GENOMICS OF PERMETHRIN RESISTANCE IN THE SOUTHERN HOUSE 
MOSQUITO, CULEX QUINQUEFASCIATUS SAY 
 
 
by 
 
William Reid 
 
 
 
 
A dissertation submitted to the Graduate Faculty of 
Auburn University 
in partial fulfillment of the 
requirements for the Degree of 
Doctor of Philosophy 
 
Auburn, Alabama 
May 3, 2014 
 
 
 
 
 
 
 
Approved by 
 
Nannan Liu, Chair, Alumni Professor 
Kathy Flanders, Professor 
John Murphy, Professor 
Scott R. Santos, Associate Professor 
 
 
 
 
 
ii 
 
 
 
 
 
 
Abstract 
 
 
 The Southern house mosquito, Culex quinquefasciatus, is a vector of several human 
diseases including West Nile fever and St. Louis encephalitis, owing to its blood feeding 
behavior whereby the female takes multiple blood meals. Vector control of mosquitoes has been 
a critical part of the current global strategy to control mosquito-associated diseases. Insecticides, 
especially pyrethroids, are important components in the vector-control effort. The successful 
management of mosquitoes, however, is negatively impacted by the development of resistance to 
insecticides within mosquito populations and the lack of the knowledge on the molecular basis of 
blood feeding behavior. The goals of our research, thus, were to gain a better understanding of 
insecticide resistance in Cx. quinquefasciatus and to identify the genes that may be involved in 
preparing the female for the taking of a blood meal with four specific objectives: 1) Characterize 
the genes up-regulated in insecticide-resistant mosquitoes, 2) Determine the genes that are 
differentially-expressed in response to insecticide treatment, 3) Investigate the cytochrome P450 
detoxification genes in resistance, 4) Examine the changes in the gene expression profiles of 
newly-eclosed females as they become old enough to take a blood meal and also in response to 
blood feeding. 
 RNA-Seq was used to investigate the gene expression profiles of a highly permethrin-
resistant strain of Cx. quinquefasciatus, and to investigate the changes in the gene expression 
levels after exposure to permethrin. Overall, we identified multiple genes up-regulated in 
insecticide-resistant mosquitoes, including genes involved in detoxification, regulation, and 
 
iii 
 
proteases. We further identified that detoxification genes and proteases were up-regulated in 
response to permethrin exposure, while serum storage proteins were down-regulated, suggesting 
that fourth instar Cx. quinquefasciatus delay development to the pupal stage in response to 
insecticide challenge, possibly in response to a cessation of feeding as a means of behavioral 
resistance in order to reduce oral exposure to permethrin. To better understand which 
detoxification genes identified in Cx. quinquefasciatus were important in other mosquito species, 
we investigated the gene expression profiles of the cytochrome P450 genes in a pyrethroid-
resistant field strain of the yellow fever mosquito, Aedes aegypti using qRT-PCR. We identified 
that multiple cytochrome P450 genes were up-regulated, and functional studies revealed that two 
of the up-regulated P450s, CYP4D4 and CYP4J15v1 could confer resistance to permethrin when 
over-expressed in a GAL4:UAS enhancer trap Drosophila melanogaster system. These 
cytochrome P450s were likely involved in the permethrin resistance response of mosquitoes. 
Examination of the genes in response to the blood feeding was conducted by determining the 
temporal changes in gene expression from newly eclosed female adults to those capable of taking 
a blood meal using RNA-Seq techniques. We found that while no females would freely take a 
blood meal prior to 48 h post-eclosion, the main gene expression changes in newly-eclosed 
females occurred within the initial 12-24 h post-eclosion, including genes encoding salivary 
proteins, odorant-binding proteins, proteases, and cuticular proteins. A smaller second peak of 
up-regulated genes was identified at 48 ? 60 h post-eclosion, which coincided with the onset of 
the maximal time-to-mating for Cx. quinquefasciatus. Taken together, these results suggested 
that the genes needed for blood feeding in Cx. quinquefasciatus are primarily up-regualted within 
12-24 h post-eclosion, while other later genes may be up-regulated in response to mating. 
 
 
 
iv 
 
 
 
 
 
 
Acknowledgments 
 
 
 I am deeply indebted to Dr. Nannan Liu and thank her for all of her help, support, advice, 
encouragement, and teaching. She the epitome of not only what a graduate advisor should be in 
graduate education, but also how scientific research is best done. I would also like to thank my 
committee members, Dr. Kathy Flanders, Dr. John Murphy, Dr. Eric Peatman, and in particular 
Dr. Scott Santos for introducing me to Linux- I had no idea how powerful a few lines of code 
could be prior to taking the red pill in your Biocomputing course. I would also like to thank our 
lab group, in particular Dr. Lee Zhang for all of his help and ideas. Sincere thanks also to Drs. 
Ting Li, Ting Yang, Chunwang Cao, Huqi Liu, Lin He, and Fang Tang, as well as the rest of our 
past and present lab members- Li Tian, Ming Li, Feng Liu, Youhui Gong, Xuechun Feng, and Ye 
Zi, it has been a great time taking this journey with you. I would also like to thank Dr. Julia 
Pridgeon for recommending me to Auburn, this has been a great experience and I can?t thank you 
all enough. I would also like to thank the Department of Entomology and Plant Pathology for all 
of the support that they provided in terms of education, professional growth, funding, and 
resources. I also want to thank my old lab groups in Florida and Vermont who always supported 
me in my studies and work and I thank all of my friends especially the adventurous Bob and Deb 
for all of their support over the years. Finally, I especially thank my parents Bill and Linda, and 
my sister Wendy and her family, without all of your support and encouragement I wouldn?t have 
gotten this far. Finally, thanks to my Aunt Pat for all of the conversations we had on my way 
home from the lab, they were really nice times.  
 
v 
 
 
 
 
 
 
Table of Contents 
 
 
Abstract ........................................................................................................................................... ii 
Acknowledgments.......................................................................................................................... iv 
List of Tables ................................................................................................................................... x 
List of Illustrations ........................................................................................................................ xii 
List of Abbreviations.................................................................................................................... xvi 
Chapter 1: Literature Review .......................................................................................................... 1 
1.1 Insects and insecticides ......................................................................................................... 1 
1.2 Insecticide resistance ............................................................................................................ 2 
1.3 Mechanisms of insecticide resistance ................................................................................... 2 
1.3.1 Increased metabolic detoxification ................................................................................ 3 
1.3.1.1 Cytochrome P450 monooxygenase-mediated detoxification ................................. 3 
1.3.1.2 Hydrolase-mediated detoxification ......................................................................... 4 
1.3.1.3 Glutathione S-transferase-mediated detoxification ................................................. 5 
1.4 Target site insensitivity ......................................................................................................... 5 
1.4.1 Insensitivity of the voltage-sensitive sodium ion channel ............................................. 5 
1.4.2 Insensitivity of acetylcholinesterase .............................................................................. 7 
1.4.3 Insensitivity of the gamma-aminobutyric acid receptor ................................................ 7 
1.5 Other mechanisms of insecticide resistance ......................................................................... 8 
1.5.1 Decreased penetration .................................................................................................... 8 
1.5.2 Behavioral/Other resistance ........................................................................................... 9 
1.6 Insecticide cross resistance ................................................................................................. 10 
1.7 Interaction of insecticide resistance factors ........................................................................ 10 
1.8 Culex quinquefasciatus an insect pest..................................................................................11 
1.9 Insecticide resistance in Cx. quinquefasciatus .................................................................... 12 
1.10 Next generation sequencing .............................................................................................. 15 
 
vi 
 
1.10.1 Illumina mRNA-Seq sequencing ............................................................................... 16 
1.10.2 Gene expression analysis using RNA-Seq ................................................................. 17 
Chapter 2: Research Goal and Specific Objectives ...................................................................... 18 
2.1 Introduction ......................................................................................................................... 18 
2.2 The goal of research and specific objectives ...................................................................... 19 
2.2.1 Characterization of the genes differentially expressed between the HAmCqG8 strain 
and its parental HAmCqG0 strain .......................................................................................... 20 
2.2.2 Characterize the genes differentially expressed upon exposure to permethrin ............ 20 
2.2.3 Characterization of the up-regulation of P450 genes in a different mosquito species . 21 
2.2.4 Characterization of the changes in gene expression in newly eclosed female Cx. 
quinquefasciatus ................................................................................................................... 22 
2.3 Significance......................................................................................................................... 23 
Chapter 3: The Transcriptome Profile of the Mosquito Culex quinquefasciatus Following 
Permethrin Selection ..................................................................................................................... 24 
3.1 Abstract ............................................................................................................................... 24 
3.2 Introduction ......................................................................................................................... 25 
3.3 Materials and Methods ........................................................................................................ 27 
3.3.1 Mosquito strains ........................................................................................................... 27 
3.3.2 RNA extraction ............................................................................................................ 28 
3.3.3 RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
processing ............................................................................................................................. 28 
3.3.4 Gene expression validation using quantitative real-time PCR (qRT-PCR) ................. 29 
3.3.5 Annotation, gene grouping, and functional gene enrichment analysis ........................ 31 
3.4 Results ................................................................................................................................. 32 
3.4.1 Illumina RNA Seq data analysis .................................................................................. 32 
3.4.2 Transcriptome profile: SCOP general categories and detailed function categories ..... 33 
3.4.3 Transcriptome profile: superfamily.............................................................................. 34 
3.4.4 Transcriptome profile: differential gene expression between HAmCqG0 and HAmCqG8
............................................................................................................................................... 36 
3.4.5. Functional enrichment analysis of GO terms for differentially expressed genes ....... 39 
3.4.6. The molecular functional parenthood relationships of the GO terms among up-
regulated genes and their interconnection ............................................................................. 41 
3.5 Discussion ........................................................................................................................... 45 
3.6 Acknowledgements ............................................................................................................. 52 
 
vii 
 
Chapter 4: Gene Expression Profiles of the Southern House Mosquito Culex quinquefasciatus 
During Exposure to Permethrin .................................................................................................... 53 
4.1 Abstract ............................................................................................................................... 53 
4.2 Introduction ......................................................................................................................... 54 
4.3 Materials and Methods ........................................................................................................ 55 
4.3.1 Mosquito strains ........................................................................................................... 55 
4.3.2 Permethrin exposure treatments ................................................................................... 56 
4.3.3. RNA extraction ........................................................................................................... 56 
4.3.4. RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
processing ............................................................................................................................. 57 
4.3.5. Annotation, gene grouping, and functional gene enrichment analysis ....................... 58 
4.3.6. Selected gene expression validation using qRT-PCR ................................................. 59 
4.4 Results ................................................................................................................................. 59 
4.4.1. Gene Abundance ......................................................................................................... 60 
4.4.2. Up-regulated Genes .................................................................................................... 60 
4.4.4. Functional enrichment of Gene Ontology (GO) terms among the differentially-
expressed genes ..................................................................................................................... 65 
4.4.5. qRT-PCR Validation of Selected Genes ...................................................................... 71 
4.5 Discussion ........................................................................................................................... 74 
4.6 Acknowledgements ............................................................................................................. 78 
4.7 Disclosure ........................................................................................................................... 78 
Chapter 5: Gene expression analysis of a pyrethroid-resistant strain of Aedes aegypti and 
functional testing of selected family 4 cytochrome P450 genes ................................................... 79 
5.1 Abstract ............................................................................................................................... 79 
5.2 Introduction ......................................................................................................................... 80 
5.3 Materials and Methods ........................................................................................................ 81 
5.3.1. Mosquito Strains ......................................................................................................... 81 
5.3.2. Bioassays..................................................................................................................... 81 
5.3.3 RNA extraction, cDNA synthesis, and qRT-PCR gene expression analysis. ............... 82 
5.3.4 Functional testing of selected cytochrome P450 genes. .............................................. 83 
5.4 Results and Discussion ....................................................................................................... 88 
5.5 Conclusions ......................................................................................................................... 99 
5.6 Acknowledgements ........................................................................................................... 100 
 
viii 
 
Chapter 6: Temporal gene expression profiles of pre and post blood-fed adult females of the 
Southern house mosquito Culex quinquefasciatus ..................................................................... 101 
6.1 Abstract ............................................................................................................................. 101 
6.2 Introduction ....................................................................................................................... 102 
6.3 Materials and Methods ...................................................................................................... 103 
6.3.1 Mosquito strains ......................................................................................................... 103 
6.3.2 Pre-determination of time period for mosquitoes to take their first blood meal ........ 104 
6.3.3 RNA extraction .......................................................................................................... 104 
6.3.4 RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
processing ........................................................................................................................... 104 
6.3.5 qPCR gene expression ............................................................................................... 105 
6.4 Results ............................................................................................................................... 106 
6.4.1 Determination of the pre-blood meal time period...................................................... 107 
6.4.2 RNA Seq characterization of the pre-blood meal and mating time periods in Cx. 
quinquefasciatus. ................................................................................................................ 108 
6.4.3 Validation of selected RNA Seq genes using qPCR. ..................................................114 
6.5 Discussion ..........................................................................................................................118 
6.6 Acknowledgements ........................................................................................................... 121 
Chapter 7: Research Summary and Future Studies ..................................................................... 122 
7.1 Research Summary ........................................................................................................... 122 
7.2 Edsysteroid UDP-glucosyltransferase in Culex quinquefasciatus as a novel target for 
mosquito management ............................................................................................................ 124 
7.3 Use of VitA gene as a screening tool for bisacylhydrazines against mosquitoes .............. 126 
7.4 Determination of gene copy number in the highly pyrethroid-resistant HAmCqG8 strain of 
Cx. quinquefasciatus ............................................................................................................... 128 
7.4 References ......................................................................................................................... 135 
Appendix 3.1. List and sequences of the qRT-PCR primers used. ............................................. 167 
Appendix 3.2. Lognormal distributions for expressed genes in HAmCqG0 and HAmCqG8 by 
superfamily. ................................................................................................................................. 169 
Appendix 3.3. Complete list of all differentially upregulated genes? in HAmCqG8. .................. 174 
Appendix 3.4. List of genes downregulated by at least two-fold in HAmCqG8 when compared to 
HAmCqG0. ................................................................................................................................... 185 
 
ix 
 
Appendix 3.5. List of differentially upregulated genes in HAmCqG8 which contained 
functionally-enriched Gene Ontology terms. .............................................................................. 237 
Appendix 4.1. List and sequences of the qRT-PCR primers used. ............................................. 242 
Appendix 4.2: Genes up-regulated in the pyrethroid-resistant HAmCqG8 strain of Culex 
quinquefasciatus following permethrin challenge. ..................................................................... 244 
Appendix 4.3. Genes down-regulated in the pyrethroid-resistant HAmCqG8 strain of Culex 
quinquefasciatus following permethrin challenge. ..................................................................... 254 
Appendix 6.1. List of primers used for the qRT-PCR determination of genes. .......................... 262 
Appendix 6.2. Complete list of up- and down-regulated genes for sugar-fed only females for the 
HAmCqG8 strain of Culex quinquefasciatus for the initial 72h post-eclosion. ........................... 263 
 
  
 
x 
 
 
 
 
 
 
List of Tables 
 
 
Table 3.1. Number of paired end reads from the Illumina HiSeq sequencing and the percentage 
of reads mapped to the Cx. quinquefasciatus (strain: Johannesburg) predicted transcriptome .... 32 
Table 3.2. Numbers of differentially-expressed genes and their cumulative gene expression level 
in HAmCqG8 sorted by the Structural Classification of Proteins general function category ........ 37 
Table 3.3. Gene Ontology (GO) term enrichment analysis results for differentially expressed 
genes in HAmCqG8 ....................................................................................................................... 38 
Table 3.4. qRT-PCR validation of selected up-regulated genes in HAmCqG8 as identified by the 
RNASeq quantification. ................................................................................................................ 44 
Table 4.2: Number of differentially-expressed genes in the highly-permethrin resistant strain of 
Culex quinquefasciatus, HAmCqG8, following a 24 h exposure to either acetone, or permethrin at 
the LC50 and LC70 rates compared to a zero hour untreated time point. ....................................... 62 
Table 4.3. Genes up-regulated and down-regulated 24h-post treatment following treatment with 
permethrin at either the LC50 or the LC70 rate. ............................................................................. 63 
Table 4.4. Gene Ontology (GO) term enrichment analysis results for differentially expressed 
genes in the HAmCqG8 strain following a 24h exposure to permethrin at the LC50 and LC70 rates.
....................................................................................................................................................... 68 
Table 4.5. Differentially-expressed genes associated with functionally-enriched Gene Ontology 
(GO) terms in the HAmCqG8 strain following a 24h exposure to permethrin at the LC50 and LC70 
rates. .............................................................................................................................................. 69 
Table 5.1. List of primers used for the qRT-PCR determination of P450 gene expression level 
and the primers designed to generate the constructs for the functional testing in transgenic 
Drosophila melanogaster. ............................................................................................................. 84 
 
xi 
 
Table 5.2. Resistance ratio of the permethrin-resistant strain of Ae. aegypti Puerto Rico 
compared to the laboratory permethrin-susceptible strain Orlando in the presence and absence of 
the cytochrome P450 metabolic inhibitor piperonyl butoxide (PBO). ......................................... 89 
Table 5.3. List of cytochrome P450 genes differentially expressed between the adult females of 
the pyrethroid-resistant strain of Aedes aegypti (Puerto Rico) and the laboratory susceptible 
strain (Orlando). ............................................................................................................................ 91 
Table 5.4. Relative cytochrome P450 gene expression values in the pyrethroid-resistant Puerto 
Rico strain compared with the pyrethroid-susceptible Orlando strain. ......................................... 93 
Table 6.1. Number of paired end reads from the Illumina HiSeq sequencing and the percentage 
of reads mapped to the Cx. quinquefasciatus (strain: Johannesburg) predicted transcriptome. . 109 
Table 6.2. Expression levels of genes in Culex quinquefasciatus, strain HAmCqG8 for genes 
previously identified as up-regulated in non-blood-fed female Aedes aegypti and linked to 
nutritional status with regard to blood-feeding competency. .......................................................113 
Table 7.1. Single nucleotide polymorphisms in the pyrethroid-resistant strain of Cx. 
quinquefasciatus, HAmCqG8, compared to the parental reference strain HAmCqG0. ................ 129 
Table 7.2. List of genes containing SNPs/indels in the HAmCqG8 strain of Cx. quinquefasciatus 
when compared to the HAmCqG0 strain for genes shown to be up-regulated in the HAmCqG8 
strain. ........................................................................................................................................... 129 
 
