Invitrogen 
GATEWAY? cloning system according to the manufacturer?s instructions. For expression 
analysis, the promoter regions (~2kb upstream of ATG) of SlCRF3 and SlCRF5 were amplified 
from the genomic DNA and cloned into the destination vector pKGWFS7 as described in Zwack 
et al. (2012). To generate the antisense construct, coding sequence of SlCRF5 was cloned in the 
destination vector pK2WG7. All vectors were sent to the Plant Transformation Research Center 
(PTRC) at the University of California Riverside for transformation of tomato plants. For 
expression analysis in Arabidopsis, Agrobacterium tumefaciens C58 cells were transformed with 
destination vector pKGWFS7 harboring SlCRF5 promoter via electroporation, and plants were 
transformed using the floral dip method (Clough and Bent, 1998). For all transgenics, three 
independently selected homozygous lines were used for analyses. 
Histochemical analysis 
        GUS activity was analyzed in tomato and Arabidopsis organs of transgenic lines. Tissues 
and organs from these lines of different developmental stages were vacuum infiltrated for 20-30 
minutes with X-gluc buffer (Weigel and Glazebrook 2002) before incubation at 37? for 2- 4 h for 
Arabidopsis and overnight for tomato followed by clearing of tissues in 70% ethanol at room 
temperature. Whole tissues or free hand sections were then examined using a Nikon Eclipse 80i 
microscope and photos were taken with a Qimaging Fast 1394 digital camera. 
Cytokinin treatment 
        Tomato plants were grown in soil as described above, from which leaves and stems of 15, 
25, and 35 d old plants were excised, placed in water, and gently shaken for 2 h prior to 
treatment. Cytokinin (N6 -benzyladenine; BA) of different concentrations (see text) or the vehicle 
 
99 
 
control DMSO were then added to shaking tissues for various times (see text). For treatment of 
roots, plants were grown hydroponically in CYG germination pouches from Mega International. 
Seedlings at 14 DAS (days after sowing) were treated for 24 h by directly adding cytokinin or 
control DMSO to the growth pouches. After treatment roots (Root tips (RT) - encompassing the 
meristem and the elongation zone; Lateral roots (LR), and whole roots (WR, including RT and 
LR) were removed from solutions or germination pouches, patted dry with paper towel and 
immediately flash-frozen in liquid nitrogen (N2), and stored at -80? C until RNA extraction. 
ProSlCRF5:GUS homozygous plants (both tomato and Arabidopsis (grown on agar plates)) were 
also treated with cytokinin in the same manner as described above.   
Stress treatments  
Water stress  
        For flooding stress treatment, 25 d old plants grown under standard conditions in soil were 
placed in trays to maintain water logged conditions for 1, 4, and 7 d. For drought experiments, 25 
d well watered plants were left unwatered for 7 d and rewatered to examine recover from drought 
conditions. Leaf, stem and root samples were collected after 7 d of wilting, and 1, 3, 6, 12 h after 
rewatering and compared to control plants grown under standard conditions. Root treatments 
were performed in CYG germination pouches. 
Mannitol, H2O2, and ABA treatment 
        25-d old soil grown plants were treated with 200mM mannitol, 10 and 20 mM H2O2, and 50 
and 100 ?M ABA for 3 h and leaf, stem, and root tissues were collected and immediately flash-
frozen in liquid N2. 
Temperature    
        Plants were grown in magenta boxes and treatments were performed at 25 d age. For cold 
treatment, magenta boxes were kept in 4? C for 24 h, and heat treatment was performed by 
 
100 
 
moving the plants in magenta boxes from 26? C to a 45? C water bath for 1 h, after which leaves, 
stems, and roots were collected and immediately flash-frozen in liquid N2. 
RNA isolation, cDNA synthesis, and expression analysis 
        For expression analysis, tissues were harvested from 15, 25, and 35 d old plants and 
immediately flash-frozen in liquid N2. Total RNA was extracted from these samples and other 
treated plants as described in Shi et al., (2012). For RT-PCR or qRT-PCR analysis, 500 ng of 
total RNA was converted into cDNA with Quanta qScript cDNA supermix and diluted 20X 
before use in PCR reactions. SlCRF3 and SlCRF5 expression analysis in various organs by RT-
PCR was started with a one-step cycle of 2 min at 95? C, followed by 29 cycles of 30 sec at 94? 
C, 45 sec at 56? C, and 50 sec at 72? C, and a 5 min final extension at 72? C, using gene specific 
primer as mentioned in Shi et al., (2012). 
        qPCR was performed using cytokinin or stress treated cDNA samples with SYBR-Green 
chemistry in an Eppendorf Mastercycler ep realplex using primers as in the RT-PCR. Each 
reaction contains 9 ?L of SYBR-Green supermix, 2 ?L of cDNA template, 1 ?L of 6 ?M forward 
and reverse primers, and 7 ?L of sterile water. The qPCR program consists of 1 cycle at 95? C, 
followed by 40 cycles of 15 sec at 95? C, 45 sec at 56? C, and 50 sec at 68? C. The last step for 
each reaction was melting curve generation to test the amplicon specificity. All qPCR reactions 
were performed in two technical and two biological replicates and the relative expression data 
used in the figure represent means ? SE of two biological replicates. Samples were compared to 
the control gene TIP41 (Exp?sito-Rodr?guez et al., 2008) or SleIF4A gene specific primers (for 
stress experiments):   
SleIF4A F 5? GGCTCATCTCGTGTGCTTAT 3?  
SleIF4A R 5? CATCCTTTCATCATCCTTGG 3? 
 