  
 
xii 
 
 
 
 
 
 
List of Illustrations 
 
 
8Figure 3.1. Total proportions of cumulative gene expression levels in HAmCqG0 and HAmCqG8 
for the SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation 
information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html. ...................................................................... 34 
Figure 3.2. Log normal bean-plots for all expressed genes within SCOP superfamilies (SCOP 
version 1.75; supfam.cs.bris.ac.uk/SUPERFAMILY/index.html) in HAmCqG0 and HAmCqG8. 
The distribution along the Y axis indicates a higher level of gene expression, while the 
distribution along the X axis indicates the proportion of genes expressed at the given level of 
gene expression along the Y axis. Distributions are oriented along a common central baseline so 
that distributions in red (HAmCqG0) have more genes expressed at a given gene expression level 
(log FPKM) if the distribution is further to the left on the X axis, while distributions in blue 
(HAmCqG8) are higher if they are further to the right of the X axis. The central vertical baseline 
for each superfamily is a mirror point for the two distributions. .................................................. 36 
Figure 3.3. Combined gene expression levels for all up- and down-regulated genes within a 
general function category in HAmCqG8 compared to those expressed in HAmCqG0. .................. 39 
Figure 3.4. Parent-Child association for functionally enriched Gene Ontology (GO) terms among 
genes that were up-regulated in HAmCqG8. GO terms associated with the up-regulated genes in 
HAmCqG8 were considered statistically at <0.001 using the g:SCS threshold in g:Cocoa 
(http://biit.cs.ut.ee/gprofiler/gcocoa.cgi). Colored boxes represent statistically functionally 
enriched GO terms, while the nonsignificantly-enriched GO term is marked in white and 
provided to display all of the parent-child relationships in the network. Lines and/or arrows 
represent connections between or among different GO terms. Solid lines represent relationships 
between two enriched GO terms. Dashed lines represent relationships between enriched and 
 
xiii 
 
unenriched terms to connect all of the nodes on the directed acyclic graph ................................. 42 
Figure 4.1. Venn diagram analysis of the total numbers of differentially-expressed up- and 
down-regulated genes in the fourth instar of the permethrin resistant HAmCqG8 strain of Cx. 
quinquefasciatus following a 24h exposure to either an acetone control, or two rates of 
permethrin (LC50 and LC70). Overlapping circles represent genes that were co-up- or co-down-
regulated in two or more groups. .................................................................................................. 61 
Figure 4.2. Gene ontology term functional enrichment analysis of the differentially-expressed 
up- and down-regulated genes identified in the fourth instar of the permethrin resistant 
HAmCqG8 strain of Cx. quinquefasciatus following a 24h exposure to permethrin. ................... 67 
Figure 4.3. Gene expression levels for proteases (upper panels A and B) and larval storage 
proteins (lower panels C and D). Bars superseded with a ?*? indicate that the expression level 
between the permethrin susceptible S-lab strain and the permethrin resistant HAmCqG8 strain of 
Cx. quinquefasciatus were significantly different at the ?=0.01 level of significance. Bars shown 
superior to the dependent axis zero line indicate genes that were up-regulated relative to a 
comparative acetone blank treatment control, while genes inferior to the dependent axis zero line 
indicate genes that were down-regulated relative to a comparative acetone blank treatment 
control ........................................................................................................................................... 73 
Figure 5.1. Two-point mortality for the Orlando strain of Aedes aegypti and the different 
generations of the Puerto Rico Ae. aegypti strain. The 0.8 ng per female (low dose) represents the 
maximum dose that results in survival in the pyrethroid-susceptible Orlando strain, while the 
6.25 ng per female represents the high dose. Puerto Rico generations F1, F2, F6, F7, F8, F14, 
and F17 did not have sufficient numbers for testing. .................................................................... 90 
Figure 5.2. RT-PCR of transgenic D. melanogaster expressing Aedes aegypti cytochrome P450 
genes. The (-) and (+) within gene represent the amplified products from the non-transgenic line 
(-) and the transgenic line (+) of D. melanogaster, respectively. ................................................. 98 
Figure 5.3. Survivorship of transgenic D. melanogaster lines following a 24h exposure to either 
permethrin or beta-cypermethrin. Bars within dose superceeded by the same letter are not 
 
xiv 
 
significantly different at the ?=0.05 level of significance. BDRC 24484 is the non-transgenic line 
of D. melanogaster, which had no surviving individuals at any of the doses of the insecticides 
tested. ............................................................................................................................................ 99 
Figure 6.1. Box and whisker plot of the percentage of females from even-aged populations of 
Cx. quinquefasciatus strain HAmCqG8 freely taking an offered blood meal. The black lines 
within a bar represent the median percentage of females who freely took a blood meal. The upper 
and lower whiskers represent the highest and lowest observations, respectively, while the bars 
themselves represent the interquartile range (Q1 - Q3). ............................................................. 107 
Figure 6.2. Total gene expression within the Structural Classification of Proteins (SCOP) general 
function categories for adult sugar-fed female Culex quinquefasciatus, strain HAmCqG8, for the 
initial 72 h post-eclosion. Gene expression values expressed are summed within each SCOP 
category to provide an overall profile of the complete distribution of all gene expression within 
the mosquitoes. ............................................................................................................................110 
Figure 6.4. Heat map displaying the relative increases in gene expression for selected genes for 
the initial 72 h post-eclosion for adult female Cx. quinquefasciatus, strain HAmCqG8, and for 72 
h post blood meal. Females offered a blood meal were 6 days old at the time of the blood 
feeding..........................................................................................................................................115 
Figure 6.5. Temporal gene expression of vitellogenin genes in adult female Cx. quinquefasciatus 
for the 72 h time period immediately following eclosion and for the 72 h time period 
immediately following the blood meal. .......................................................................................117 
Figure 7.1 Temporal expression of the ecdysone-inducible gene E74 and the ecdysteroid 
glucosyltransferase gene CPIJ003694. ....................................................................................... 125 
Figure 7.2. Dose-dependent effect of ecdysone agonists on the gene expression of the VitA gene 
(CPIJ001357 / CPIJ001358) against adult female Cx. quinquefasciatus. .................................. 127 
Figure 7.3. Distribution of SNPs and indels identified within the up-regulated genes in the 
pyrethroid-resistant HAmCqG8 strain of Cx. quinquefasciatus within the general function 
categories of the Structural Classification of Proteins (SCOP) datatbase. Individual points within 
 
xv 
 
category represent the actual number of SNPs/indels for a given gene, while the box-whisker 
plots represent the quartile values, where the internal black bar within each box represents the 
median value of SNPs/indels per gene within SCOP general function category. ....................... 134 
 
  
 
xvi 
 
 
 
 
 
 
List of Abbreviations 
 
 
ANOVA Analysis of Variance 
BDRC Bloomington Drosophila Resource Center 
cDNA copy Deoxyribo Nucleic Acid 
DDT Dichloro Diphenyl Trichloroethane 
DEF S,S,S- tributyl phosphorotrithioate 
DEM diethyl maleate 
DNA Deoxyribonucleic Acid 
FDR False discovery rate 
FPKM Fragments per kilo base of gene for every million reads mapped 
GABA gamma amino butyric acid 
GAL4:UAS Galactose 4: Upstream Activator Sequence 
GEO Gene Expression Omnibus (NCBI) 
GO Gene Ontology 
GRN1 gustatory receptor neuron 1 
GRN2 gustatory receptor neuron 2 
HAIB Hudson Alpha Institute for Biotechnology 
IMD immunodeficient 
Kdr knock down resistant 
LC50 Lethal concentration that kills 50% of the population 
 
xvii 
 
LC70 Lethal concentration that kills 70% of the population 
LPS lipopolysaccharide 
m/tr metabolism/transport 
mRNA messenger RiboNucleic Acid 
NCBI National Center for Biotechnology Information 
NONA Non annotated 
nt nucleotide 
OP Organophosphate 
P450 Cytochrome P450 
PBO Piperonyl Butoxide 
PCR Polymerase Chain Reaction 
Ppm parts per million 
qRT-PCR quantitative Real Time Polymerase Chain Reaction 
Rdl resistance to dieldrin 
RNA Ribonucleic acid 
RNA-Seq Ribonucleic acid sequencing (massively parallel) 
RPKM Reads per kilo base of gene for every million reads mapped 
SCOP Structural Classification of Proteins 
SNP Single Nucleotide Polymorphism 
TOR target of rapamycin 
vitA vitellogenin A 
Vssc Voltage sensitive sodium channel 
WHO World Health Organization 
1 
 
Chapter 1: Literature Review 
 
1.1 Insects and insecticides 
 Insects consume or spoil roughly one-third of all food/fiber produced for human 
consumption and use (Johnson and Triplehorn, 2004). Insects are also direct parasites of humans, 
and some can vector the etiological agents of several diseases (Lounibos, 2002). In order to 
combat the losses of food, fiber, and to decrease the transmission rates of human pathogens by 
insects, chemicals (insecticides) have been developed to kill pestiferous insects (Casida and 
Quistad, 1998). Insecticides work by directly targeting a vital system or process of the insect, 
including systems such as the nervous, integument, or muscular systems, and processes such as 
development and molting (Yu, 2008). As a result, insecticides target specific molecules within 
the insect and, when applied at toxic levels, cause specific symptoms. For example, the 
insecticides methoprene and pyriproxyfen are mimics of juvenile hormone that disrupt the 
molting process of immature insects, notably killing holometabolous insects as they enter the 
pupal stage (Dhadialla et al., 1998). Other insecticides, such as organophosphates, target the 
nervous system of insects by inhibiting the action of acetylcholinesterase, which prevents the 
degradation of the neurotransmitter acetylcholine in insects, resulting in a sustained nervous 
impulse that ultimately results in death of the insect (Casida and Quistad, 1998; Yu, 2008). While 
insecticides provide protection to food, fiber, animals, and humans, their overuse or improper use 
can ultimately lead to their failure. The first documented failure of an insecticide to manage an 
insect pest was recorded for Paris Green, which was used for the management of the San Jose 
scale in the Western US (Melander, 1914). Insecticide resistance is largely believed to be a pre-
adaptive phenomenon resulting from the selection of genetically-based trait(s) within a 
2 
 
population of insects, resulting in the ability of the target insect pest to resist the insecticide 
challenge. The repeated exposure of insects to insecticides led to genetic changes within the 
insect populations to increase the proportion of individuals within the population that harbor 
genetically-based traits that confer insecticide resistance (Georghiou, 1972; Liu 2008). 
 
1.2 Insecticide resistance 
 Insecticide resistance is a phenomenon where an insecticide fails to kill the target insect. 
The resistance to insecticides within populations of insects is largely believed to be pre-adaptive, 
in that individuals within the population harbor traits that confer the tolerance/resistance to 
insecticides, which  upon challenge with an insecticide results in the selection of these traits that 
are then passed on to successive insect generations (Georghiou, 1972; Liu 2008). As such, 
insecticide resistance has a genetic basis. As a consequence of the genetic basis and subsequent 
trait/gene selection, the repeated use of an insecticide against an insect population results in an 
enrichment of insecticide resistance traits/genes within the population. Thus insecticide 
resistance arises from the repeated use of insecticides which enriches the prevalence of these 
traits/genes within in the population, ultimately resulting in a failure of insect control (Georghiou 
and Saito 1983). 
 
1.3 Mechanisms of insecticide resistance 
 Insecticide resistance can be broadly classified into two categories: physiological and 
behavioral (Yu, 2008). Physiological resistance can be further characterized into: target-site 
insensitivity, metabolic resistance and reduced uptake/acquisition. The first category, target-site 
insensitivity, is when there is a physical change in the target site resulting in a decreased efficacy 
3 
 
of the chemical. The second category, metabolic resistance, occurs due to the ability of the insect 
to metabolize the insecticide into less-toxic, more easily excretable forms. The third category, 
reduced uptake/acquisition, represents changes in the cuticular structure of the insect that results 
in less of the insecticide being absorbed. Finally the behavioral resistance includes behavioral 
adaptations of the insect that confer indirect resistance to the insect such as the ability to avoid 
consuming a toxin/toxicant, or other mechanisms such as the acquisition of endosymbiotic 
microbes capable of degrading insecticides (Yu, 2008). 
 
1.3.1 Increased metabolic detoxification 
 Insects encounter multiple naturally-present toxins, for which they have a multitude of 
enzymes capable of mitigating the negative impact of the toxins by degrading them into less-
toxic, more easily excretable forms, and are able to degrade insecticides as well. The enzymes 
involved in the degradation of insecticides can be broadly classified into two categories: phase I, 
and phase II enzymes. Phase I enzymes are the enzymes that are primarily responsible for the 
degradation and catalyze the oxidation, reduction, and hydrolysis reactions, such as cytochrome 
P450s and carboxylesterases. Phase II enzymes serve to mitigate the toxic effects of an 
insecticide by conjugating small molecules to the insecticide such as sugars, amino acids, or 
glutathione. 
 
1.3.1.1 Cytochrome P450 monooxygenase-mediated detoxification 
 Of all of the phase I reactions, oxidation reactions, which are carried out by cytochrome 
P450s, is considered to be the most important (Yu, 2008). Cytochrome P450s are present in all 
divisions of life (Scott and Wen, 2001), and perform various physiological functions in insects 
4 
 
including the biosynthesis and degradation of ecdysteroids, cuticle formation, fatty acid synthesis 
and metabolism, as well as the detoxification of xenobiotics (Chavez et al., 2000; Warren et al., 
2002; Petryk et al., 2003; Warren et al., 2004; Namiki et al., 2005; Ono et al., 2006; Rewitz and 
Gilbert, 2008; Guittard et al., 2011, Qiu et al., 2012). The numbers of P450 genes in insects 
ranges from as low as 37 in the human body louse Pecidulus humanus (Lee et al., 2010) to 204 
in the Southern House Mosquito, Culex quinquefasciatus (Arensburger et al., 2010; Yang and 
Liu, 2011). Cytochrome P450s are arranged into clans, families, and subfamilies, based on 
sequence similarity, among which, insect cytochrome P450s are found in clans 2, 3, 4, and mito 
clan (Feyeresen, 1999). Many studies have investigated the role of cytochrome P450s in 
insecticide resistance (Strode et al., 2008; Pridgeon et al., 2009; Bariami et al., 2012; Fonseca-
Gonzalez et al., 2011; Yang and Liu, 2011; Poupardin et al., 2010; Saavedra-Rodriguez et al., 
2012; Strode et al., 2012) and the functionality of selected cytochrome P450s has been tested, 
notably among mosquito species (Boonseupsekul et al., 2008; McLaughlin et al., 2008; Muller et 
al., 2008; Stevenson et al., 2011; 2012).  
 
1.3.1.2 Hydrolase-mediated detoxification 
 Hydrolase (esterase) mediated detoxification has been documented for nearly all insect 
classes, notably among organophosphorous (OP) insecticides (Li et al., 2007). Hydrolase-
mediated resistance has been identified to be due to gene duplication and neo-functionalization 
of esterase genes in multiple insect species, whereby the amino acid sequences of 
carboxylesterases become modified to degrade OP compounds (Oppenoorth and Van Asperen, 
1960; Campbell et al., 1998; Claudianos et al., 1999). Esterase gene duplication and 
amplification has also been demonstrated to serve as a means of general protection against 
5 
 
insecticides via sequestration of the toxicant (Field and Devonshire, 1998). 
 
1.3.1.3 Glutathione S-transferase-mediated detoxification 
 Phase II reactions are conjugation reactions that include the addition of small molecules 
onto the insecticide, rendering it more easily excreted. Although there are multiple phase II 
reactions, such as the conjugation of glucose to OP compounds via uridine diphosphate glucosyl 
transferase (Bull and Whitten, 1972), the major enzymes involved in the phase II detoxification 
of insecticides are the glutathione S-transferases (Feyereisen, 1995; Hemingway and Ranson, 
2000). Insect glutathione S-transferases have two subunits and may be both cytosolic and 
microsomal and have been proposed to serve as protection to the cell membrane (Yu, 2002). 
Glutathione S-transferases have been shown to confer insecticide resistance for multiple insect 
species against OP compounds (Huang et al., 1998), organochlorine compounds (Ranson et al., 
2001; Syvanen et al., 1996), as well as pyrethroids (Syvanen et al., 1994; Vontas et al., 2002). 
They have also been shown to be involved in pyrethroid resistance in Cx. quinquefasciatus, 
where pretreatment of larvae with the glutathione S-transferase inhibitor diethyl maleate (DEM) 
resulted in a 3-fold decrease in permethrin resistance for a field-collected strain exhibiting 
multiple insecticide resistance (Xu et al., 2005). 
 
1.4 Target site insensitivity 
1.4.1 Insensitivity of the voltage-sensitive sodium ion channel 
 The voltage sensitive sodium ion channels (Vssc) of insects are the major ion channels 
involved in perpetuating the depolarization phase of action potentials. They are targets of DDT, 
pyrethroids, oxadiazines, as well as a variety of naturally-occurring neurotoxins (Dong, 2007; 
6 
 
Cestele and Catterall, 2000; Wang and Wang, 2003). Amino acid substitutions in the Vssc that 
lead to structural changes can confer insecticide resistance. The first observation of this 
phenomenon was in the house fly Musca domestica, where resistance to DDT was found to 
coincide with a loss of the typically rapid knock-down effect of DDT leading to the term 'knock-
down resistant', or kdr for short (Farnham, 1977). Presently, the term 'kdr' is used to refer to the 
specific mutation in M. domestica, which was identified to be due to a single nucleotide change 
from a C to a T at position After investigating the DNA sequence of the target of DDT, which is 
the voltage-gated sodium channel. L1014F in Anopheles gambiae (Martinez-Torres et al.,1998), 
Blatella germanica (Liu et al., 2000), Culex pipiens, Myzus persicae (Martinez-Torres et al., 
1999), Culex quinquefasciatus (Xu et al., 2006b), Hematobia irritans (Guerrero et al., 1997), 
Leptinotarsa decemlineata (Lee et al., 1999) and Plutella xylostella (Schuler et al., 1998); 
alternative L1014 mutations such as L1014S in An. gambiae (Ranson et al., 2000), Cx. pipiens 
(Martinez-Torres et al., 1999), and L1014H in Heliothis virescens (Park and Taylor, 1999), and 
Musca domestica (Park et al., 1997). Recent studies on Cx. quinquefasciatus traced the 
frequency of both synonymous and non-synonymous SNPs throughout the pressuring to two 
distinct field strains of Cx. quinquefasciatus. The results showed that combinations of SNPs 
became fixed in the population as the level of permethrin resistance increased (Li et al., 2012; Xu 
et al., 2012a), notably three non-synonymous SNP changes which were L982F, A109S, and 
W1573R, which were comparable to L1014F, A99S, and W1594R in M. domestica, respectively. 
Li et al., 2012 and Xu et al., 2012a further co-identified six synonymous that were found to be 
statistically correlated to permethrin resistance in Cx. quinquefasciatus. These correlation of 
these novel SNPs in the Vssc to increasing insecticide resistance suggests their involvement in 
insecticide resistance (Li et al., 2012). 
7 
 
 
1.4.2 Insensitivity of acetylcholinesterase 
 Acetylcholine is a neurotransmitter in insects that spans the synapse of two neurons to 
continue the nervous impulse from nerve to nerve via the nicotinic acetylcholine receptor. 
Following the signal transmission, acetylcholinesterase degrades acetylcholine into choline and 
acetic acid, terminating the nervous stimulation. Organophosphorous and carbamate compounds 
are both inhibitors of acetylcholine, and resistance to these two insecticides has been identified 
and linked to insensitivity of acetylcholinesterase in mosquitoes, houseflies, and multiple other 
insect species as well (Fournier and Mutero, 1994; Casida and Durkin 2013). Multiple non-
synonymous mutations in the acetylcholinesterase molecule have been documented in diverse 
insect species including D. melanogaster, Aphis gossypii, Lucilia cuprina, Ae. aegypti, Cx. 
pipiens, An. gambiae, and An. albimanus (Mutero et al., 1994; Vaughan et al. 1997; Chen et al., 
2001; Boublik et al., 2002; Weill et al., 2003; Weill et al., 2004; Menozzi et al., 2004). Not all of 
the non-synonymous mutations identified in these insects confer insecticide resistance, while 
various combinations of the other mutations, for example the combination of the two mutations 
S431F and A302S confers a high level of resistance to both OP compounds and carbamates in 
the aphids M. persicae and A. gossypii (Benting and Nauen, 2004; Andrews et al., 2004). 
 
1.4.3 Insensitivity of the gamma-aminobutyric acid receptor 
 Gamma-aminobutyric acid (GABA) is the major insect neurotransmitter for inhibitory 
neurons, which are neurons that play an important role in nervous impulse transduction by 
hyperpolarizing the nerve, making an action potential less likely (Otsuka et al., 1966).  The 
GABA receptor, itself, forms a multimeric Cl- channel, which when bound to GABA, results in 
8 
 
an influx of Cl- into the nerve cell, resulting in hyperpolarization of the membrane ((ffrench-
Constant et al., 1993; Buckingham et al., 2005). The GABA channel is the target for several 
insecticides, inlcuding cyclodienes, phenylpyrazoles, and avermectin (Abalis et al., 1986; Gant et 
al., 1998). Multiple studies have identified resistance in the GABA receptor, the first of which 
was the identification of rdl (resistance to dieldrin locus), which is the result of an amino acid 
change from alanine to serine at position 302 (A302S) in the M2 domain of the Cl- channel in 
Drosophila melanogaster (ffrench-Constant et al., 1993). The same A302S (or A302G in for 
some insects) has since been identified in a multitude of insects including Drosophila simulans, 
Musca domestica, Blatella germanica, Aedes aegypti, Bemisia tabaci, Tribolium castaneum, 
Hypothenemus hampei, and Myzus persicae (ffrench-Constant et al., 1993; Zhang et al., 1994; 
Andreev et al., 1999; ffrench-Constant et al., 1993). The rdl locus that has been shown to confer 
not only dieldrin resistance, but resistance to other insecticides that target the GABA receptor, 
such as phenylpyrazoles (e.g. fipronil) as well. 
 
1.5 Other mechanisms of insecticide resistance 
1.5.1 Decreased penetration 
 A minor increase in the resistance to insecticides as a result of changes in the cuticular 
structure of insect has long been proposed (Plapp and Hoyer, 1968; Terriere, 1982).  
Earlier work demonstrated higher protein and lipid contents in the cuticle of DDT-resistant 
Heliothis virescens, and mutiple-insecticide resistant Musca domestica (Vinson and Law, 1971; 
Patil and Guthrie, 1979). Recent work using scanning electron measurements has shown that the 
females of pyrethroid-resistant Anopheles funestus had significantly thicker cuticles than 
pyrethroid-susceptible females (Wood et al., 2010). Gene-based evidence for the involvement of 
9 
 
cuticular genes has also been demonstrated in the Colorado potato beetle Leptinotarsa 
decemlineata, where three structural glycine-rich cuticular genes were found to be highly 
induced upon exposure to the organophosphate aziphosmethyl (Zhang et al., 2008). More 
recently, tissue-specific qRT-PCR has shown that along with the up-regulation of cuticlar 
structural genes, the majority of the metabolic genes contributing to insecticide resistance in the 
common bed bug Cimex lectularius are expressed in the epidermal layer (Zhu et al., 2013).  
 
1.5.2 Behavioral/Other resistance 
 Behavioral resistance refers to changes in the behavior of the insect that results in 
avoidance of the insecticide (Chareonviriyaphap et al. 2013). Behavioral resistance is broadly 
classified into non-contact spatial repellency (where the insect avoids the chemical without 
contact) and direct contact excitation (where the insect becomes hypersensitive to the chemical 
and moves away from the toxin/toxicant following exposure (Roberts et al., 1997). An example 
of behavioral resistance is that of the German cockroach Blatella germanica to survive a 
hydramethylnon-spiked corn-syrup bait by developing an aversion to D-glucose, which led to a 
decrease in efficacy from 90 to 39% in only five years of exposure (Silverman and Bieman, 
1993), which has been recently been discovered to be the result of changes in the peripheral 
gustatory receptor neurons GRN1 and GRN2, which are stimulated by sugar which encourages 
feeding and bitter compounds which suppresses feeding, respectively (Wada-Katsamata et al., 
2013). In glucose-averse roaches, GRN1 exhibits a low response to D-glucose relative to wild-
type roaches, while GRN2 is stimulated in a dose dependent fashion, even though GRN2 has no 
response to D-glucose in wild-type B. germanica (Wadu-Katsamata et al., 2013). This ultimately 
results in glucose-averse B. germanica avoiding the hydramethylnon-spiked corn-syrup bait due 
10 
 
to the high concentration of D-glucose.  
 
1.6 Insecticide cross resistance 
 The development of insecticide resistance in an insect can lead to cross-resistance to a 
different insecticide, even if the insect has never been exposed to the second insecticide. 
Examples of this are in the diamondback moth Plutella xylostella where selection of a strain 
using permethrin, conferred cross-resistance to other pyrethroids (Yu and Nguyen, 1996), the 
Southern House Mosquito Culex quinquefasciatus where resistance to fenitrothion also conferred 
resistance to DDT and dichlorvos (Hassall, 1990), and the house fly Musca domestica where a 
the highly pyrethroid-resistant ALHF strain was identified to have cross-resistance to type I and 
type II pyrethroids, as well as the carbamate propoxur due to the high activity of 
monooxygenases (Liu and Yue, 2001).  
 
1.7 Interaction of insecticide resistance factors 
 The factors that confer insecticide resistance to insects may, independently, confer only a 
small level of resistance, whereas the combination of factors may confer multiplicative resistance 
(Georghiou, 1972). Studies using crosses of an insecticide resistant strain of M. domestica with 
an insecticide susceptible strain possessing recessive molecular markers unique to each of the 
five autosomes of M. domestica have allowed researchers to investigate the additive or 
multiplicative effects of insecticide resistance factors that are borne on different autosomes and 
their possible interaction. Georghiou (1972) identified that autosomes 2, 3, and 5 independently 
conferred 3.2, 1.7, and 1.0, respectively, when compared to the susceptible strain. When 
autosomes 2, 3, and 5 were combined, however, it resulted in a nearly complete restoration of 
11 
 
resistance. Other work using a similar house fly crossing strategy has shown that trans-acting 
factors may influence the expression of resistance genes, such as CYP6D1, which is located on 
autosome 1, but whose expression is controlled by a factor on autosome 2 (Liu and Scott, 1997). 
Recently, the factors involved in a multiple-insecticide resistant strain of M. domestica have been 
investigated using a combination of RNA-Seq gene expression profiling and various house fly 
crosses between the insecticide resistant and the insecticide susceptible strains. The results of this 
study indicated that factors on autosomes 2 and 5, notably cytochrome P450s and regulation 
genes may be largely responsible for the metabolic resistance to insecticides in M. domestica, 
with minor pesticide-metabolism factors present on autosomes 1 and 3 (Li et al., 2013). 
Other studies have identified that microbes may slow the development of insecticide resistance 
(Broderick et al., 2006). For example, correlations have been made between the density of 
Wolbachia infection in insecticide resistant mosquitoes and have been shown to be responsible, 
in part to the reproductive fitness of mosquitoes (Duron et al., 2006). Finally microbes may 
confer insecticide resistance to insects by directly degrading them. A recent study in Japan has 
identified that colonies of Burkholderia in sugar cane fields, where fenitrothion was repeatedly 
and heavily applied, had developed the capacity to utilize fenitrothion as a carbon source. When 
the bean bug Riptortus pedestris feeds on the sugar cane, it acquires the bacterium which 
colonizes the midgut of the insect, where it confers resistance to fenitrothion by using any 
fenitrothion injected by R. pedestris as a food source (Kikuchi et al., 2012). 
 
1.8 Culex quinquefasciatus an insect pest 
The mosquito Culex quinquefasciatus Say is a primary vector of several disease causing 
agents including: West Nile virus, St. Louis encephalitis virus, Eastern Equine Encephalitis virus, 
12 
 
Japanese Encephalitis virus, Chikunguja virus, Wucheria bancroftii (Nasci and Miller, 1996; 
Arensburger et al., 2010). Culex quinquefasciatus has a global distribution, and is found 
predominantly in tropical, subtropical, and warmer portions of the temperate regions. In nature, 
Cx. quinquefasciatus is anautogenous, requiring a blood meal in order to provision its eggs 
(Gelbi? and Rozsypalov?, 2012). The primary hosts of Cx. quinquefasciatus are birds, however 
they also feed on humans, mammals, and amphibians (Mackay et al. 2010, Unlu et al. 2010). The 
degree to which Cx. quinquefasciatus feeds on humans in North America has been shown to vary 
from as low as 1% in a study in California (Reisen et al. 1990) to 50% in a study conducted in 
Arizona (Zinser et al. 2004). In Alabama, it is the predominant mosquito species in urban areas 
(Fonseca et al., 2004; Cupp et al., 2011). Current approaches to controlling mosquitoes in the 
state rely primarily on source reduction and the application of insecticides, primarily pyrethroids 
and organophosphates, for both larval and adult mosquitoes (Liu et al., 2004).  
 
1.9 Insecticide resistance in Cx. quinquefasciatus 
The Southern house mosquito Cx. quinquefasciatus has been reported to have resistance 
to and varying degrees of insecticide susceptibility to >20 different insecticides (Hamdan et al., 
2005; Pridgeon et al., 2008; Norris and Norris, 2011), however, since pyrethroid insecticides are 
the most widely used insecticides for the control of mosquitoes indoors (Liu et al., 2006) and 
since pyrethroids represent one-quarter of the worldwide insecticide market (Hemingway et al., 
2004), much of the research to investigate insecticide resistance in Cx. quinquefasciatus has 
focused on resistance to pyrethroids. Insecticide resistance mechanisms in Cx. quinquefasciatus 
can include factors sucah as increased sequestering (Scott 1991; Feyereisen 1995), however the 
major inseticide resistance factors pertain to target site insensitivity and metabolic detoxification 
13 
 
(Liu et al., 2006). Two multiple-insecticide resistant field strains of Cx. quinquefasciatus 
(HAmCqG0, and MAmCq G0) have been collected from two geographically-diverse regions of 
Alabama (Liu et al., 2004). These field strains contained both the kdr-like mutation L982F 
(L1014F) as well as multiple metabolic-based resistance factors (Xu et al., 2005; Xu et al., 
2006b). Pretreatment of the MAmCq G0 and HAmCq G0 strains with the cytochrome P450 
inhibitor piperonyl butoxide (PBO) resulted in a 10-fold decrease in resistance to permethrin, 
while treatments with the hydrolase inhibitor S,S,S,-tributylphosphorotrithioate (DEF) and the 
glutathione S-transferase inhibitor diethyl maleate (DEM) resulted in decreases of only 3 and 2-
fold, respectively (Xu et al., 2005). These results demonstrated that along with the kdr-like Vssc 
mutation, the majority of insecticide resistance in Cx. quinquefasciatus is attributable to 
cytochrome P450-mediated metabolic detoxification (Xu et al., 2005). Similar results were 
obtained from collections of Cx. quinquefasciatus worldwide from regions as diverse as Saudi 
Arabia (Kasai et al., 1998), California (McAbee, 2003), and West Africa (Chandre et al., 1998). 
Hardstone et al. (2010) further identified that there are epistatic (interactions that are non-
additive) effects between the kdr-like Vssc mutation and cytochrome P450s in Cx. 
quinquefasciatus with regard to permethrin resistance. In their study, they crossed a permethrin 
resistant strain of Cx. quinquefasciatus containing the kdr-like mutation and cytochrome P450 
metabolic detoxification (Jpal strain) with a lab susceptible strain (S-lab) to obtain a strain 
possessing P450-mediated resistance, but no kdr-like mutation. It was found that cytochrome 
P450-mediated detoxification alone conferred only 4% of the same resistance as the combination 
of the kdr-like mutation and the P450-mediated detoxification. They further found that if the 
cytochrome P450s of the Jpal strain were inhibited by PBO, the strain lost nearly all resistance to 
permethrin, reducing from ~28000-fold resistant to 70-fold resistant when compared to a 
14 
 