Results  
 
101 
 
SlCRF3 and SlCRF5 show distinct expression patterns with overlapping specificity in 
vascular tissues 
        An initial broad examination of SlCRFs revealed varying levels of expression in leaf, stem, 
root, and flower (Shi et al., 2012). To better delineate the expression patterns of SlCRF3 and 
SlCRF5 across different stages of tomato development, RT-PCR was performed on: cotyledon, 
hypocotyl, leaves; 15 d (1 leaf), 25 d (1-4 leaves, 4th leaf being the oldest, 1st the youngest), 35 d 
(1-7 leaves, 7th leaf being the oldest, 1st the youngest), 15, 25, and 35 d old stems and roots (root 
tip (RT), lateral root (LR), and whole root (WR)). 
        For leaf and cotyledons, SlCRF3 expression was found to increase in 15 d leaves compared 
to cotyledons followed by similar expression in 25 d leaves. In 35 d old leaves, SlCRF3 
expression was lower in young leaves, increasing with age as to the highest levels in the 6th and 
the 7th (oldest) leaves. In comparison, SlCRF5 expression in cotyledons, 15 and 25 d old leaves 
was at lower and nearly consistent levels than 35 d leaves with the highest expression in leaf 7 
(oldest) of these plants. In stems the expression of SlCRF3 was highest in the oldest 35 d stems, 
whereas expression of SlCRF5 was highest in the young hypocotyl tissue. SlCRF3 and SlCRF5 
expression was also widely observed in the roots across root tips, lateral roots and whole roots of 
15, 25, and 35 d old plants. SlCRF3 expression appeared consistent in the roots, except for lower 
levels in root tips of 25 and 35 d old plants, whereas SlCRF5 was relatively similar in the root 
over development. 
        Stably transformed homozygous proSlCRF::GUS (?-glucuronidase) reporter lines for SlCRF3 
and SlCRF5 were analyzed for in vivo spatial and temporal expression patterns in tomato. 
Independent proSlCRF3::GUS lines showed expression in the emerging radicle during germination, 
seedling shoot apical meristem and vasculature in: 4, 7, and 9 d old seedlings, 15, 25, 35, 85 d old 
leaves, and fruit, as well as RT and LR and vasculature in the rest of the root (Fig. 11 A). 
Expression in proSlCRF5::GUS lines was observed in the embryo, emerging radicle during 
germination, 4 d old seedling, leaf primordia, RT and LR, flowers, as well as in vasculature of 7 
 
102 
 
and 9 d old seedlings, 15, 25 and 35 d old leaves, 35 d old stems, roots, and fruits (Fig. 11 B, a-i; 
l-v). In both SlCRF3 and SlCRF5, the highest GUS expression was observed in 35 d plants 
compared to 15 and 25 d old leaf stages, consistent with RT-PCR analysis. ProSlCRF5 driven GUS 
expression was also observed in vasculature of cotyledons and leaves in Arabidopsis plants 
transformed with proSlCRF5::GUS cassette (Fig. 11 B, j-k). While proSlCRF5::GUS expression was 
generally the strongest in the vasculature especially in the phloem, its expression could also be 
observed in other tissues. 
 
Cytokinin induction of SlCRF3 is primarily in leaves, while SlCRF5 is broadly induced in 
different plant organs  
        While a previous finding indicated a single point of cytokinin induction for SlCRF3 and 
SlCRF5 after 3 h of 5 ?M BA cytokinin treatment in 15 d leaves (Shi et al., 2012), here we 
present a detailed regulation of these genes by a range of cytokinin concentrations, organs/tissues, 
and developmental stages (Fig. 12). The following were examined for SlCRF3 and SlCRF5 
expression levels: leaves and stems from 15, 25, and 35 d plants were treated with cytokinin (1, 5, 
and 10 ?M BA) or DMSO as a vehicle control for 3, 6, 12, and 24 h; roots (RT, LR, WR) from 15 
d plants after treating 14 d seedlings with cytokinin (1, 5, and 10 ?M BA) for 24 h. 
        SlCRF3 was primarily induced by cytokinin in leaves, with only minor expression changes 
in stems and roots (Fig. 12 A). The greatest induction of SlCRF3 was ~4.5 fold by 5 ?M BA at 3 
h in 15 d old leaves, however, there was also 2-3 fold induction at 12 h in both 15 and 25 d old 
leaves, suggesting potential cytokinin regulatory roles of SlCRF3 in leaves at these 
developmental stages. There were only slight inductions under other conditions in leaves stems 
and roots. 
        In contrast, SlCRF5 was induced by cytokinin 2+ fold in at least one condition in leaves, 
stems and roots; although similar to SlCRF3 the highest level of SlCRF5 induction was ~4.8-fold 
by 5 ?M BA at 3 h in 15 d leaf (Fig. 12 B).  Induction of 2.0-2.5 fold was also seen in 25 and 35 
 
103 
 
d old leaf samples. In stems, SlCRF5 appeared to be primarily induced at 25 d by 5 ?M BA 
treatment for 3 h, over 2.5 fold. In roots, SlCRF5 transcript levels were induced more than 2 fold 
in all tissues (RT, LR, and WR), with the highest induction in RT 2.8 fold by 5 ?M BA (Fig. 12 
B). To further confirm this wide range of cytokinin induction for SlCRF5, proSlCRF5::GUS tomato 
and Arabidopsis plants were analyzed after treatment with 5 ?M BA at 3 h in 25 d plants (Fig. 
13). GUS expression of these lines was greatly induced by cytokinin in stem tissue as seen for 
these similar conditions in transcript analysis and root tissues were also highly induced indicating 
that the cytokinin transcriptional induction seen in different parts of the root at 15 d continues at 
this later developmental stage (Fig. 12, 13). In leaves GUS expression was induced by cytokinin, 
strongly in the vasculature of both tomato and Arabidopsis (Fig. 13), which likely could not be 
detected from transcript analysis under the same conditions because that analysis was conducted 
on whole leaves containing a lot of non-vascular tissue (Fig. 12). Overall, these results indicate 
that both SlCRF3 and SlCRF5 expression levels are induced by cytokinin strongly in leaves of 15 
and 25 d old plants, with SlCRF5 also showing strong induction in stems and roots. 
 
SlCRF3 and SlCRF5 are regulated by various abiotic stresses  
Flooding stress 
        In order to investigate the involvement of SlCRF3 and SlCRF5 in flooding stress, 25 d 
leaves, stems, and roots were exposed to water logged conditions for 1, 4, and 7 d. SlCRF3 
showed only slight ~1.5 fold increases in leaf transcript levels at 1 and 7 d, while stem and root 
levels were unchanged, suggesting that SlCRF3 is unlikely to be involved in this stress response 
(Fig. 14 A). In contrast, expression of SlCRF5 in leaves was induced 2+ fold during flooding 
stress treatment with a peak of ~5.5 fold at 4 d (Fig. 14 B). SlCRF5 levels also showed some 
increase in response to flooding in stems, 2.7 fold at 7 d, and in roots, 1.5-2.0 fold at 1 and 7 d 
(Fig. 14 B). This suggests that SlCRF5 is linked to flooding stress, as it is induced in different 
organs over 7 days of this stress, particularly strongly in leaves.  
 
104 
 
Drought stress and recovery 
        Drought stress and response during recovery were examined for SlCRF3 and SlCRF5 in 
plants left unwatered for 7 d and during the 12h after rewatering. SlCRF5 was found to have a 
distinct pattern of regulation in different organs (Fig. 14 B). In leaves, SlCRF5 was highly 
induced ~2.75 fold during drought, then repressed during the first 6 hours of recovery, returning 
to normal levels by 12 h. In contrast, SlCRF5 root transcript was reduced during drought, 
remaining low during recovery until reaching 2.5+ fold induced levels at 12 h of recovery. 
SlCRF5 expression in stems was unchanged during drought stress, but was reduced during 1 and 
3 h recovery, reaching normal levels 6 h recovery. 
        SlCRF3 expression in leaves during drought stress and recovery showed a somewhat similar 
pattern to SlCRF5, with higher expression (1.5 fold) during drought followed by reduced levels 
until 12 h after recovery when SlCRF3 levels returned to normal, although overall transcript 
levels were less effected (Fig. 14 A). In roots, SlCRF3 expression was consistently reduced 
during drought as well as recovery (0.4-0.5), whereas in stems expression remained unchanged 
except for slightly reduced levels around 3 h of recovery (Fig. 14 A). Despite complex patterns of 
changing expression levels, these results indicate that SlCRF5 is strongly regulated in leaves and 
roots during drought and recovery, with SlCRF3 also involved although to a lesser degree. 
Osmotic, oxidative, and ABA hormone stress 
        To examine SlCRF3 and SlCRF5 response to osmotic and oxidative stresses and regulation 
by the stress hormone ABA, 25 d old plants were treated for 3 h with 200 mM mannitol, 10-20 
mM hydrogen peroxide (H2O2), and 50-100 ?M ABA. Mannitol treatment showed little to no 
regulation of either SlCRF3 or SlCRF5 in leaves, stem or roots indicating that these genes are 
unlikely to be linked to osmotic stress (Fig. 14). 
        Both SlCRF3 and SlCRF5 were induced by H2O2 primarily in roots and to a lesser degree in 
stems, with similar levels at the different concentrations used. SlCRF5 transcript levels increased 
4 fold in roots and 2 fold in stems, while SlCRF3 levels increased 2.25 fold in roots and 1.5 fold 
 
105 
 
in stems (Fig. 14). No induction was observed for either SlCRF3 or SlCRF5 in the leaves. These 
findings indicate that these genes may be linked to oxidative stress processes in roots and stems. 
        In response to exogenous ABA treatment SlCRF3 expression was mostly unaffected, 
showing only minor (1.6 fold) induction at 50 ?M ABA in roots, with no induction at higher, 100 
?M levels (Fig. 14 A). SlCRF5 expression was unaffected in any tissue at 50 ?M, but did show 
induction to 2.5 fold levels in roots at the higher ABA concentration (Fig. 14 B). This may 
suggest that high levels of ABA could be involved in the stress regulation of SlCRF5 in leaves. 
Temperature stress 
        In order to determine SlCRF3 or SlCRF5 regulation by cold or heat stress, 25 day old plants 
were exposed to 4? for 24 h and 45? for 1 h. During cold stress, SlCRF3 was found to be slightly 
repressed in leaves (0.57) and stems (0.85) and unchanged in roots. Whereas SlCRF5 expression 
was unaffected in leaves and stems, but induced ~2.4 fold in roots, indicating a possible role for 
SlCRF5 in cold response in roots. Heat stress treatment resulted in little change in either SlCRF3 
or SlCRF5 levels in the plant suggesting these genes are unlikely to be connected to this stress. 
 