laboratory susceptible strain of Cx. quinquefasciatus. The HAmCq G0 and MAmCq G0 strains 
were further pressured with permethrin in the laboratory to obtain strains with a high level of 
pyrethroid resistance (Xu et al., 2006a). As a result of the permethrin pressuring, the genes 
involved in pyrethroid resistance were identified to be over-expressed when compared to their 
respective parental strains (Liu et al., 2007; Liu et al., 2011; Yang and Liu, 2011). This allowed 
for techniques such as suppression subtractive hybridization to be conducted to identify genes 
that are involved in permethrin resistance, including genes involved in cellular and molecular 
metabolism, signal transduction and regulation, vesicular and molecular transport, protein 
biosynthesis and ubiquitinization, cytoskeletal network, and others (Liu et al., 2007). Liu et al. 
(2007) discussed, for the first time, the possible involvement of cellular signaling in cytochrome 
P450 gene expression in mosquitoes and the link to insecticide resistance. Studies utilizing qRT-
PCR have also been conducted to characterize the gene expression profiles of cytochrome P450s 
in insecticide resistant strains of Cx. quinquefasciatus. Liu et al. (2011) identified that four 
cytochrome P450 genes, CYP6AA7, CYP9J40, CYP9J34, and CYP9M10 were constitutively up-
regulated in the larval stages in highly permethrin-resistant Cx. quinquefasciatus, while only 
CYP6AA7 was up-regulated in adult mosquitoes. Liu et al. (2011) further identified that three of 
these cytochrome P450 genes (CYP6AA7, CYP9J34, and CYP9M10) were inducted to a higher 
level of gene expression following a 24 h exposure to permethrin at the LC50 rate. The use of the 
two highly insecticide resistant strains of Cx. quinquefasciatus (HAmCq and MAmCq) also 
allowed for gene expression profiling of the entire compliment of the 204 cytochrome P450 
genes predicted to be present in the Cx. quinquefasciatus genome (Arensburger et al., 2010) and 
to link selected cytochrome P450 over-expressed genes to permethrin resistance. In their study, 
Yang and Liu (2011) identified that multiple cytochrome P450 genes were up-regulated across 
15 
 
the two permethrin resistant lines tested when compared to their parental low insecticide 
resistance strains (HAmCqG8 to HAmCqG0 and S-lab, and MAmCqG6 to MAmCqG0 and S-lab, 
respectively). Yang and Liu (2011) further confirmed the up-regulation of CYP6AA7, CYP9J40, 
CYP9J34, and CYP9M10 in larval permethrin-resistant Cx. quinquefasciatus, and further 
identified that CYP6AA7 and CYP4C52v1 were up-regulated across both strains of permethrin-
resistant Cx. quinquefasciatus and all lifestages. This highlighted the importance of CYP6AA7 
and CYP4C52v1 in permethrin resistance for all life stages, while other cytochrome P450s, 
notably CYP9J40, CYP9J34, and CYP9M10 may be of particular importance for permethrin 
resistance in the larval stage. 
In addition to the deep level of knowledge of cytochrome P450 mediated resistance in Cx. 
quinquefasciatus, research has been done to investigate the sequence changes (SNPs) associated 
with the Vssc during pressuring with permethrin. SNP analyses of the successive generations of 
the two highly permethrin-resistant strains HAmCqG8 and MAmCqG6 as they were undergoing 
laboratory selection with permethrin identified a total of nine (three non-synonymous and six 
synonymous) SNPs in the Vssc that were statistically correlated to the increase in resistance to 
permethrin (Xu et al., 2012a; Li et al., 2012). This suggested that as permethrin resistance 
increases, there is a need for additional target site modifications to maintain the insensitivity of 
the Vssc in the presence of higher permethrin concentrations. 
 
1.10 Next generation sequencing 
 With the advent of next generation sequencing, the ability to rapidly acquire large 
amounts of sequence information in a short period of time became available. Several 
technologies have been developed and are in current use as of 2012, including the Illumina-based 
16 
 
Solexa technology, the SOLiD technology, the Roche 454 technology, and the Ion Torrent 
technology (Metzker, 2010).  
 
1.10.1 Illumina mRNA-Seq sequencing 
 In Illumina mRNA-Seq sequencing, the compliment of mRNA is extracted from the RNA 
fraction via oligo-dT hybridization or ribosomal RNA subtraction. The mRNA is then reverse 
transcribed into double stranded DNA, sheared into appropriate lengths (~300 nucleotides) and 
two unique Y-adapters are added to the ends of the molecule (Metzker, 2010). Due to the lack of 
complementarity of the Y-adapters at their 5'-end, a PCR generation step can be conducted that 
will allow for the selective amplification of only those fragments containing the two adapters 
(one on each end of the fragment). The fragments are then flowed across a silica slide flow cell 
that is coated with a sequence that is complimentary to the adapters, to which they bind and serve 
as the template for the extension of the covalently-bound adapters. The bound adapters are then 
extended using a DNA polymerase (Metzker, 2010). This step generates a second template at the 
end of the molecule, which can then anneal to a second covalently-bond adapter on the silica 
slide, where it serves as the template for the generation of the reverse strand via bridge 
amplification (Harris et al., 2008). This cycle is repeated to obtain localized spots or 'polonies' 
where single-stranded unique forward and reverse strands are present. Once the polonies have 
been generated, the PCR reaction proceeds in the presence of all four nucleotide bases containing 
a reversible allyl protecting group on the 3'-hydroxyl on the sugar and a second allyl group 
connecting a unique fluorophore to the nucleobase (Metzker et al., 1994; Canard and Sarfati, 
1994). Once a base has been added to the growing chain, the remaining nucleotides are flushed 
from the flow cell and the slide is excited successively with two different wavelengths that excite 
17 
 
the fluorophores that are then read for each polony using a camera (Illumina, San Diego, CA). 
Following the recording of the flourophore (which indicates which base was incorporated), a 
palladium-catalysed tris(2-carboxyethyl)phosphine-mediated deallylation reaction removes the 
fluorophore and restores the 3'-hydroxyl on the deoxyribose sugar allowing for the next base to 
be incorporated and read (Bentley et al., 2008). This cycle is repeated to identify the next base 
and ultimately, obtain the nucleotide sequence.  
 
1.10.2 Gene expression analysis using RNA-Seq 
 To determine the gene expression levels of genes using the RNA-Seq methodology, the 
individual reads are mapped to a nucleotide reference and the total number of times that a read 
matches to a sequence within a gene is recorded (Rapaport et al.,2013). Since all genes are 
fragmented into lengths of ~300 nt, the longer the gene is, the more fragments into which the 
gene will be divided. Therefore, the total number of fragments that are mapped to a gene are 
normalized by gene length in order to account for the additional possibility of longer genes to 
have mapped fragments. For this reason, the number of reads mapped is divided by the number 
of thousand nucleotides per gene, or reads/fragments mapped per kilobases of sequence for every 
million reads mapped (RPKM/FPKM) (Oshlack and Wakeffeld, 2009). For example, if 500 reads 
mapped to a given gene, and the gene was 2500 nt long, the 500 mapped reads would be divided 
by 2.5 to yield 200 and subsequently divided through by every million reads mapped, allowing 
genes to be compared both within, and between samples (Rapaport et al., 2013). 
 
 
 
 
 
  
18 
 
Chapter 2: Research Goal and Specific Objectives 
 
2.1 Introduction 
 Mosquitoes serve as the vectors of several human and animal pathogens. Insecticides are 
used to suppress mosquito populations and protect humans and animals from disease. Insecticide 
resistance, however, results from the repeated use of chemical insecticides and becomes a 
practical problem in the management of mosquito borne diseases. The Southern house mosquito  
Culex quinquefasciatus Say is a globally-distributed mosquito and is the primary vector of West 
Nile virus, St. Louis encephalitis virus, Eastern Equine Encephalitis virus, Japanese Encephalitis 
virus, Chikungunja virus, and Wucheria bancroftii (Nasci and Miller, 1996; Fonseca et al., 2004; 
Arensburger et al., 2010; Cupp et al., 2011). One strain of Cx. quinquefasciatus, HAmCqG0, 
which has resistance to pyrethroids, has been further selected with permethrin for eight 
generations in the laboratory to produce the HAmCqG8 strain, and has ~300-fold higher 
resistance level than the HAmCqG0 parental strain (Xu et al., 2006a; Li and Liu, 2010). Multiple 
studies have identified various factors involved in insecticide resistance based on the HAmCq G8 
strain, including variations in the sodium channel (Xu et al., 2006b; Li et al., 2012; Xu et al., 
2012a), cytochrome P450s (Liu et al., 2011, Yang and Liu, 2011; Gong et al., 2013), and other 
previously uncharacterized factors (Liu et al., 2007). Taken together, these results indicate that 
insecticide resistance in Cx. quinquefasciatus is the result of multiple factors. Therefore, I 
hypothesize that the use of RNA-Seq, which can concurrently estimate the gene expression 
levels of all genes, to probe the gene expression profiles of the HAmCqG8 strain, will elucidate 
novel mechanisms of insecticide resistance in Cx. quinquefasciatus. The questions raised are: 1) 
what genes are up-regulated in the HAmCqG8 strain, both constitutively and upon exposure to 
19 
 
permethrin; and 2) are the genes identified as important to insecticide resistance in Cx. 
quinquefasciatus important in other mosquitoes. 
 In addition to the investigation of insecticide resistance genes, we were also interested in 
possible new targets for the development of insecticides against Cx. quinquefasciatus. For this, 
we chose to investigate the anautogenous blood feeding requirement of Cx. quinquefasciatus. 
Adult female Cx. quinquefasciatus require a period of time before they are capable of taking the 
blood meal during which, the female mates and continues with the necessary development to be 
competent for the acquisition of the blood meal itself (Williams and Patterson, 1969). Many 
studies have shown that genes and gene up-regulation are involved in the processing of the blood 
meal and subsequently, vitellogenesis (Chen et al., 2004, Hansen et al., 2005, Bryant et al., 
2010). Therefore I hypothesize that the use of RNA-Seq to characterize the gene expression 
profiles of newly-eclosed female Cx. quinquefasciatus will reveal genes involved in the 
requirements of the female for the taking of a blood meal. The two questions raised are: 1) what 
changes in gene expression occur during the early time points post-eclosion, and 2) are these 
gene changes related to vitellogenesis. 
 
2.2 The goal of research and specific objectives 
 In order to answer these two questions in 2.1 and gain valuable insights into insecticide 
resistance and they physiology of Cx. quinquefasciatus, the long-term goal of my project is to 
first, characterize the gene expression profiles of the highly permethrin-resistant strain of Cx. 
quinquefasciatus HAmCqG8 both in the absence of, and in presence of permethrin, and second, to 
characterize the gene expression profiles of Cx. quinquefasciatus during the early stages 
following eclosion in the female as they pertain to blood feeding. To achieve my long-term goals, 
20 
 
the following objectives will be performed: 1) characterization of the genes differentially 
expressed between the HAmCqG8 strain and its parental HAmCqG0 strain; 2) characterize the 
genes differentially expressed upon exposure to permethrin; 3) using the superfamily of 
cytochrome P450 genes, characterization of the up-regulation of P450 genes in a different 
mosquito species; 4) characterization of the changes in gene expression in newly eclosed female 
Cx. quinquefasciatus. 
 
2.2.1 Characterization of the genes differentially expressed between the HAmCqG8 strain 
and its parental HAmCqG0 strain 
 Earlier studies have investigated the genes involved in insecticide resistance in the 
HAmCqG8 strain through various technologies including SNP reaction analysis (Xu et al., 2006b; 
Li et al., 2012; Xu et al., 2012b), suppression subtractive hybridization (Liu et al., 2007), and 
qRT-PCR (Yang and Liu, 2011). With the advent of next generation sequencing, we are now able 
to concurrently probe the gene expression levels of nearly all genes within Cx. quinquefasciatus 
(Metzker et al., 2010). This is further aided by the availability of the annotated genome for Cx. 
quinquefasciatus (Arensburger et al., 2010). To identify the genes that are differentially 
expressed between the highly permethrin-resistant strain of Cx. quinquefasciatus HAmCqG8 and 
its parental low-resistance strain HAmCqG0, we will conduct RNA-Seq on the most pyrethroid-
resistant life stage, the fourth instar (Li and Liu, 2010), then conduct tests of differential gene 
expression and functional enrichment of associated gene ontology (GO) terms.  
 
 
2.2.2 Characterize the genes differentially expressed upon exposure to permethrin 
21 
 
 A recent study in our lab has identified that in the HAmCqG8 strain, several cytochrome 
P450 genes are up-regulated during an exposure to permethrin (Gong et al., 2013). Following a 
similar approach as outlines in 2.2.1, we will expose fourth instar HAmCqG8 to permethrin at the 
LC50 and LC70 rates for 24 h, which is an exposure period that has previously been shown to 
result in gene up-regulation (Zhu et al., 2008b; Gong et al., 2013). In addition an acetone control 
at the same rate of acetone (200 ppm) will be treated for the same 24 h interval. All samples will 
be sequenced using RNA-Seq, mapped to the Cx. quinquefaciatus genome and compared to an 
untreated zero hour reference. Following this, tests of differential gene expression, Venn diagram 
analyses, and functional enrichment of associated gene ontology (GO) terms will be used to 
identify the changes in gene expression for a highly permethrin-resistant strain of Cx. 
quinquefasciatus during permethrin exposure. 
 
2.2.3 Characterization of the up-regulation of P450 genes in a different mosquito species 
 Previous work has shown that different mosquito species have different susceptibilities to 
insecticides (Beckage et al., 2004; Pridgeon et al., 2008). In order to investigate the factors 
involved in insecticide resistance and to see if there are comparisons between different mosquito 
species, we will use the superfamily of cytochrome P450 genes to characterize the gene 
expression levels in Aedes aegypti to compare with the gene expression values of insecticide 
resistant Cx. quinquefasciatus (Yang and Liu, 2011). We will use qRT-PCR to proble the gene 
expression of all cytochrome P450 genes in the Ae. aegypti genome (Nene et al., 2007) to 
identify up-regulated P450 genes. Based on these results we will select several P450 genes for 
functional study using the GAL4:UAS enhancer trap methodology (Brand and Perrimon, 1993; 
22 
 
Bischof et al., 2007) to test the P450 gene for its functional capacity to degrade the type I 
pyrethroid permethrin and the type II pyrethroid beta-cypermethrin. 
 
2.2.4 Characterization of the changes in gene expression in newly eclosed female Cx. 
quinquefasciatus 
 Newly-eclosed Cx. quinquefasciatus females require a period of time before they will 
freely take a blood meal (Williams and Patterson, 1969). To characterize the genes that may be 
involved in preparing the female for the taking of a blood meal, we will first determine the time 
course for which females will take a blood meal by collecting newly-eclosed adults in 12 h 
intervals and subsequently providing them with a blood meal at 24 h post-eclosion and every 12 
h thereafter until 144 h post-eclosion. Once the time course for blood feeding has been 
determined, we will utilize RNA-Seq technology to probe the gene expression profiles of adult 
female Cx. quinquefasciatus from 2 h post-eclosion and every 12 h following until a time point 
that represents the age at which roughly half of the mosquitoes would take a blood meal. The 
gene expression values from the RNA-Seq sequencing will be estimated and differential gene 
expression will be tested as a time series to identify genes that are differentially expressed 
through the post-eclosion through to blooding time period. To identify if the genes detected as 
differentially-expressed throughout the time series by the RNA-Seq survey, we will characterize 
a set of genes identified as differentially-expressed in the RNA-Seq results along with selected 
genes known to be linked to vitellogenesis in mosquitoes including vitellogenins (Hansen et al., 
2004). We will then test to see if the gene expression changes in Cx. quinquefasciatus during the 
early time point following eclosion are related to vitellogenesis by select genes identified as 
involved in vitellogenesis by the qRT-PCR work. We will then use 20-hydroxyecdysone as well 
23 
 
as ecdysone agonists to treat Cx. quinquefasciatus to see if we can induce the expression of E74 
which regulates the expression of vitellogenin (Guoquiang et al., 2002). This will determine if 
the differentially-expressed genes in the early stages of adult female Cx. quinquefasciatus 
following eclosion are involved in the vitellogenesis competency of the mosquito. 
 
2.3 Significance 
 Characterization of gene expression profiles at the whole transcriptome level can 
elucidate patterns of gene expression that may otherwise go undetected in a posteriori 
approaches. The use of RNA-Seq to survey for uncharacterized factors involved in insecticide 
resistance in Cx. quinquefasciatus provides an ideal start point for future studies to identify the 
regulatory pathways involved in insecticide resistance, which may ultimately lead to an 
improvement of mosquito management. The same RNA-Seq technology applied to the 
previously uncharacterized early post-eclosion time points of Cx. quinquefasciatus adult females 
also represents the possibility for the discovery of new factors involved in host seeking and 
blood meal acquisition, which could represent novel targets for the development of new 
insecticides against Cx. quinquefasciatus. 
 
 
 
 
 
 
 
  
24 
 
Chapter 3: The Transcriptome Profile of the Mosquito Culex quinquefasciatus Following 
Permethrin Selection 
 
William R. Reid1, Lee Zhang1,2, Feng Liu1, Nannan Liu1? 
 
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849, USA 
2Genomics and Sequencing Laboratory, Auburn University, Auburn, AL 36849, USA 
?To whom correspondence should be addressed 
 
Accepted in PLoS ONE: DOI: 10.1371/journal.pone.0047163  
 
3.1 Abstract 
To better understand the genetic variation in the insecticide resistant mosquito, Culex 
quinquefasciatus, and to gain valuable insights into the gene interaction and the complex 
regulation system involved in the development of insecticide resistance, we conducted a whole 
transcriptome analysis of Culex mosquitoes following permethrin selection. Gene expression 
profiles for the lower resistant parental mosquito strain HAmCqG0 and their permethrin-selected 
high resistant offspring HAmCqG8 were compared and a total of 367 and 3982 genes were found 
to be up- and down-regulated, respectively, in HAmCqG8, indicating that multiple genes are 
involved in response to permethrin selection. However, a similar overall cumulative gene 
expression abundance was identified between up- and down-regulated genes in HAmCqG8 
mosquitoes following permethrin selection, suggesting a homeostatic response to insecticides 
through a balancing of the up- and down-regulation of the genes. While structural and/or 
cuticular structural functions were the only two enriched GO terms for down-regulated genes, the 
25 
 
enriched GO terms obtained for the up-regulated genes occurred primarily among the catalytic 
and metabolic functions where they represented three functional categories: electron carrier 
activity, binding, and catalytic activity. Interestingly, the functional GO terms in these three 
functional categories were overwhelmingly overrepresented in P450s and proteases/serine 
proteases. The important role played by P450s in the development of insecticide resistance has 
been extensively studied but the function of proteases/serine proteases in resistance is less well 
understood. Hence, the characterization of the functions of these proteins, including their 
digestive, catalytic and proteinase activities; regulation of signaling transduction and protein 
trafficking, immunity and storage; and their precise function in the development of insecticide 
resistance in mosquitoes will provide new insights into how genes are interconnected and 
regulated in resistance.  
Keywords: Pyrethroid resistance, gene expression, Culex quinquefasciatus, transcriptome, up-
regulation 
 
3.2 Introduction 
Mosquitoes are known vectors of parasites and pathogens of both human and animal diseases 
and their control is an important part of the global strategy to control mosquito-associated 
diseases (WHO, 1957). Insecticides are the most important component of this vector-control 
effort, and pyrethroids such as permethrin are currently the most widely used insecticides for the 
indoor control of mosquitoes worldwide and the only chemical recommended for the treatment 
of mosquito nets, the main tool for preventing malaria in Africa (Najera and Zaim, 2001). 
However, the development of resistance to insecticides, especially to pyrethroids, in mosquito 
vectors has become a global problem (Hemingway et al., 2000; Phillips, 2001; Liu et al., 2004; 
26 
 
Xu et al., 2005; Liu, 2008). An improved understanding of the mechanisms governing insecticide 
resistance is therefore necessary to provide a knowledge base for the development of novel 
strategies to prevent resistance development and other tools to control resistant mosquitoes; 
ultimately reducing the prevalence of mosquito-borne diseases. Resistance has been assumed to 
be a pre-adaptive phenomenon, in that prior to insecticide exposure rare individuals already exist 
who carry an altered genome that results in one or more possible mechanisms (factors) allowing 
survival from the selection pressure of insecticides (Sawicki and Denholm, 1984;.Brattsten et al., 
1986) In addition, some studies propose that resistance can also be induced by insecticide 
exposure (Vontas et al., 2010), and overall, the rate of development of resistance in field 
populations of insects depends upon the levels of genetic variability in a population (Liu and 
Scott, 1995; Liu and Yue, 2001). Efforts to characterize the genetic variation involved in 
insecticide resistance have therefore been fundamental in understanding the development of 
resistance and studying resistance mechanisms, as well as in practical applications such as 
designing novel strategies to prevent or minimize the spread and evolution of resistance 
development and the control of insect pests (Roush et al., 1990).  
The mosquito Culex quinquefasciatus Say is a primary vector of West Nile virus, St. 
Louis encephalitis virus, Eastern Equine Encephalitis virus, Japanese Encephalitis virus, 
Chikungunja virus, Wucheria bancroftii, and pathogens that cause lymphatic filariasis (Nasci and 
Miller, 1996; Arensburger et al., 2010). This mosquito species has a global distribution, 
especially throughout tropical and temperate climates of the world (Fonseca et al., 2004; Cupp et 
al., 2011). In Alabama, Cx. quinquefasciatus is the predominant mosquito species in urban areas. 
Current approaches to controlling mosquitoes in the state rely primarily on source reduction and 
the application of insecticides, primarily pyrethroids and organophosphates, for both larval and 
27 
 
adult mosquitoes (Liu et al., 2004). One northern Alabama Culex strain, HAmCqG0 collected 
from Huntsville, has demonstrated the ability to develop resistance and/or cross-resistance to not 
only pyrethroids and organophosphates (OPs), but also relatively new insecticides such as 
fipronil and imidacloprid (Liu et al., 2004). The HAmCqG0 mosquito strain has been further 
selected with permethrin for eight generations in the laboratory to produce the HAmCqG8 strain, 
which has a much higher level of resistance to permethrin than the parental strain, HAmCqG0 
(Xu et al., 2006a; Li et al., 2009; Li and Liu, 2010). In an effort to better understand the genetic 
variation in resistant mosquitoes and gain valuable insights into the genes involved in the 
development of permethrin resistance in Culex mosquitoes, we chose the most resistant life stage 
(fourth instar larvae)(Li and Liu, 2010) and conducted a whole transcriptome analysis of the 
mosquito Culex quinquefasciatus following permethrin selection and examined the gene 
expression profiles between the lower resistant parental strain HAmCqG0 and their permethrin-
selected high resistant offspring HAmCqG8 using Illumina RNA Seq (Morin et al., 2008). 
 
3.3 Materials and Methods 
3.3.1 Mosquito strains 
Culex quinquefasciatus strain HAmCqG0 is a low insecticide resistant strain with a 10-fold level 
of resistance to permethrin compared with the laboratory susceptible S-Lab strain (Li and Liu, 
2010). It was originally collected from Huntsville, Alabama in 2002 and established in laboratory 
without further exposure to insecticides (Liu et al., 2004). The HAmCqG8 strain is the 8th 
generation of permethrin-selected HAmCqG0 offspring and has a 2,700-fold level of resistance 
(Li and Liu, 2010). All mosquitoes were reared at 25?2oC under a photoperiod of 12:12 (L:D) h. 
The mosquito was reared strictly under identical rearing conditions for the two mosquito 
28 
 
populations to enter into the fourth instar stage at the same time, which was achieved through the 
controlling of the egg raft collection, egg hatching, and subsequent larval development and 
sample collection. 
 
3.3.2 RNA extraction  
A total of 200 fourth instar larvae of the HAmCqG8 and HAmCqG8 mosquito populations were 
pooled, flash frozen on dry ice and immediately processed for RNA extraction. The fourth instar 
lifestage was selected because it is the most permethrin-resistant lifestage (Li and Liu, 2010) 
which should provide for the greatest differences in gene expression between the low- and 
highly-permethrin resistant mosquito strains. Total RNA was extracted using the hot acid phenol 
extraction method (Liu and Scott, 1997), after which a total of 30?g of RNA was treated with 
DNase I using the DNA-Free kit from Ambion (Austin, TX) to remove any contaminant DNA. 
Total RNA was re-extracted with two successive acid phenol: chloroform (1:1) steps followed by 
a final chloroform extraction to remove any residual phenol. The RNA was then precipitated over 
ethanol and resuspended in sterile distilled water. After a 1?g aliquot of RNA had been visually 
inspected for quality and for DNA contamination on a 1% agarose gel, total RNA was sent for 
RNA-Seq analysis (Hudson Alpha Institute of Biotechnology [HAIB]). 
3.3.3 RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
processing 
RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA) and an 
Invitrogen Qubit (Invitrogen, Carlsbad, CA). Libraries were then prepared using the Illumina 
Tru-Seq RNA Sample Prep Kits (Illumina, San Diego, CA) for mRNA-Seq and a 3' poly A tail 
selection method. Samples were barcoded and run as one of four samples on a single lane of an 
29 
 
Illumina Hi Seq 2000 chip. Samples for the mRNA Seq were run using the PE-50 module 
(HAIB). Base calling, initial removal of low quality reads, and barcode parsing were conducted 
by the staff at HAIB. Data were sorted by coordinate using Picardtools 
(http://picard.sourceforge.net) and checked for mate-pair matching. Paired end reads were then 
mapped to the Cx quinquefasciatus genome from Vectorbase (Megy et al., 2009) using Tophat 
(Trapnell et al., 2009) with mate pair interval of 200 bases and the gtf basefeatures file. The --no-
novel-juncs flag was used in the alignment to suppress the discovery of novel spliceforms in 
order to estimate gene expression levels based on the Vectorbase annotation of the genes. Read 
counts were determined using Cufflinks, and the testing of differential expression was estimated 
using Cuffdiff (Roberts et al., 2011). Both Cufflinks and Cuffdiff were used because these 
programs provide a more accurate estimation of the gene expression value by adjusting for 
transcript fragment biases that occur at the ends of the transcripts and fragments during the 
library generation protocol (Kasper et al., 2010). To adjust for the unequal coverage across a 
gene, Cuffdiff uses a negative binomial distribution (Anders and Huber, 2010) and applies a 
likelihood function to estimate gene expression that reduces bias, increases reproducibility across 
libraries, and gives better correlated gene expression levels as estimated by qRT-PCR and 
determines differentially-expressed genes at the ?=0.05 false discovery rate (FDR) (Kasper et al., 
2010). After analysis, only genes with expression values ?1, as measured in number of fragments 
mapped for every thousand bases of gene length for every million fragments sequenced (FPKM), 
were retained for expression comparisons (Gan et al., 2010). 
 
 
3.3.4 Gene expression validation using quantitative real-time PCR (qRT-PCR) 
30 
 
The 4th instar larvae of each mosquito population had their RNA extracted for each experiment 
using the acidic guanidine thiocyanate-phenol-chloroform method (Liu and Scott, 1997). Total 
RNA (0.5 ?g/sample) from each mosquito sample was reverse-transcribed using SuperScript II 
reverse transcriptase (Stratagene) in a total volume of 20 ?l. The quantity of cDNAs was 
measured using a spectrophotometer prior to qRT-PCR, which was performed with the SYBR 
Green master mix Kit and ABI 7500 Real Time PCR system (Applied Biosystems). Each qRT-
PCR reaction (15 ?l final volume) contained 1x SYBR Green master mix, 1 ?l of cDNA, and a 
specific primer pair designed according to gene sequences (Appendix 3.1) at a final 
concentration of 3-5 ?M. All samples, including the no-template negative control, were 
performed in triplicate. The reaction cycle consisted of an initial UDG glycosylase step at 50?C 
for 2 min followed by a melting stage at 95?C for 10 min, followed by 40 cycles of 95?C for 15 
sec and 60?C for 1 min. Specificity of the PCR reactions was assessed by a melting curve 
analysis for each PCR reaction using Dissociation Curves software. Relative expression levels 
for the genes were calculated by the 2-??CT method using SDS RQ software (Livak and 
Schmittgen, 2001). The 18S ribosome RNA gene, an endogenous control, was used to normalize 
the expression of target genes (Yang and Liu, 2011; Liu et al., 2011). Preliminary qRT-PCR 
experiments with the primer pair (Appendix 3.1) for the 18S ribosome RNA gene designed 
according to the sequences of the 18S ribosome RNA gene had revealed that the 18S ribosome 
RNA gene expression remained constant in of HAmCqG8 and HAmCqG8 mosquito populations, 
so the 18S ribosome RNA gene was used for internal normalization in the qRT-PCR assays. Each 
experiment was repeated three to four times with different preparations of RNA samples. The 
statistical significance of the gene expressions was calculated using a Student's t-test for all 2-
sample comparisons and a one-way analysis of variance (ANOVA) for multiple sample 
31 
 
comparisons (SAS v9.1 software); a value of P?0.05 was considered statistically significant. 
 
3.3.5 Annotation, gene grouping, and functional gene enrichment analysis 
The genes were annotated for SCOP general and detailed functions using the predicted Cx. 
quinquefasciatus annotation information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html (Gough et al., 2001). Additional gene 
information for carboxylesterases was taken from the Vectorbase annotation for the 
Johannesburg strain version 1.1 (www.vectorbase.org) (Megy et al., 2009). Gene Ontology is a 
method of gene annotation that was introduced in 1998 (Ashburner et al., 2009). It is composed 
of three sets of structured gene ontology terms (GO terms) that have a carefully controlled 
vocabulary. These three sets represent 1) Cellular Component, which describe where the protein 
product is located at the sub-cellular and macromolecular complex level, 2) Biological Process, 
which denote gene products that are part of, or are themselves, biological processes, and 3) 
Molecular Function, which describe what the gene product does with regard to its function. Each 
gene may have multiple GO terms within each of the three sets of GO term ontology. Since the 
vocabulary of GO terms is carefully controlled, the occurrence of a given GO term can be 
compared between two distinct sets of genes. This allowed us to conduct an enrichment analysis 
of GO terms in the differentially-expressed gene sets against the entire expressed gene set using 
the Gene Ontology terms as annotated for the predicted genes in the Cx. quinquefasciatus 
genome using the online tool g:Profiler biit.cs.ut.ee/gprofiler/welcome.cgi (Reimand et al., 2007; 
Reimand et al., 2011). The g:Cocoa tool was used to test for GO term enrichment using a gSCS 
threshold for the significance threshold and a static background containing only genes with 
expression values of ?1. This analysis took all of the GO terms associated with the differentially 
32 
 
down- or up-regulated gene sets and determined if a given GO term was statistically over-
represented using a hypergeometric distribution to quantify the sampling probability that a given 
GO term is statistically more abundant in the up- or down-regulated gene set when compared to 
the abundance of that same GO term among the entire expressed gene set. 
 
3.4 Results  
3.4.1 Illumina RNA Seq data analysis  
The maximum numbers of 51 nt paired-end reads that passed Illumina quality filtering were 
32,540,882 and 37,184,673 for HAmCqG0 and HAmCqG8, respectively (Table 3.1), which is 
consistent with the data typically obtained in an RNA Seq reaction that is based on an Illumina 
HiSeq 2000 single lane consisting of eight barcoded samples with a maximum number of reads 
passing filter of ~46 million (Illumina, Inc. San Diego, CA). Reads were mapped to the Cx. 
quinquefasciatus genome (version: CpipJ1.2) from Vectorbase (www.vectorbase.org) (Megy et 
al., 2009).  
 
Table 3.1. Number of paired end reads from the Illumina HiSeq sequencing and the percentage 
of reads mapped to the Cx. quinquefasciatus (strain: Johannesburg) predicted transcriptome 
Mosquito strain HAmCqG0 HAmCqG8 
Total reads 32540882? 37184673 
Additional reads discarded 31509? 16219 
Reads mapped 23008772 30586459 
?Total number of FASTQ (DNA sequence with quality scores) reads passing the Illumina quality 
filter 
?Number of reads discarded due to low quality of one or both of the paired end reads 
 
Overall, the sequenced fragments mapped to a total of 14,440 genes, with 12,451 of these having 
a FPKM value of ?1.0 in both HAmCqG0 and HAmCqG8, which was used as the minimum value 
33 
 
to detect gene expression (Gan et al., 2010). All sequence traces and expression values have been 
submitted to the Gene Expression Omnibus at NCBI, reference accessions GSE33736 
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33736 and SRA048095 
(http://www.ncbi.nlm.nih.gov/sra/?term=SRA048095). 
 
3.4.2 Transcriptome profile: SCOP general categories and detailed function categories  
All expressed genes from both HAmCqG0 and HAmCqG8 were annotated for protein superfamily 
using the Structural Classification of Proteins (SCOP) annotations version 1.73 supplied for Cx. 
quinquefasciatus (http://supfam.cs.bris.ac.uk/SUPERFAMILY) (Hubbard et al., 1997), classified 
in terms of eight SCOP general categories, extra?cellular processes, intra?cellular processes, 
general, information, metabolism, regulation, not annotated, and other/unknown, according to the 
general function of the proteins. The genes expressed in both HAmCqG0 and HAmCqG8 were 
sorted into each of the eight SCOP general categories (Vogel et al., 2004) and then the expression 
values of each of these genes were summed within SCOP general category to obtain the 
proportion of total gene expression attributable to each of the SCOP categories (Fig. 3.1). 
Overall, the proportions of total gene expression were similar for HAmCqG0 and HAmCqG8, 
however there were notable differences between the two mosquito strains for the metabolism 
category,  which accounted for 32% of the gene expression in the entire HAmCqG8 genome 
compared to 26% in HAmCqG0, suggesting an up-regulation of genes relating to metabolism in 
response to permethrin selection. Another difference in the total gene expression was in the not 
annotated category in HAmCqG0, where it accounted for 23% of the gene expression in the entire 
genome compared to only 18% in HAmCqG8, suggesting the down regulation of a set of genes 
without functional annotation in response to permethrin selection. 
34 
 
Figure 3.1. Total proportions of cumulative gene expression levels in HAmCqG0 and HAmCqG8 
for the SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation 
information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html.  
 