Reduced SlCRF5 transcript level results in altered plant development  
        To gain insight into the role of SlCRF5, antisense transgenic plants were generated to 
determine the effect of reduced a SlCRF5 level as the plant develops. Three independent 
homozygous antisense lines SlCRF5 AS1-3, with reduced SlCRF5 levels were examined for 
phenotypic changes from normal plant development (Fig. 15 A, B). Several distinct changes were 
seen in SlCRF5 AS plants in different organs throughout development (Fig. 15). Early effects 
were seen in SlCRF5 AS seedlings (12d) that showed a highly stunted primary root, a complete 
lack of lateral roots, and a late emergence of the first true leaves (Fig. 15 A, C, D). SlCRF5 AS 
plants continued to have altered effects in roots at later developmental stages, as the primary root 
never elongates, nor do lateral roots ever emerge. However, plants do produce adventitious roots, 
which appear to take over as the main root structures (Fig. 15 B, C, D). Continued phenotypic 
 
106 
 
analysis of soil grown SlCRF5 AS plants over the rest of development revealed a number of aerial 
differences in SlCRF5 AS plants including: smaller, poorly developed leaves with thin leaflet 
laminas and short petioles; thin stems; delayed flowering; and reduced numbers of flowers and 
fruits containing lower seed number (Fig. 15 E). Despite this number of altered morphological 
factors, some features such as overall plant height and leaf number remain unchanged. Generally, 
the organs and regions where SlCRF5 AS plants have altered morphology correspond to SlCRF5 
transcript and GUS expression patterns. Together these results clearly indicate the importance of 
SlCRF5 in tomato developmental stages from seedling through to seed production. 
 
Discussion:  
        Cytokinin is involved in numerous plant growth and developmental processes, yet only a 
few cytokinin-regulated genes have been investigated in tomato. This study presents the detailed 
examination of the tomato CRF genes, SlCRF3 and SlCRF5 showing their endogenous expression 
patterns, regulation by hormones and abiotic stresses, as well as roles for SlCRF5 in plant 
development. 
        Endogenous expression analysis was performed throughout the plant for SlCRF3 and 
SlCRF5 examining both transcript levels by RT-PCR and promoter::GUS reporter analysis. For 
SlCRF3, transcript levels were widely abundant and found to generally increase with age in 
leaves and stems and with higher levels in organs of mature 35 d old plants, whereas in roots 
levels were similar across developmental stages except for reduced levels in RT of older plants 
(Fig. 10). SlCRF3 expression using proSlCRF3::GUS transgenic lines was consistent with RT-
PCR analysis, such as expression in roots, stems and leaves, while additional expression was seen 
in other tissues including the emerging radicle and fruit. Importantly strong GUS staining was 
found in vascular tissues in several organs over development, suggesting this is a primary site of 
SlCRF3 expressed (Fig. 11). SlCRF3 vascular expression is consistent with observations for other 
standard CRFs in Arabidopsis and may be a general feature of the CRF group (Zwack et al., 
 
107 
 
2012). It is worth noting since SlCRF3 has a unique protein structure (with two alternating CRF 
and AP2 DNA-binding domains), which is atypical of other CRFs that contain only a single CRF 
and AP2 DNA-binding domain (Rashotte and Goertzen, 2010). Possibly because of this unique 
structure there is no direct ortholog of SlCRF3 in Arabidopsis with which to compare expression, 
as SlCRF3 does not fall into any of the standard clades that most CRFs are subdivided into 
(Zwack et al., 2012). Despite the differences of SlCRF3 from other CRFs, it is clearly expressed 
strongly over a range of organs in the plant across development in many cases preferentially in 
vascular tissue. 
        For SlCRF5, RT-PCR transcript levels were also found to be widely present across all 
organs examined at different developmental stages. In leaves expression levels were higher older 
leaves of mature 35 d plants, whereas in stems levels were higher in younger plants and in the 
hypocotyl (Fig. 10). GUS expression driven by SlCRF5 promoter was also found in various 
organs over development consistent with results from the RT-PCR transcript analysis, in addition 
to showing expression in the embryo, apical tissues, flowers, and fruit (Fig. 11). Interestingly, in 
leaves GUS expression became stronger as the plant matured, until being reduced in senescing 
leaves: a pattern similar to that seen in AtCRF6, an Arabidopsis ortholog of SlCRF5 (Zwack et 
al., 2013). This could suggest that SlCRF5 may function like AtCRF6 as a negative regulator of 
senescence, although further study is still required to determine this. Tissue level examination of 
SlCRF5 GUS stained material revealed vascular expression in a number of organs (leaves, roots, 
stems, fruit), which appears to be preferentially found in the phloem (Fig. 11), in a manner 
consistent with general tissue specific CRF patterns previous seen (Zwack et al., 2012). A 
possible reason for phloem-specific expression is the presence of phloem targeting cis-elements 
present in the SlCRF5 promoter similar to other tomato and Arabidopsis CRFs (Zwack et al., 
2012). Both the vascular and phloem expression of SlCRF5 suggests a role for SlCRF5 in phloem 
and cytokinin regulated processes such as sink/source regulation or senescence (Mok and Mok, 
2001; Werner and Schm?lling, 2009). 
 