3.4.3 Transcriptome profile: superfamily  
Genes were further categorized into protein superfamilies at a gene annotation level lower than 
detailed function to compare the distribution of the expression levels between HAmCqG0 and 
HAmCqG8. This allowed us to evaluate changes in the general gene expression within each of the 
superfamilies following permethrin selection. A log FPKM transformation was used to normalize 
the gene expression values and these were then plotted as beanplots (Fig. 3.2, Appendix 3.2). The 
distribution of each superfamily was broadly classified as unimodal, bimodal, or multimodal 
(Appendix 3.2) according to the similarities of gene expression within that superfamily. In 
addition, the values of skewness and kurtosis for the gene expression distribution were 
calculated, representing the symmetry of the gene distributions within the log normal 
35 
 
distributions (a positive skewness represents a gene distribution where a majority of genes have 
low expression levels and a negative skewness one where a majority of the genes have high 
expression levels) and the degree of sharpness of the curve (in leptokurtic distributions, groups 
of genes are expressed at similar expression levels and in platykurtic distributions, genes are 
expressed across a range of expression levels). Overall, all the superfamilies were comparable 
for HAmCqG0 and HAmCqG8, both in terms of expression levels and in numbers of genes (as 
shown along the Y and the X axes, respectively, in Fig. 3.2, and in Appendix 3.2). This suggested 
that the permethrin selection may not have significantly influenced the overall expression levels 
of the genes in most superfamilies, however, in some cases the overall gene expression 
distribution in the two strains did differ slightly in a few superfamilies. For example, the Di-
Copper containing center gene superfamily showed a multi modal distribution with three 
expression peaks in both HAmCqG8 and HAmCqG0.  
However, while the magnitudes of all three expression peaks were similar for a number of genes 
in HAmCqG8, the peak with the lower mode of expression was >2-fold higher than the 
intermediate peak, and more than 5-fold higher than the highest mode in HAmCqG0. Similar 
patterns were also found for the C-type lectin-like, NAP-like, and PLP binding barrel 
superfamilies. These slight changes in the gene expression distribution pattern may reflect the 
influence of up-regulated genes on the overall gene expression pattern in each of the 
superfamilies. The lysozyme-like superfamily, compared with HAmCqG0 which had a single 
mode, contained two modes in HAmCqG8 with one distribution positively and the other 
negatively skewed, suggesting that while some genes in this superfamily were up-regulated in 
HAmCqG8 compared with HAmCqG0, the others may be down regulated. 
 
36 
 
Figure 3.2. Log normal bean-plots for all expressed genes within SCOP superfamilies (SCOP 
version 1.75; supfam.cs.bris.ac.uk/SUPERFAMILY/index.html) in HAmCqG0 and HAmCqG8. 
The distribution along the Y axis indicates a higher level of gene expression, while the 
distribution along the X axis indicates the proportion of genes expressed at the given level of 
gene expression along the Y axis. Distributions are oriented along a common central baseline so 
that distributions in red (HAmCqG0) have more genes expressed at a given gene expression level 
(log FPKM) if the distribution is further to the left on the X axis, while distributions in blue 
(HAmCqG8) are higher if they are further to the right of the X axis. The central vertical baseline 
for each superfamily is a mirror point for the two distributions. 
 
3.4.4 Transcriptome profile: differential gene expression between HAmCqG0 and HAmCqG8 
37 
 
Looking at the above SCOP general categories, detailed function categories and superfamily 
categories there is an overall similarity in the pattern of gene expression over the whole 
transcriptome level between the lower resistance parental mosquito HAmCqG0 and their 
permethrin selected offspring HAmCqG8. We therefore went on to characterize the gene 
expression level between the two mosquito strains using the Cuffdiff algorithm and applying 
a >2-fold differential expression cut off threshold. A total of 3982 down- and 367 up-regulated 
genes were identified in HAmCqG8 (Table 3.2, Appendix 3.3;3.4) compared to HAmCqG0. 
Overall, although there were more than 10 times the number of genes down-regulated than up-
regulated, the cumulative gene expression values (FPKM) between the down- and up-regulated 
genes (1.43 ? 105 and 1.53 ? 105, respectively) were similar (Table 3.3). Interestingly, the 
predominant SCOP general function category for the down-regulated genes was the non-
annotated category (NONA, 2016 genes), which accounted for 50% of the down-regulated genes 
(Table 3.2, Fig. 3.3), and represented 77% of the total cumulative expression (FPKM) of all of 
the down-regulated genes. 
Table 3.2. Numbers of differentially-expressed genes and their cumulative gene expression level 
in HAmCqG8 sorted by the Structural Classification of Proteins general function category 
 Down-regulated? Up-regulated 
SCOP? general function 
category 
#genes FPKM* range and (cumulative) #genes FPKM range and 
(cumulative) 
Extra-cellular processes 101 0.1 - 126.4     (1.29 ? 103) 20 1.0 - 121.8    (5.42 ? 102) 
General 355 0.1 - 192.1     (4.31 ? 103) 39 1.0 - 1750.5  (5.99 ? 104) 
Information 171 0.1 - 344.9     (3.68 ? 103) 5 4.3 - 66.0      (1.05 ? 102) 
Intra-cellular processes 359 0.1 - 255.4     (5.18 ? 103) 58 1.7 - 5763.6  (1.28 ? 104) 
Metabolism 397 0.1 - 737.5     (1.15 ? 104) 91 1.1 - 47162.3 (1.02 ? 105) 
NONA? 2016 0.0 - 33037.0 (1.10 ? 105) 125 1.0 - 5766.3  (2.62 ? 104) 
Other 57 0.6 - 167.1     (1.26 ? 103) 5 7.5 - 1742.1  (3.76 ? 103) 
Regulation 526 0.0 - 584.3     (5.56 ? 103) 24 1.5 - 865.9    (1.25 ? 103) 
TOTAL 3982 (1.43 ? 105) 367 (1.53 ? 105) 
?Down-regulated /Up-regulated genes represent those genes that differed in their expression level (FPKM) in 
HAmCqG8 by more than two fold when compared to the parental strain HAmCqG0 
? SCOP general function categories annotated using the predicted Cx. quinquefasciatus annotation (version 1.75)  
*Fragments mapped Per Kilo bases of reference sequence for every Million fragments sequenced 
?NONA: Not annotated 
 
38 
 
Table 3.3. Gene Ontology (GO) term enrichment analysis results for differentially expressed 
genes in HAmCqG8 
GO level GO term? Term domain and name # hits p-value? 
 
Down-regulated genes 
   
Molecular function - - 
          structural molecule activity (GO:0005198) 163 1.08 ? 10-11 
                    structural constituent of cuticle (GO:0042302) 85 3.19 ? 10-18 
     
Up-regulated genes    
Biological process (GO:0008150) 193 4.28 ? 10-10 
          metabolic process (GO:0008152) 139 1.02 ? 10-7 
                    oxidation-reduction process (GO:0055114) 38 5.39 ? 10-9 
                    proteolysis (GO:0006508) 55 2.35 ? 10-16 
Molecular function (GO:0003674) 250 9.80 ? 10-6 
          Catalytic activity (GO:0003824) 162 2.09 ? 10-13 
                    oxidoreductase activity (GO:0016491) 47 1.05 ? 10-10 
                              monooxygenase activity (GO:0004497) 29 2.84 ? 10-15 
                    hydrolase activity (GO:0016787) 90 1.29 ? 10-12 
                             peptidase activity (GO:0008233) 54 2.16 ? 10-14 
                                   peptidase activity, acting on L-amino acid peptides (GO:0070011) 52 1.99 ? 10-15 
                                                exopeptidase activity (GO:0008238) 10 4.66 ? 10-5 
                                                carboxypeptidase activity (GO:0004180) 7 1.03 ? 10-4 
                                                endopeptidase activity (GO:0004175) 41 1.47 ? 10-12 
                                                metallopeptidase activity (GO:0008237) 20 6.26 ? 10-10 
                                                metalloendopeptidase activity (GO:0004222) 11 2.42 ? 10-6 
                             serine hydrolase activity (GO:0017171) 30 4.39 ? 10-9 
                                       serine-type peptidase activity (GO:0008236) 30 4.39 ? 10-9 
                                               serine-type endopeptidase activity (GO:0004252) 28 1.89 ? 10-8 
                         hydrolase activity, acting on glycosyl bonds (GO:0016798) 15 1.23 ? 10-7 
                             hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553) 13 1.17 ? 10-6 
          Electron carrier activity (GO:0009055) 28 6.65 ? 10-14 
          Binding activity - - 
                   tetrapyrrole binding (GO:0046906) 32 1.55 ? 10-17 
                   iron ion binding (GO:0005506) 33 3.19 ? 10-15 
                             heme binding (GO:0020037) 32 1.32 ? 10-17           
?Annotation from the Gene Ontology consortium (version 1.2084; release date: 12:07:2011) 
? Cumulative hypergeometric p-values for GO terms of genes that were differentially up-
regulated in when tested against all genes with expression levels of FPKM > 1 using the g:SCS 
threshold. 
* GO Terms that do not have values for the number of hits or p-values were not statistically 
enriched in the functional enrichment analysis, but are included in the table to provide all 
parenthood connections. 
 
This result is consistent with the results for the SCOP general categories, where a decrease in the 
total gene expression was found in the NONA category for HAmCqG8 compared to HAmCqG0. In 
contrast, only 17% of the cumulative expression of the up-regulated genes in HAmCqG8 was in 
the NONA category. Nevertheless, the highest cumulative gene expression of up-regulated genes 
39 
 
was in the metabolism general function category (Table 3.2, Fig 3.3), which accounted for 67% 
(FPKM) of all of the up-regulated gene expression, while the cumulative expression of this 
category accounted for only 8% of the total cumulative expression of the down-regulated genes. 
Taken together, these results not only reveal equally dynamic changes in abundance for both the 
increases and decreases in the total gene expression for different categories in Cx. 
quinquefasciatus following permethrin selection, but also indicate an important feature of 
metabolic gene up-regulation in response to insecticide resistance and permethrin selection that 
is consistent with the data from the SCOP general category analysis, where the total expression 
in the metabolism general category was found to be higher in HAmCqG8 than in HAmCqG0.  
 
Figure 3.3. Combined gene expression levels for all up- and down-regulated genes within a 
general function category in HAmCqG8 compared to those expressed in HAmCqG0.  
 
3.4.5. Functional enrichment analysis of GO terms for differentially expressed genes 
40 
 
To interpret the gene expression data and gain more insight into the biological mechanisms 
driving the up- and down-regulated genes, Gene Ontology (GO) term enrichment or functional 
enrichment analysis (Castillo-Davis and Hartl, 2002; Reimand et al., 2007; Reimand et al., 2011) 
was performed to identify significantly enriched GO terms among the up- and down regulated 
genes in HAmCqG8. GO terms are groups of genes sharing common biological function, 
regulation, or interaction (http://biit.cs.ut.ee/gprofiler/gconvert.cgi). A statistical analysis reveals 
which GO terms are over-represented and have hence been ?enriched?, or are more prevalent, 
within the down- or up-regulated genes in HAmCqG8. Each gene can have multiple GO terms 
and these are part of a carefully-controlled vocabulary that allows for genes of various 
annotations to be grouped according to common attributes such as their cellular components, 
biological processes, or molecular functions (Ashburner et al., 2009). Overall, the functional 
enrichment analysis showed that among the down-regulated gene set in HAmCqG8, the terms 
GO:000581 (structural molecule activity) and GO:0042302 (structural constituent of cuticle) 
were the only statistically over represented GO terms (P=1.08 ? 10-11 and 3.19 ? 10-18, 
respectively) (Table 3.3). For the 3982 down-regulated genes in HAmCqG8, there were 85 hits for 
GO:000581 and 163 hits for GO:0042302, indicating that 85 of the 3982 down-regulated genes 
had the structural molecule activity function and 163 the structural constituent of cuticle GO 
terms. Since these were the only enriched molecular function GO terms among the down-
regulated gene set, there are likely to be changes of gene expression in the structural component 
of the cuticle in the HAmCqG8 mosquitoes compared to the parental HAmCqG0 strain. 
The functional enrichment analysis of the 367 up-regulated genes in HAmCqG8 identified 
25 statistically enriched GO terms (Table 3.3), four of which were in the categories biological 
process (GO:0008150), metabolic process (GO:0008152), proteolysis (GO:0006508), and 
41 
 
oxidation-reduction process (GO:0055114). Among these four enriched GO terms, biological 
process (GO:0008150) and metabolic process (GO;0008152) were the predominant GO terms, 
with 193 and 139 hits, respectively,  suggesting that the major up-regulated genes were involved 
in biological and metabolic processes. The remaining 21 statistically enriched GO terms were in 
the molecular function category (Table 3.3) and the GO terms for catalytic activity 
(GO:0003824), hydrolase activity (GO:0016787), peptidase activity (GO:0008233), peptidase 
activity acting on L-amino acid peptides (GO:0070011), and oxidoreductase activity 
(GO:0016491) were the predominant GO terms, with hits that ranged from 162 to 47. Comparing 
the statistically enriched GO terms between the up- and down-regulated genes, these two sets of 
genes had obvious differences in their functions: the down-regulated genes primarily represented 
structural or cuticular structural activity functions, while the up-regulated genes were 
predominantly related to catalytic, metabolic, and proteolytic activity. 
 
3.4.6. The molecular functional parenthood relationships of the GO terms among up-
regulated genes and their interconnection 
The relationships among the GO terms in the molecular function category were investigated in 
the up-regulated genes in HAmCqG8 by determining whether their connection was a part of the 
same process or whether a parenthood process was involved (Ashburner et al., 2009). Overall, 3 
functional sets of GO terms were found to be significantly overrepresented among the GO terms 
for molecular function (Fig. 3.4, Table 3.3), namely electron carrier activity, binding, and 
catalytic activity. The electron carrier activity set was mainly associated with GO terms in 
cytochrome P450 genes (Appendix 3.5).  
42 
 
Figure 3.4. Parent-Child association for functionally enriched Gene Ontology (GO) terms among 
genes that were up-regulated in HAmCqG8. GO terms associated with the up-regulated genes in 
HAmCqG8 were considered statistically at <0.001 using the g:SCS threshold in g:Cocoa 
(http://biit.cs.ut.ee/gprofiler/gcocoa.cgi). Colored boxes represent statistically functionally 
enriched GO terms, while the nonsignificantly-enriched GO term is marked in white and 
provided to display all of the parent-child relationships in the network. Lines and/or arrows 
represent connections between or among different GO terms. Solid lines represent relationships 
between two enriched GO terms. Dashed lines represent relationships between enriched and 
unenriched terms to connect all of the nodes on the directed acyclic graph. 
 
The category for binding had three child branch nodes, all of which were related to metal 
binding: tetrapyrrole binding, iron binding, and heme binding (Fig. 3.4). These child branch 
nodes were again associated with the GO terms that were mainly overrepresented among 
cytochrome P450 genes (Appendix 3.5). The next major category was catalytic activity, which 
had two main child branch nodes: oxidoreductase activity with an additional branch node for 
43 
 
monooxygenase activity, both of which had their GO terms present in the genes annotated as 
cytochrome P450s (Appendix 3.5); and hydrolase activity, which contained three additional 
branch nodes. Of these additional hydrolase branch nodes, the first was for hydrolase activity of 
glycosyl bonds, with an additional sub-branch node for hydrolyzing O-glycosyl compounds. This 
was significantly overrepresented among the enzymes corresponding to the function of 
hydrolyzing glycosyl compounds such as alpha-L-fucosidases, alpha amylases and alpha 
glucosidases. The other two additional hydrolase branch nodes were peptidase/proteinase 
activity, which had an additional six sub-branch nodes relating to different peptidase/proteinase 
activities, and serine hydrolase activity, which had two additional sub-branch nodes for serine-
type peptidase activity and serine-type endopeptidase activity (Fig. 3.4). The 
peptidase/proteinase and serine hydrolase activity nodes interconnected through the GO term 
nodes of endopeptidase activity and peptidase activity acting on L-amino acid peptides, 
suggesting that the GO terms associated with proteinase activity among the differentially up-
regulated gene set in HAmCqG8 were interconnected. Therefore, investigating the relationships 
among these enriched GO term categories of up-regulated genes revealed that functional 
categories were mainly overrepresented among P450s and proteases/serine proteases.  
Indeed, the up-regulation of gene expression in these two categories was further 
confirmed by validation study of gene expression using qRT-PCR. Overall, the qRT-PCR 
validation data was consistent with the RNA-Seq data, showing a general trend of differential 
expression of genes between HAmCqG8 and HAmCqG0. A total of 14 up-regulated P450 genes 
and 24 protease related genes, which showed ? 2-fold higher expression in HAmCqG8 compared 
with HAmCqG8 in the RNA-Seq data, were selected for the study (Table 3.4).  
 
44 
 
Table 3.4. qRT-PCR validation of selected up-regulated genes in HAmCqG8 as identified by the 
RNASeq quantification. 
   Fold overexpression in 
HAmCqG8? 
Gene category Vectorbase  Annotation? RNASeq qRT-PCR 
Cytochrome P450 CPIJ002538 CYP6AG12? 3.7 2.1?? 
 CPIJ005959 CYP6AA7? 7.3 2.1 
 CPIJ005957 CYP6AA9? 6.6 2.8 
 CPIJ010546 CYP9J34? 13.4 2.9 
 CPIJ009478 CYP4D42v1? 2.4 3.2 
 CPIJ005956 CYP6BZ2? 3.3 3.7 
 CPIJ010537 CYP9J45? 4.8 3.8 
 CPIJ012470 CYP9AL1? 9.2 3.8 
 CPIJ014218 CYP9M10? 3.7 4.2 
 CPIJ010225 CPY12F7? 3.9 5.2 
 CPIJ010227 CYP12F13? 7.1 5.2 
 CPIJ010543 CYP9J40? 7.2 6.0 
 CPIJ005955 CYP6P14? 8.2 6.3 
 CPIJ020229 CYP4D42v2? 2.4 7.0 
Protease CPIJ002139 HzC4 chymotrypsinogen  4.3 1.1 ? 0.11 
 CPIJ002130 kallikrein-7  2.4 1.5 ? 0.50 
 CPIJ013319 metalloproteinase  3.5 1.5 ? 0.10 
 CPIJ009106 angiotensin-converting enzyme  2.7 1.5 ? 0.84 
 CPIJ001240 cathepsin B-like thiol protease  5.3 1.6 ? 0.46 
 CPIJ019428 trypsin 2  3.4 1.6 ? 0.04 
 CPIJ004086 angiotensin-converting enzyme  5.7 1.7 ? 0.62 
 CPIJ008873 prolylcarboxypeptidase  3.5 1.7 ? 1.09 
 CPIJ002135 trypsin alpha-4  5.9 1.8 ? 0.84 
 CPIJ016012 tryptase-2  2.2 1.8 ? 0.10 
 CPIJ002142 chymotrypsin BI  2.8 2.0 ? 0.42 
 CPIJ006803 zinc metalloproteinase nas-7  4.5 2.0 ? 0.21 
 CPIJ007383 endothelin-converting enzyme 1  2.5 2.1 ? 1.08 
 CPIJ010224 metalloproteinase  2.9 2.4 ? 0.74 
 CPIJ014523 elastase-3A  3.0 2.4 ? 0.71 
 CPIJ019029 metalloproteinase  2.6 3.6 ? 0.70 
 CPIJ002128 mast cell protease 2  16.1 3.6 ? 0.04 
 CPIJ006542 chymotrypsin-2  19.7 5.4 ? 1.84 
 CPIJ010805 carboxypeptidase A1  4.4 6.9 ? 3.72 
 CPIJ006076 hypodermin-B  17.0 11.6 ? 4.96 
 CPIJ001743 carboxypeptidase A2  5.4 16.3 ? 5.48 
 CPIJ003623 coagulation factor XII  7.1 54.2 ? 19.79 
 CPIJ001742 zinc carboxypeptidase  3.0 99.5 ? 19.35 
 CPIJ009594 nephrosin  21.7 144.3 ? 13.8 
?Culex quinquefasciatus genome, Johannesburg strain CpipJ1.2, June 2008; 
http://cquinquefasciatus.vectorbase.org/ 
?Expressed as fold change in gene expression in HAmCqG8 compared to HAmCqG0 
?Annotations for cytochrome P450 genes were taken from the most current annotation based on: 
Nelson (2009) The Cytochrome P450 Homepage. Human Genomics 4, 59-65: 
http://drnelson.uthsc.edu/CytochromeP450.html 
??Data reprinted from Yang and Liu, 2011 
 
All 14 cytochrome P450s were up-regulated by at least 2-fold in the HAmCqG8 strain compared 
45 
 
with HAmCqG0, which was consistent with the data generated using the RNAseq. Among the 23 
up-regulated proteinase genes that have been identified by RNAseq, 14 of them (60%) were up-
regulated by at least 2-fold in the HAmCqG8 strain and nine were up-regulated with a range of 
1.5- to 1.8-fold compared with HAmCqG0 (Table 3.4). However, one of the proteinase genes had 
an expression level of 1.1-fold in HAmCqG8 compared with HAmCqG0, which was significantly 
different from the RNAseq data. 
 
3.5 Discussion 
Based on the findings of our previous research, which has included synergism studies on the 
inhibition of metabolic enzymes (Xu et al., 2005), studies on the target site insensitivity of 
sodium channels in permethrin resistance (Xu et al., 2006b), gene expression profiles of 
resistance from a resistant-susceptible mosquito subtractive library (Liu et al., 2007), research 
into the genetic inheritance of permethrin resistance (Li and Liu, 2010), and, most recently, 
studies of the gene expression and characterization of P450 genes covering the entire genome 
sequence of resistant mosquitoes (Yang and Liu, 2011; Liu et al., 2011), it seems clear that a 
multiple mechanism/gene-interaction phenomenon is responsible for the development of 
permethrin resistance in Culex mosquitoes. We consider it very likely that normal biological and 
physiological pathways and gene expression signatures are altered in the resistant mosquitoes 
through changes in multiple gene expression in the resistant mosquitoes following insecticide 
selection that allow them to adapt to environmental or insecticide stress. While a great deal of 
effort has been devoted to identifying and characterizing the mechanisms and genes involved in 
insecticide resistance, and significant progress has been made, our previous approaches to 
characterizing the individual genes associated with insecticide resistance have not yet resulted in 
46 
 
a global understanding of the complex processes responsible for resistance. The recent genome 
sequencing of Cx. quinquefasciatus (Arensburger et al., 2010) has made direct comparisons of 
gene expression at the whole genome level between samples possible. The whole transcriptome 
analysis of the mosquito Culex quinquefasciatus following permethrin selection using Illumina 
RNA Seq reported here has allowed us to compare the cumulative gene expression in HAmCqG0 
and HAmCqG8 mosquitoes in the SCOP general function categories and superfamilies, enabling 
us to evaluate major changes in the gene expression within each of the categories in the 
mosquitoes following permethrin selection using their median expression values. In general, 
similar levels of total cumulative gene expression were identified in the HAmCqG0 and 
HAmCqG8 mosquitoes in each of the general function categories, suggesting that the permethrin 
selection may not change the majority of the gene expression occurring in the mosquito genome, 
but that the changes that are found in only a select number of genes should be correlated to the 
permethrin selection process undergone by HAmCqG8.  
Results from our previous studies (Liu et al., 2004, Xu et al., 2005; Liu and Yue, 2001, 
Xu et al., 2006a, Liu et al., 2007) and from many others (David et al., 2005; Strode et al., 2006; 
Strode et al, 2008, Muller et al., 2008; Marcombe et al., 2009; Vontas et al., 2005) suggest that 
the interaction of multiple insecticide resistance mechanisms or genes may be responsible for 
insecticide resistance. While it is unclear whether and how these up-regulated genes are 
associated with insecticide resistance, the findings reported in these papers suggest that 
insecticide resistance in mosquitoes involves both multiple gene up-regulation and multiple 
complex interaction mechanisms. Taken together, the above findings suggest that not only is 
insecticide resistance conferred via multi-resistance mechanisms or up-regulated genes, but it is 
mediated through the interaction of resistance genes. The current study identified a total of 367 
47 
 
and 3982 genes that were up- and down-regulated, respectively, in permethrin selected offspring 
HAmCqG8 compared with the parental HAmCqG0 strain. These results provide further evidence 
to confirm our hypothesis that multiple gene expression in resistant mosquitoes changes 
following insecticide selection, thus allowing them to adapt to environmental or insecticide 
stress. Further, when we validated our RNAseq data using qRT-PCR, we were able to confirm 
that all of the cytochrome P450 genes identified as upregulated along with 60% of the proteases 
were indeed upregulated. Previous work using human colorectal cell lines showed that among 
192 human exons , 88% of those identified as overexpressed using RNASeq could be validated 
as having either higher or lower expression using qRT-PCR, although the fold expression 
between the two strains was variable (Griffith et al., 2010). This suggested that the RNAseq 
methodology was suitable for the identification of genes putatively involved in insecticide 
resistance based on gene expression level, although some genes of interest may be overlooked 
due to differences in gene sequence, or genes involved in cell signaling that do not need to be 
more than two-fold expressed in order to be of importance to insecticide resistance. 
To interpret the gene expression data and gain fresh insights into the biological 
mechanisms affected by the up- and down-regulated genes/proteins, we characterized the GO 
term enrichment, or functional enrichment, by identifying the significantly enriched GO terms 
among the up- and down-regulated genes in the low resistance parental strain and the high 
resistance eighth generation offspring. As described earlier, three categories of GO terms are 
used to describe gene products: biological processes, molecular functions, and cellular 
components (Ashburner et al., 2009). This approach facilitates efforts to understand the 
functional relevance of genes, allowing genes or family members that share functional and 
structural properties to be studied as a whole. Our comparison of the enriched GO terms in the 
48 
 
up- and down-regulated genes in HAmCqG8 revealed that the two enriched GO terms for the 
down-regulated genes represented primarily structural or cuticular structural functions and 50% 
of all the down-regulated genes, representing 77% of the total cumulative expression of those 
genes, were non-annotated. In contrast, the enriched GO terms for the up-regulated genes 
represented mainly the catalytic, metabolic, and proteolytic functions, and only 17% of the 
cumulative expression of the up-regulated genes was in the NONA category. Nevertheless, from 
an overall cumulative gene expression point of view, we saw similar expression levels between 
the up- and down-regulated genes in permethrin selected HAmCqG8. Taken together, these results 
not only revealed different patterns in the enriched GO terms/functions for both the up- and 
down regulated genes, but also equally the dynamic changes in the abundance of both the total 
increased and the total decreased gene expression in Culex mosquitoes following permethrin 
selection, suggesting a homeostatic response of mosquitoes to insecticides through a balancing of 
up- and down-regulation of genes (Morgan 1997; 2001). 
A number of mechanisms have been proposed for the balancing of up- and down-
regulation, including: 1) an adaptive homeostatic response that protects the cell from the 
deleterious effects of oxidizing species, nitric oxide, or arachidonic acid metabolites from 
catalytic and/or metabolic enzymes (Morgan 2001; White and Coon, 1980); 2) a homeostatic or 
pathological response to inflammatory processes (Morgan, 1997); and/or 3) a need for the tissue 
to utilize its transcriptional machinery and energy for the synthesis of other components involved 
in the inflammatory response (Morgan, 1989). These hypotheses all offer reasonable 
explanations for our observation of both up- and down-regulation of multiple genes in the 
resistant mosquitoes following permethrin selection. For example, down-regulation of genes with 
structural or cuticular structural functions could be linked to the homeostatic response that 
49 
 
mosquitoes utilize to protect the cell from the toxic effects of oxidizing species derived from the 
extra metabolic proteolytic, and/or catalytic enzymes and metabolites that result from the up-
regulated metabolic enzymes. This homeostatic response might also balance the usage of energy, 
O2, and the other components needed for the syntheses of the up-regulated gene products and the 
catalytic or metabolic processes known to play important roles in mosquito resistance. 
The functional relationships among the enriched GO terms of up-regulated genes/proteins 
allowed us to identify the key components involved in insecticide resistance and gain an insight 
into the molecular mechanisms in resistant mosquitoes as a whole. Three molecular function 
categories, namely electron carrier activity, binding, and catalytic activity, were significantly 
overrepresented among the GO terms for the up-regulated genes. Investigating the relationships 
among these enriched GO term categories revealed that functional categories were mainly 
overrepresented among P450s and proteases/serine proteases. Among these two key components, 
the importance of P450s has been extensively studied and it has been demonstrated that basal 
and up-regulation of P450 gene expression can significantly affect the disposition of xenobiotics 
or endogenous compounds in the tissues of organisms, thus altering their pharmacological and/or 
toxicological effects (Pavek and Dvorak, 2008). In many cases, increased P450-mediated 
detoxification has been found to be associated with enhanced metabolic detoxification of 
insecticides, as evidenced by the increased levels of P450 proteins and P450 activity that result 
from constitutive overexpression of P450 genes in insecticide resistant insects (Carino et al., 
1992; Liu and Scott, 1997; Liu and Scott, 1998; Zhu et al., 2008a; Zhu et al., 2008b; Zhu and 
Liu, 2008; Zhu et al., 2010; Hardstone et al., 2010; Feyereisen et al., 2011; Liu et al., 2011). In 
addition, multiple P450 genes have been identified as being up-regulated in several individual 
resistant organisms, including house flies and mosquitoes (Zhu et al., 2008a; Zhu and Liu, 2008; 
50 
 
Marcombe et al., 2009; Itokawa et al., 2010; Yang and Liu, 2011; Liu et al., 2011), thus 
increasing the overall expression levels of P450 genes. Our recent studies on the characterization 
of P450s, their expression profiles, and their important role in the response to insecticide 
treatment found that multiple P450 genes were up-regulated in resistant and permethrin selected 
Cx quinquefasciatus (Yang and Liu, 2011; Liu et al., 2011). These findings together strongly 
suggest that overexpression of multiple P450 genes is likely to be a key factor governing the 
increased levels of detoxification of insecticides and insecticide resistance. 
In contrast to the well-known role of P450s in insecticide resistance, apart from a few 
examples, less is known about the function of proteases/serine proteases in resistance. Proteases 
are a potent class of enzymes that catalyze the hydrolysis of peptide bonds and are known to be 
involved in a wide range of physiological functions, including the digestion of dietary protein, 
blood coagulation, immune response, hormone activation, and development (Krem et al., 2000). 
In addition to their digestive, catalytic, proteinase activities, proteases/serine proteases are 
involved in the regulation of signaling transduction (Burysek et al., 2002; Trejo, 2003; Ramsay et 
al., 2008; Marrs et al., 2012) and cellular protein trafficking in eukaryotic cells (Lemberg, 2011). 
Indeed, the up-regulation of protease genes have been identified in in DDT resistant An. gambiae 
(Vontas et al., 2005), fenitrothion resistant house flies, Musca domestica (Ahmed et al., 1998; 
Wilkins et al., 1999), as well as DDT resistant D. melanogaster (Pedra et al., 2004). It has been 
suggested that the up-regulation of proteases may enable insects to rapidly degrade proteins for 
their re-synthesis into detoxification enzymes as has been postulated for M. domestica when 
challenged with the insecticide fenitrothion (Wilkins et al., 1999). In addition, two serine 
protease genes from Cx. pipiens pallens have been found to be up-regulated in a deltamethrin-
resistant strain (Wu et al., 2004). These reports, together with the findings reported here, suggest 
51 
 
the importance of the up-regulation of proteases in insecticide resistance. Whether the up-
regulated proteases identified in the resistant mosquitoes play a role in the degradation of 
proteins for biosynthesis of the up-regulated metabolic proteins, particularly P450s and the other 
proteins involved in the regulation of insecticide resistance, or whether there is some form of 
interaction with the up-regulated genes associated with signaling transduction and protein 
trafficking needs further investigation.  
In conclusion, this study not only provides a catalog of genes that were co-up- and down-
regulated and information about their potential functions, but may also ultimately lead to a 
deeper understanding of transcriptional regulation and the interconnection of co-regulated genes, 
including metabolic genes, genes with catalytic activities, genes with proteolytic activities, and 
genes with, perhaps, functions involved in the regulation, signaling transduction, and protection 
of cells and tissues in resistant mosquitoes. It has been suggested that co-overexpressed genes are 
frequently co-regulated (Blalock et al., 2004; Clarke and Zhu, 2006). Therefore, characterizing 
these co-regulated genes as a whole will represent a good starting point for characterizing the 
transcriptional regulatory network and pathways in insecticide resistance, improving our 
understanding of the dynamic, interconnected network of genes and their products that are 
responsible for processing environmental input, for example the response to insecticide pressure, 
and the regulation of the phenotypic output, in this case, the insecticide resistance of insects 
(Clarke and Zhu, 2006). The new information presented here will provide fundamental new 
insights into precisely how insecticide resistance is regulated and how the genes involved are 
interconnected and regulated in resistance.  
 
 
52 
 
3.6 Acknowledgements 
The authors are grateful to Drs. Peter W. Atkinson, Peter Arensburger and the Culex 
quinquefasciatus genome community for the efforts they have devoted to determining the 
genome sequence and making the information available in VectorBase. We would also like to 
thank Ting Yang for technical support with the qRT-PCR validation, and the Hudson Alpha 
Institute of Biotechnology for their expertise in conducting the RNA sequencing work and for all 
of their help and support with this study. We also thank two anonymous reviewers for their 
comments and suggestions for our manuscript. 
 
 
 
 
  
53 
 
Chapter 4: Gene Expression Profiles of the Southern House Mosquito Culex 
quinquefasciatus During Exposure to Permethrin 
 
William R. Reid1, Lee Zhang1,2, Youhui Gong1.3, Ting Li1, Nannan Liu1? 
 
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849, USA 
2Genomics and Sequencing Laboratory, Auburn University, Auburn, AL 36849, USA 
3Institute of Vegetables and Flowers, Chinese Academy of Agricultural Science, Beijing 100081, 
China 
 
?To whom correspondence should be addressed 
Prepared for publication in Insect Science 
 
4.1 Abstract 
 Insecticide resistance is a major obstacle to the management of disease-vectoring 
mosquitoes worldwide. The genetic changes and detoxification genes involved in insecticide 
resistance have been extensively studied in populations of insecticide-resistant, however few 
studies have focused on the resistance genes up-regulated upon insecticide exposure and the 
possible regulation pathways involved in insecticide resistance. To characterize the changes in 
gene expression during insecticide exposure, and to investigate the possible connection of known 
regulation pathways with insecticide resistance, we conducted RNA-Seq analysis of a highly-
permethrin resistant strain of Culex quinquefasciatus following permethrin exposure. Gene 
expression profiles revealed a total of 224 and 146 up- and down-regulated, when compared to a 
blank acetone carrier treated control, respectively, suggesting that there were multiple, but 
54 
 
specific genes were involved in permethrin resistance. Functional enrichment analysis showed 
that the up-regulated genes contained multiple detoxification genes including a glutathione S-
transferase and multiple cytochrome P450 genes, as well as several immune-related genes, while 
the down-regulated genes consisted primarily of proteases and carbohydrate metabolism and 
transport. Further analysis showed that permethrin exposure resulted in a decrease in the 
expression of serum storage proteins and likely represented a resulted in a delay in the 
development of the fourth instar possibly due to a decrease in feeding. This effect was more 
pronounced in an insecticide-resistant strain than in an insecticide-susceptible strain and may 
represent a behavioral mechanism of insecticide resistance in Culex mosquitoes. 
 