108 
 
        Cytokinin induction of CRFs is not universal and appears to be specific to distinct CRF 
clades (Zwack et al., 2012). However, this generalization is based primarily on examinations of 
cytokinin regulation of CRFs in Arabidopsis or from tomato leaves (Rashotte et al., 2003; 
Rashotte et al., 2006; Rashotte and Goertzen, 2010; Shi et al., 2012). Transcriptional regulation of 
SlCRF3 and SlCRF5 were studied here to generate a detailed profile of regulation by cytokinin 
over different developmental stages in leaves and stems and different regions in roots. Results 
confirm previous finding that both SlCRF3 and SlCRF5 are induced by cytokinin in young leaves 
and show that both genes reach maximum induction after 3h by 5?M BA in 15 d old leaves (Fig. 
12; Shi et al., 2012) as well as revealing novel organ and stage regulation by cytokinin. SlCRF3 
showed additional cytokinin induction at a later point (12h) in both 15 and 25 d old leaves, also 
with possibly minor levels of induction in young stems. Roots and older stems showed little to no 
induction indicating that SlCRF3 appears to be leaf specific in its cytokinin regulation. Again as 
SlCRF3 does not have a direct ortholog in Arabidopsis or fall into any of the five CRF clades 
(Zwack et al., 2012), the role of this gene in cytokinin regulation or cytokinin regulated plant 
processes is difficult to predict, although it does seem to function in some cytokinin response. 
        In contrast, SlCRF5 is strongly induced by cytokinin in both stems and roots as well as in 
leaves of 15, 25, and 35 d old leaves (Fig. 12). In stems there was moderate to strong cytokinin 
induction at 3 h and there was 2+ fold induction in each part of the root with different cytokinin 
concentrations. In leaves SlCRF5 showed induction 2+ fold levels at both 3 h in 15 and 35 d old 
plants with levels approaching 2 fold in 25 d old plants, as well as at 12 h of each developmental 
stage, with lesser induction at 6 and 24 h that could suggest a bi-phasic regulation by cytokinin. 
Although AtCRFs have variable cytokinin induction levels over the first 24 h of treatment, 
including the orthologous clade III AtCRF5 and AtCRF6, the pattern seen for SlCRF5 here is 
distinct from other CRF genes (Rashotte et al., 2006). 
        Although there has been limited work examining the role of CRFs in stress response, these 
findings indicate that particular CRF genes can be regulated by biotic (Zhou et al., 1997; Gu et 
 
109 
 
al., 2002) and abiotic stresses (Park et al., 2001; Shi et al., 2012, Zwack et al., 2013). These 
studies were not focused on either SlCRF3 or SlCRF5 and their only link to stress regulation is a 
minor induction by salt stress for SlCRF5 (Shi et al., 2012). Here we found that both SlCRF3 and 
SlCRF5 were transcriptionally regulated by different abiotic stresses. SlCRF3 transcript levels 
were largely unaffected by flooding, osmotic, and heat stress or by exogenous ABA and would 
appear not to be connected to these processes (Fig. 14A). SlCRF3 did show a strong induction 
from oxidative stress in roots and a repression from cold stress in both leaves and stems. 
Expression levels were also affected during drought stress, although larger effects including a 
strong reduction in roots occurred during the 12 hours of the recovery period. This suggests that 
SlCRF3 may be involved in these abiotic stresses or recovery from them to different degrees in a 
manner that is distinct at the organ level. 
        SlCRF5 also showed regulation by number of abiotic stresses in a pattern different from that 
of SlCRF3 (Fig. 14). SlCRF5 was induced by different types of water stresses: excess levels of 
flooding, in leaves, stems and roots over the entire period examined; and lack of water during 
drought stress in leaves, followed by a complex expression changes in different organs during 
recovery. This links SlCRF5 to water stress responses. Similar to SlCRF3, SlCRF5 expression 
was unaffected by osmotic and heat stress and while SlCRF5 also was regulated by both 
oxidative and cold it was to different degrees: SlCRF5 was induced to higher levels by oxidative 
stress in roots and stems; in contrast was induced by cold in roots. Interestingly SlCRF5 also 
appeared to be induced in leaves at the highest levels of ABA, suggesting either a general stress 
link or a potential cytokinin-ABA antagonistic response (Tanaka et al., 2006; Polansk? et al., 
2007). 
        The induction of both SlCRF3 and SlCRF5 by H2O2 in roots could suggest an involvement 
with Reactive Oxygen Species (ROS) with previous links to controlling root meristem size 
(Tsukagoshi et al., 2010) and other aspects of root growth and development (Passardi et al., 2006; 
Cheng et al., 1995; Vernoux et al., 2000; Dunand et al., 2007). It is unclear what the differential 
 
110 
 
regulation of SlCRF3 and SlCRF5 by cold stress means. However, a similar cold induction 
pattern as in SlCRF5 has been seen for other CRFs, including in roots of AtCRF3 and AtCRF4 
(Compton, 2012). Additionally, SlCRF5 has been recently shown to be induced by cold in a 
microarray analysis examining both cold tolerant and -sensitive varieties, suggesting that SlCRF5 
is definitely linked to cold stress response (Liu et. al., 2012). 
        Further examination of the role SlCRF5 plays over development was conducted in observing 
the effects of having reduced levels of SlCRF5 revealing that in SlCRF5 AS lines there were 
profound effects at multiple stages and in multiple organs in plant development (Fig. 15). 
Previous studies of CRF mutants linked them to roles in embryo, cotyledon, and leaf 
development, as well as vascular patterning and senescence (Rashotte et al., 2006; Zwack et al., 
2012, 2013; Zwack and Rashotte, 2013). In SlCRF5 AS lines one of the primary developmental 
alterations was in the root system that had a highly reduced primary root and a complete lack of 
lateral roots even after many weeks of growth. Eventually these plants produce adventitious roots 
that appear to take over the role of the major root and allow further plant growth. This phenotype 
is similar to phenotypes in multiple mutants of the cytokinin signaling pathway in Arabidopsis 
including the receptor AHKs and the phosphotransfer protein AHPs, suggesting that SlCRF5 is 
likely an essential step in a similar cytokinin signaling pathway in tomato regulating root growth 
(reviewed in Gupta and Rashotte 2012). Additional developmental defects are found in aerial 
tissues, including reduced leaf size, flower, fruit, and seed number. The reduced fertility 
corresponds to previous finding of a double knockout crf5,6 in Arabidopsis that is embryo lethal 
(Rashotte et al., 2006); as such the reduced seed number in SlCRF5 AS might be expected as 
SlCRF5 is the tomato ortholog of both AtCRF5 and AtCRF6 (Zwack et al., 2012). Regions of the 
SlCRF5 AS lines that show developmental defects largely match the GUS reporter expression 
patters for SlCRF5. 
Conclusion: 
 
111 
 
        In summary, a detailed examination of two genes from tomato-SlCRF3 and SlCRF5 with 
respect to their expression patterns, cytokinin regulation, abiotic stress response, and the role of 
SlCRF5 was performed. Results revealed that SlCRF3 and SlCRF5 genes have distinct expression 
patterns in different organs during plant development. These genes also showed differential 
regulatory patterns by cytokinin over development and by abiotic stress suggesting a diverse role 
for SlCRFs in hormone regulation and in stress in plants. Additionally, SlCRF5 antisense 
knockdown plants produced several defects suggesting its important role in development. 
Overall, these findings present basic information on the expression and regulation of SlCRF3 and 
SlCRF5 genes relevant for advanced research on tomato development. 
 
Acknowledgments 
        The authors gratefully acknowledge members of the Rashotte lab for critical reading of the 
manuscript. This work was funded by the USDA-NRI (grant 2008-35304-04457) and the AAES-
HATCH (grants 370220-310007-2055 and 370228-310010-2055). 
 
 
 
 
 
 
 
 
 
 
 
 
 
112 
 
Literature Cited 
 
Cheng JC, Seeley KA, Sung ZR. Arabidopsis genes required for cell proliferation at the root tip. 
Plant Physiol 1995;107:365-76. 
 
Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation 
of Arabidopsis thaliana. Plant J 1998;16:735-43. 
 
Compton MA. Cytokinin Response Factor 4: A Role in Development During Cold Stress in 
Arabidopsis thaliana http://hdl.handle.net/10415/32312012.  
 
Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM. CRFs form protein?protein interactions with 
each other and with members of the cytokinin signalling pathway in Arabidopsis via the CRF 
domain.  J Exp Bot 2011;62:4995-5002. 
 
Dunand C, Crevecoeur M, Penel C. Distribution of superoxide and hydrogen peroxide in 
Arabidopsis root and their influence on root development: possible interaction with peroxidases. 
New Phytol 2007;174:332-41. 
 
Duque AS, de Almeida AM, da Silva AB, da Silva JM, Farinha AP, Santos D, et al. Abiotic 
Stress Responses in Plants: Unraveling the Complexity of Genes and Networks to Survive. 
http://dx.doi.org/10.5772/52779 2013.  
 
Gu Y-Q, Wildermuth M, Chakravarthy S, Loh Y-T, Yang C, He X, et al. Tomato transcription 
factors Pti4, Pti5, and Pti6 activate defense responses when expressed in Arabidopsis. Plant Cell 
2002;14:817-31. 
 
Gupta S, Rashotte AM. Down-stream components of cytokinin signaling and the role of cytokinin 
throughout the plant. Plant Cell Rep 2012;31:801-12. 
 
Liu H, Ouyang B, Zhang J, Wang T, Li H, Zhang Y, et al. Differential Modulation of 
Photosynthesis, Signaling, and Transcriptional Regulation between Tolerant and Sensitive 
Tomato Genotypes under Cold Stress. PLoS One 2012;7:e50785.  
 
Mok DW, Mok MC. Cytokinin metabolism and action.  Annu Rev Plant Physiol Plant Mol Biol 
2001;89:89-118. 
 
Nishiyama R, Watanabe Y, Fujita Y, Le D T, Kojima M, Werner T, et al. Analysis of cytokinin 
mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of 
cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell 
2011;23:2169-83. 
 
Pandey SK, Nookaraju A, Upadhyaya CP, Gururani MA, Venkatesh J, Kim D-H, et al. An 
Update on Biotechnological Approaches for Improving Abiotic Stress Tolerance in Tomato. Crop 
Sci 2011;51:2303-24. 
 
Park J, Park C-J, Lee S-B, Ham B-K, Shin R, Paek K-H. Overexpression of the tobacco Tsi1 gene 
encoding an EREBP/AP2-type transcription factor enhances resistance against pathogen attack 
and osmotic stress in tobacco. Plant Cell 2001;13:1035-46. 
 
 
113 
 
Passardi F, Tognolli M, De Meyer M, Penel C, Dunand C. Two cell wall associated peroxidases 
from Arabidopsis influence root elongation. Planta 2006;5:965-74. 
 
Peleg Z, Blumwald E. Hormone homeostasis and abiotic stress tolerance in crop plants. Curr Op 
Plant Biol 2011;14:1-6. 
 
Polansk? L, Vi??nkov? A, Nov?kov? M, Malbeck J, Dobrev PI, Brzobohat? B, et al. Altered 
cytokinin metabolism affects cytokinin, auxin, and abscisic acid contents in leaves and 
chloroplasts, and chloroplast ultrastructure in transgenic tobacco. J Exp Bot 2007;58:637-49.  
 
Qin F, Shinozaki K, Yamaguchi-Shinozaki K. Achievements and Challenges in Understanding 
Plant Abiotic Stress Responses and Tolerance. Plant Cell Physiol 2011;52:1569-82. 
 
Rashotte AM, Carson SDB, To, JPC, Kieber JJ. Expression profiling of cytokinin action in 
Arabidopsis. Plant Physiol 2003;132:1998-2011. 
 
Rashotte AM, Goertzen LR. The CRF domain defines cytokinin response factor proteins in 
plants. BMC Plant Biol 2010;10:74. 
 
Rashotte AM, Mason MM, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ. A subset of 
Arabidopsis AP2 transcription factors mediate cytokinin responses in concert with a two-
component pathway. Proc Natl Acad Sci USA 2006;103:11081-85. 
 
Shi X, Gupta S, Rashotte AM. Solanum lycopersicum cytokinin response factors (SlCRFs) genes: 
characterization of CRF domain containing ERF genes in tomato. J Exp Bot 2012;63:973-82. 
 
Tanaka Y, Sano T, Tamaoki M, Nakajima N, Kondo N, Hasezawa S. Cytokinin and auxin inhibit 
abscisic acid-induced stomatal closure by enhancing ethylene production in Arabidopsis. J Exp 
Bot 2006;57:2259-66. 
 
Tsukagoshi H, Busch W, Benfey PN. Transcriptional regulation of ROS controls transition from 
proliferation to differentiation in the root. Cell 2010;143:606-16. 
 
Vernoux T, Wilson RC, Seeley KA, Reichheld JP, Muroy S, Brown S, et al. The ROOT 
MERISTEMLESS1/CADMIUM SENSITIVE2 gene defines a glutathione-dependent pathway 
involved in initiation and maintenance of cell division during postembryonic root development.  
Plant Cell 2000;12:97-109. 
 
Werner T, Schm?lling T. Cytokinin action in plant development. Curr Opin Plant Biol 
2009;12:527-38. 
 
Wilkinson S, Kudoyarova GR, Veselov DS, Arkhipova TN, Davies WJ. Plant hormone 
interactions: innovative targets for crop breeding and management. J Exp Bot 2012;63:3499-
3509. 
 
Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ. An ?Electronic Fluorescent 
Pictograph? browser for exploring and analyzing large-scale biological data sets. PLoS One 
2007;2:e718. 
 
 
114 
 
Zhou J, Tang X, Martin G. The Pto kinase conferring resistance to tomato bacterial speck disease 
interacts with proteins that bind a cis-element of pathogenesis-related genes. EMBO J 
1997;16:3207-18. 
 
Zwack PJ, Rashotte AM. Cytokinin inhibition of leaf senescence. Plant signaling behavior 
2013;8:e24737. 
 
Zwack PJ, Shi X, Robinson BR, Gupta S, Compton MA, Gerken DM, et al. Vascular Expression 
and C-Terminal Sequence Divergence of Cytokinin Response Factors in Flowering Plants. Plant 
Cell Physiol 2012;53:1683-95. 
 
Zwack PJ, Shi X, Robinson BR, Risley MG, Rashotte AM. Cytokinin Response Factor 6 
Negatively Regulates Leaf Senescence and is Induced in Response to Cytokinin and Numerous 
Abiotic Stresses. Plant Cell Physiol 2013;54:971-81. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
115 
 
 
 
Fig.10 SlCRF3 and SlCRF5 expression patterns in three different stages of leaf, stem, and root. 
RT-PCR analysis of SlCRF3 and SlCRF5 in (A) cotyledon, leaf (15 d-1 leaf, 25 d-4 leaves, leaf 
4th being the oldest, and 35 d-7 leaves, leaf 7th being the oldest), (B) hypocotyl, stem (15, 25, and 
35 d), and (C) root (root tip (RT), lateral roots (LR), whole roots (WR) of 15, 25, and 35 d) is 
shown. The TIP41 gene serves as an internal control.  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
116 
 
            
 
Fig.11 Promoter-driven GUS reporter gene expression for SlCRF3 and SlCRF5 is seen in the 
vascular tissues of various organs. (A) SlCRF3 expression in the radicle (a), cotyledons of 4-7 d 
old seedlings after germination (DAG) (b-c), shoot apex of 9 d old seedling (d), leaves of 15, 25, 
35, 85 d (e-h), root tip and lateral root (i-j), and mature fruit (k). (B) SlCRF5 expression in 
embryo (a), radicle (b), vascular tissue of 4-9 d old seedlings after germination (DAG) (c-e), 
leaves of 15, 25, 35, 85 d (f-i), Arabidopsis cotyledons (j) and leaf (k), in phloem tissue as seen 
through free-hand cross-section of mid-vein of 35 d old leaf (l), 35 d old stem (m-n), primary root 
A
B
 
117 
 
(o-p), root tip (q), lateral roots (r) of 35 d old plants, reproductive organs: sepals, petals, anthers, 
stigma (s-u), and mature fruit. X, xylem; P, phloem. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
118 
 
 
Fig.12 Expression analyses of SlCRF3 and SlCRF5 in response to benzyladenine (BA). 
Expression patterns of SlCRF3 (A) and SlCRF5 (B) in response to 1, 5, and 10 ?M BA in 15, 25, 
and 35 d old leaf and stem treated for 3, 6, 12, and 24 h and 15 d old root treated for 24 h is 
shown. Relative expression was measured after performing qRT-PCR and the data presented are a 
mean?SE (two biological replicates). TIP41 was used as an internal control.   
 
 
 
 
Le a f
St e m
R o o t
A B
0 . 0
1 . 0
2 . 0
3 . 0
4 . 0
5 . 0
6 . 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
0 . 0
1 . 0
2 . 0
3 . 0
4 . 0
5 . 0
6 . 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0
3 . 5
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0
3 . 5
4 . 0
RT LR WR
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
0 . 0
0 . 2
0 . 4
0 . 6
0 . 8
1 . 0
1 . 2
1 . 4
1 . 6
1 . 8
2 . 0
RT LR WR
0 .0 0
0 .5 0
1 .0 0
1 .5 0
2 .0 0
2 .5 0
3 .0 0
3 .5 0
4 .0 0
4 .5 0
5 .0 0
3h 6h 12h 24h 3h 6h 12h 24h 3h 6h 12h 24h
1 5  D 2 5  D 3 5  D
1 u M
5 u M
1 0 u M
 
119 
 
 
 
Fig.13 GUS expression is induced in response to BA in proSlCRF5::GUS transgenic plants. (A) 
Increased GUS expression in 25 d old proSlCRF5::GUS transgenic roots (d-e) and leaf (f) treated 
with 5 ?M BA compared to the roots (a-b) and leaf (c) treated with DMSO as control. (B) 
Induced GUS expression in root (c) and leaf (d) of 25 d old Arabidopsis plants harboring 
proSlCRF5::GUS cassette treated with 5 ?M BA compared to control root (a) and leaf (b). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
- BA + BA
A B
eda b
fc
- BA + BA
a
db
c
 
120 
 
 
Fig.14 Expression analyses of SlCRF3 and SlCRF5 in response to abiotic stresses. Relative 
expression of SlCRF3 (A) and SlCRF5 (B) in 25 d leaf, stem, and root in response to abiotic 
stress conditions after treatment versus non-treated controls is shown. qRT-PCR was performed 
on samples exposed to flood conditions for 1, 4, and 7 d (a, b), drought for 7 d and recovery 1, 3, 
6, 12 h (c, d), treatment with 200 mM mannitol, and 10 and 20 mM H2O2 for 3 h (e, f), treatment 
with 50 and 100 ?M ABA for 3 h (g, h), and exposure to 4? C for 24 hours and 45? C for 1 hr (I, 
j). Data presented are a mean?SE (two biological replicates). SleIF4A was used as an internal 
control. 
0 .0
0 .5
1 .0
1 .5
2 .0
2 .5
3 .0
L e a f  
S t e m  
R o o t  
R
e
l
a
tiv
e
 e
x
p
r
e
s
s
i
o
n
 o
f
 
S
l
C
R
F
3
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
3
A B A  
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
3
0 . 0
0 . 2
0 . 4
0 . 6
0 . 8
1 . 0
1 . 2
1 . 4
1 . 6
1 . 8
2 . 0 L e a f  
S te m  
R o o t 
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
5
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0
L e a f  
S t e m  
R o o t  
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
3
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
F l o o d i n g
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
5
0 . 0
1 . 0
2 . 0
3 . 0
4 . 0
5 . 0
6 . 0
7 . 0
L e a f  
S te m  
R o o t  
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
L e a f  
S t e m  
R o o t  
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
5
D r o u g h t  a n d  
R ec o v er y
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0
3 . 5
4 . 0 L e a f  
S te m  
R o o t 
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
3
0 . 0
0 . 2
0 . 4
0 . 6
0 . 8
1 . 0
1 . 2
1 . 4
1 . 6
1 . 8
L e a f  
S te m  
R o o t 
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
M a n n i t o l   
a n d  H
2
O
2
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
5
0 . 0
1 . 0
2 . 0
3 . 0
4 . 0
5 . 0
6 . 0 L e a f  
S te m  
R o o t  
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0
3 . 5
L e a f  
S te m  
R o o t 
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
T e m p e r a t u r e  
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
L e a f  
S te m  
R o o t 
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
0 .0
1 .0
2 .0
3 .0
4 .0
5 .0
6 .0
7 .0
L e a f  
S te m  
R o o t  
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
3 . 0 L e a f  
S t e m  
R o o t  
R
e
l
a
ti
v
e
 
e
x
p
r
e
s
s
i
o
n
 
o
f
 
S
l
C
R
F
5
 
121 
 
 
 
 
Fig.15 SlCRF5 knockdown leads to stunted primary roots and absence of lateral roots. (A) Roots 
of 12 DAG and (B) 48 DAG antisense seedlings (AS1- AS3), with three plants each were 
compared to M-tom seedlings. Lateral roots (LR) and adventitious roots (Ad). Reduced transcript 
levels were examined in both cases by RT-PCR (C) Table of mean values of LR and Ad in M-
tom and AS1-AS3 seedlings ? SE (Three biological replicates). (D) Primary root length of 12 
DAG and 48 DAG AS1-AS3 seedlings compared to M-tom seedlings. Data presented are a 
mean?SE (Three biological replicates). TIP41 was used as an internal control in all these 
experiments. (E) M-tom vs AS3 at 65 DAG stage. 
C
Nu m b e r  o f  L R Nu m b e r  o f  A d Nu m b e r  o f  L R Nu m b e r  o f  A d Nu m b e r  o f  L R Nu m b e r  o f  A d Nu m b e r  o f  L R Nu m b e r  o f  A d
Y o u n g  S e e d lin g s 8 . 6 7 ( + / - )  1 . 6 7 0 0 0 0 0 0 0
O ld  S e e d lin g s 2 2 . 3 3 ( + / - )  1 . 2 0 4 ( + / - )  1 . 1 5 0 2 ( + / - )  1 . 1 5 0 2 . 6 7 ( + / - )  1 . 2 0 0 2 . 6 7 ( + / - )  1 . 2 0
M i c r o - T o m A S 1 A S 2 A S 3
D
AS 1 AS 2 AS 3M - T om
Ad
Ad
Ad
LR
AS 1 AS 2 AS 3M - T om
A
A S 1 A S 2 A S 3M - T o m
S lC R F5
T I P 4 1
A S 1 A S 2 A S 3     M - T o m
S l C RF 5
T I P 4 1
LR LR
1 . 0 0             0 . 4 4             0 . 5 5            0 . 3 3 1 . 0 0           0 . 2 8              0 . 4 7              0 . 4 7   
Mi c r o - to m A S 3   E