4.2 Introduction 
Mosquitoes carry and transmit parasites and pathogens, impacting human and animal 
health and resulting in economic losses (WHO, 1957). Insecticides, notably pyrethroids such as 
permethrin, are routinely applied to manage mosquito populations in order to mitigate the 
negative impact of mosquitoes, however, the development of insecticide resistance, especially to 
pyrethroids, has become a global problem (Phillips, 2001; Liu et al, 2004; Hemingway et al., 
2002; Xu et al, 2005; Liu 2008; Liu et al., 2009). Insecticide resistance is presumed to be a pre-
adaptive phenomenon, indicating that the genes involved in insecticide resistance and the 
pathways that control their regulation are already present within the insect (Sawicki and 
Denholm, 1984; Brattsten et al., 1986). In addition, some studies propose that resistance can also 
be induced by insecticide exposure (Vontas et al., 2010; Gong et al., 2013), indicating that there 
are underlying pathways within the insect that respond to an insecticide challenge, and that these 
pathways may be involved in insecticide resistance.  
55 
 
The mosquito Culex quinquefasciatus Say is a primary vector of West Nile virus, St. 
Louis encephalitis virus, Eastern Equine Encephalitis virus, Japanese Encephalitis virus, and 
lymphatic filariasis (Nasci and Miller, 1996; Arensberger et al., 2010). This mosquito species has 
a global distribution, especially throughout tropical and temperate climates of the world (Fonseca 
et al., 2004; Cupp et al., 2011). In Alabama, Cx. quinquefasciatus is the predominant mosquito 
species in urban areas, and insecticide resistance has been documented for this mosquito in the 
field (Liu et al., 2005). One strain of Cx. quinquefasciatus, collected from Alabama, has been 
pressured with permethrin for eight generations in the laboratory to produce the HAmCqG8 
strain, which is a highly permethrin-resistant strain that allows for the identification of genes 
putatively involved in insecticide resistance based on gene expression profiles (Xu et al., 2006a; 
Li et al., 2009, Li and Liu, 2010, Yang and Liu, 2011, Reid et al., 2012, Gong et al., 2013). The 
objective of our study was to characterize the expression levels of genes induced upon exposure 
to permethrin when compared to an acetone blank carrier and identify the possible activation of 
gene pathways in Cx. quiquefasciatus. 
 
4.3 Materials and Methods 
4.3.1 Mosquito strains 
Culex quinquefasciatus strain HAmCqG8 is a highly-insecticide resistant strain that was 
originally collected from Huntsville, Alabama in 2002 (Liu et al., 2004) and subsequently 
pressured in the laboratory with permethrin for eight successive generations to achieve a 2,700-
fold level of resistance to permethrin compared with the laboratory susceptible S-Lab strain (Li 
and Liu, 2010). All mosquitoes were reared at 25?2oC under a photoperiod of 12:12 (L:D) h. 
 
56 
 
4.3.2 Permethrin exposure treatments 
A total of 400 fourth instar larvae were collected and transferred to 3 L of water in plastic 
containers measuring 20.5 x 35 x 11 cm for each treatment. The mosquito rearing was conducted 
so that the two mosquito populations entered into the fourth instar stage at the same time. This 
was achieved through the controlling of the egg raft collection, egg hatching, and subsequent 
larval development and sample collection under identical rearing conditions. Four treatments 
were conducted: untreated time 0h, acetone treated 24h post-application, and permethrin mixed 
in an acetone carrier at the LC50 and the LC70 rate (24h post-application). The treatments were 
considered to be representative of the LC50 and LC70 rates if the percentage of dead larvae after 
the 24 h permethrin exposure was 50?5% and 70?5%, respectively. The final volume of acetone 
was adjusted to 600 ?l per 3 L for the acetone and permethrin treatments. No acetone was added 
to the untreated time 0h sample and no mortality was observed for either the 0h untreated 
treatment, or the 24 h acetone exposure treatment. A single container was used for the acetone 24 
h treatment, while two pans each were used for the LC50 and LC70 treatments in order to obtain 
enough surviving larvae for RNA extraction. 
 
4.3.3. RNA extraction  
A total of 200 surviving fourth instar larvae of each treatment were pooled, flash frozen 
on dry ice and immediately processed for RNA extraction. Total RNA was extracted using the 
hot acid phenol extraction method as outlined by Chomczynski and Sacchi (1987), after which a 
total of 30 ?g of RNA was treated with DNase I using the DNA-Free kit from Ambion (Austin, 
TX) to remove any contaminant DNA. Total RNA was re-extracted with two successive acid 
phenol: chloroform (1:1) steps followed by a final chloroform extraction to remove any residual 
57 
 
phenol. The RNA was then precipitated over ethanol and re-suspended in sterile distilled water. 
After a 1?g aliquot of RNA had been visually inspected for quality and for DNA contamination 
on a 1% agarose gel, total RNA was sent for RNA-Seq analysis (Hudson Alpha Institute of 
Biotechnology [HAIB]). 
 
4.3.4. RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
processing 
RNA quality was assessed using a Qubit fluorimeter and an Agilent 2100 Bioanalyzer by 
the HAIB. Libraries were then prepared using the Illumina mRNA-Seq kit using a 3' poly A tail 
selection method. Samples were barcoded and run as one of four samples on a single lane of an 
Illumina Hi Seq 2000 chip. Samples for the mRNA Seq were run using the PE-50 module 
(HAIB), which results in paired end reads that are each 50 nucleotides long, spanning a 300 nt 
stretch of the mRNA sequence. Base calling, initial removal of low quality reads, and barcode 
parsing were conducted by the staff at HAIB. Data were sorted by coordinate using Picardtools 
(http://picard.sourceforge.net) and checked for mate-pair matching. Paired end reads were then 
trimmed for adapter and low quality reads were removed using Trimmomatic (Lohse et al., 
2012). Surviving reads were then mapped to the Cx quinquefasciatus genome JHBv1.3 from 
Vectorbase (Arensberger et al., 2010; Megy et al., 2012) using Tophat2 (Trapnell et al., 2009; 
Kim et al., 2011) with mate pair interval of 200 bases and the gtf basefeatures file. The --no-
novel-juncs flag was used in the alignment to suppress the discovery of novel spliceforms in 
order to estimate gene expression levels based on the Vectorbase annotation of the genes. Read 
counts were determined using Cufflinks, and the testing of differential expression was estimated 
using Cuffdiff (Roberts et al., 2011) for each 24h exposure treatment compared to the untreated 
58 
 
0h treatment. Both Cufflinks and Cuffdiff were used because these programs provide a more 
accurate estimation of the gene expression value by adjusting for transcript fragment biases that 
occur at the ends of the transcripts and fragments during the library generation protocol (Kasper 
et al., 2010). Genes identified as up- or down-regulated when compared to the 0h untreated 
sample were then subjected to Venn diagram analysis to generate a list of genes that were up- or 
down-regulated in the permethrin treatments, but not in the acetone treatment. Only genes with 
expression values ?1, as measured in number of fragments mapped for every thousand bases of 
gene length for every million fragments sequenced (FPKM), were retained for expression 
comparisons (Gan et al., 2010). 
 
4.3.5. Annotation, gene grouping, and functional gene enrichment analysis 
The genes were annotated using the Vectorbase CpipJv1.3 annotation (Megy et al., 2012) 
and further annotated using the Structural Classification of Proteins (SCOP) general and detailed 
functions for Cx. quinquefasciatus available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html (Gough et al., 2001). Functional gene 
enrichment of GO terms was conducted using the online tool g:Profiler 
biit.cs.ut.ee/gprofiler/welcome.cgi (Reimand et al., 2007; 2011) and gene identification number 
discrepancies between CpipJv1.2 and CpipJ1.3 were resolved using the 'Gene annotation 
changes CpipJ1.2 to CpipJ1.3' file from Vectorbase (Megy et al., 2012). The g:Cocoa tool was 
used to test for GO term enrichment on genes that were up- or down-regulated in the permethrin 
treatments using a gSCS threshold for the significance threshold and a static background 
containing only genes with expression values of ?1. This analysis took all of the GO terms 
associated with the differentially down- or upregulated gene sets and determined if a given GO 
59 
 
term was statistically over-represented using a hypergeometric distribution to quantify the 
sampling probability that a given GO term is statistically more abundant in the up- or down-
regulated gene set when compared to the abundance of that same GO term among the entire 
expressed gene set. 
 
4.3.6. Selected gene expression validation using qRT-PCR 
 Acetone and permethrin (LC50) exposures were independently replicated in triplicate 
following the methodology for insecticide exposure previously described above. The RNA from 
three independent samples of 100 fourth instar larvae from both the S-lab and the HAmCqG8 
strains was obtained using the extraction method of Chomczynski and Sacchi (1987), and treated 
with DNase I using the DNA-Free kit from Ambion (Austin, TX) to remove any contaminant 
DNA. The DNase I was inactivated using the inactivation buffer from Ambion and cDNA was 
generated from the template RNA using the First strand cDNA synthesis kit from Roche 
(Indianapolis, IN). qRT-PCR was conducted on an ABI 7500 Real Time PCR system (Applied 
Biosystems) using the ABI SyBr Green mastermix kit (Life Technologies, Carlsbad, CA) and 
relative gene expression was determined by using the 2(-??Ct) method (Livak and Schmittgen, 
2001) using a portion of the 18S rRNA gene as the reference gene and subtracting the acetone 
treatment from the LC50 permethrin treatment. Statistical significance between the S-lab and 
HAmCqG8 strain was tested using a Welch's T-test in R (R Core Team, 2013).The primers used 
are provided in Appendix 4.1. 
 
 
4.4 Results 
60 
 
4.4.1. Gene Abundance 
The number of paired-end reads that passed Illumina quality filtering ranged from 25,723,783 to 
30,431,848, which provided a similar depth of coverage for each of the four treatments tested 
(Table 4.1), which allowed us to compare the gene expression levels for all four samples tested. 
The adapter trimming and low-quality removal step removed an additional ~2 million paired end 
reads from each of the treatments resulting in a final set of reads that ranged from 24 to 28.5 
million reads (Table 4.1).  
 
 
Tophat2 and Cufflinks were then used to map the reads to the Cx. quinquefasciatus genome 
(version: CpipJ1.3) from Vectorbase (www.vectorbase.org) and to estimate gene abundance, 
which identified a total of 11,595 genes that had an FPKM ?1.0. This was consistent with our 
previous study where 12,451 expressed genes were identified in the fourth instar stage of 
HAmCqG8, (Reid et al., 2012). All sequence traces and expression values have been submitted to 
the Gene Expression Omnibus at NCBI, reference accession GSE51399 
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE51399. 
Following the determination of gene abundance, the genes were tested for differential gene 
expression using Cuffdiff by comparing the untreated 0 h time point with each of the 24 hour 
exposure treatments: acetone, permethrin LC50, and permethrin LC70.  
 
4.4.2. Up-regulated Genes 
61 
 
The differential gene expression testing identified a total of 331 up-regulated genes, which 
included 107, 214, and 216 genes in the acetone, permethrin LC50, and permethrin LC70 
treatments, respectively (Fig. 4.1; Table 4.2).  
Figure 4.1. Venn diagram analysis of the total numbers of differentially-expressed up- and 
down-regulated genes in the fourth instar of the permethrin resistant HAmCqG8 strain of Cx. 
quinquefasciatus following a 24h exposure to either an acetone control, or two rates of 
permethrin (LC50 and LC70). Overlapping circles represent genes that were co-up- or co-down-
regulated in two or more groups. 
 
Among the genes up-regulated in the permethrin treatments, the majority were present within the 
SCOP functional categories of 'no annotation', 'metabolism', 'intra-cellular processes', and 
'general' (Table 4.3).  
Forty-six of the genes were up-regulated in the acetone and both permethrin treatments, with an 
additional 11 and 26 genes shared between the acetone and the permethrin LC50, and acetone and 
the permethrin LC70 treatments, respectively. The remaining up-regulated genes were present 
only in the permethrin treated samples and included 80 genes up-regulated in the permethrin 
LC50 treatment, 67 genes up-regulated in the permethrin LC70 treatment, and 77 genes up-
regulated in both the permethrin LC50 and LC70 treatments.  
62 
 
 
Table 4.2: Number of differentially-expressed genes in the highly-permethrin resistant strain of 
Culex quinquefasciatus, HAmCqG8, following a 24 h exposure to either acetone, or permethrin at 
the LC50 and LC70 rates compared to a zero hour untreated time point. 
 Down-regulated (24h post application) Up-regulated (24h post 
application) 
  Permethrin  Permethrin 
SCOP? general function Acetone LC50 LC70 Ace LC50 LC70 
 
Extra-cellular processes 7 7 7 2 2 5 
General 8 10 12 20 34 30 
Information 0 0 3 3 4 5 
Intra-cellular processes 28 42 42 17 34 47 
Metabolism 50 97 91 21 47 43 
No annotation 19 24 16 29 73 66 
Other 2 3 4 2 3 4 
Regulation 11 16 16 13 17 16 
TOTAL 125 199 191 107 214 216 
?Structural Classification of Proteins database (SCOP) general and detailed functions using the 
predicted Cx. quinquefasciatus annotation information available at the Superfamily website 
(version 1.75) supfam.cs.bris.ac.uk/SUPERFAMILY/index.html  
 
 
Although several of the genes up-regulated in the permethrin treatment were present in the SCOP 
'no annotation? category, there was lower-level annotation for several of these genes using the 
functional annotation from Vectorbase, including 10 cuticular genes, two cercropin genes, 
CPIJ005108 and CPIJ010699, and a high-affinity nuclear juvenile hormone (JH) binding protein 
CPIJ006964 (Appendix 4.2). Within the SCOP 'metabolism' category, the greatest numbers of 
up-regulated genes among the permethrin-treatments were contained within the redox category, 
including nine cytochrome P450 genes (CYP325BF1-de1b, CYP325BF1v2, CYP6BY2, 
CYP6M14, CYP4H34, CYP6N19, CYP6M16, CYP6M13, CYP6M15) (Table 4.3; Appendix 4.2). 
Within the SCOP 'general' category, the greatest number of up-regulated genes were contained 
within the small molecule binding category, which contained two fatty acyl-CoA reductases 
(CPIJ007244, CPIJ007245) and a glutathione S-transferase (CPIJ002679) (Table 4.3; Appendix 
63 
 
4.2). Finally, within the SCOP 'intra-cellular processes' category, the greatest number of up-
regulated genes was present in the proteases category which contained two trypsin-like serine 
proteases (CPIJ002140, CPIJ016012), two metalloproteases (CPIJ002142, CPIJ002156) and 
nephrosin (CPIJ009594) (Table 4.3; Appendix 4.2). 
 
4.4.3. Down-regulated Genes 
A total of 271 genes were determined to be down-regulated, which included 107, 214, and 216 
genes in the acetone, permethrin LC50, and permethrin LC70 treatments, respectively (Fig. 4.1; 
Table 4.2). Sixty-four of the down-regulated genes were down-regulated in all of the 24 hour 
exposure treatments (acetone, permethrin LC50, and permethrin LC70), with an additional 10 
genes down-regulated in both the acetone and the permethrin LC50 treatment, and seven genes 
down-regulated in both the acetone and the LC70 treatment (Fig. 4.1). 
 
 
Table 4.3. Genes up-regulated and down-regulated 24h-post treatment following treatment with 
permethrin at either the LC50 or the LC70 rate. 
SCOP Functional annotation? Up-regulated Down-regulated 
General function Detailed function Superfamilies Genes Superfamilies Genes 
Extra-cellular processes Blood clotting 0 0 1 1 
 Cell adhesion 3 3 2 2 
 Immune response 0 0 1 1 
 Toxins/defense 1 1 0 0 
General General 7 9 2 2 
 Small molecule binding 5 20 4 4 
Information Chromatin structure 1 1 1 1 
 DNA replication/repair 2 3 1 1 
 Translation 0 0 1 1 
Intra-cellular processes Cell cycle, Apoptosis 1 1 0 0 
 Cell motility 3 4 0 0 
 Ion m/tr 4 10 1 2 
 Phospholipid m/tr 1 3 1 2 
 Proteases 7 19 5 24 
64 
 
 Protein modification 1 2 1 1 
 Transport 3 5 0 0 
Metabolism Amino acids m/tr 0 0 1 2 
 Carbohydrate m/tr 4 6 2 18 
 Coenzyme m/tr 1 1 1 1 
 E- transfer 1 1 1 1 
 Energy 0 0 1 1 
 Lipid m/tr 1 1 0 0 
 Nitrogen m/tr 0 0 1 1 
 Nucleotide m/tr 1 1 0 0 
 Other enzymes 3 10 8 32 
 Polysaccharide m/tr 1 3 1 1 
 Redox 5 16 3 9 
 Secondary metabolism 3 4 1 7 
 Transferases 0 0 3 3 
Regulation DNA-binding 3 3 3 3 
 Kinases/phosphatases 1 3 1 3 
 Receptor activity 0 0 2 2 
 Signal transduction 6 9 0 0 
Other Unknown function 4 4 1 2 
 Viral proteins 0 0 1 1 
No annotation No annotation 1 81 1 17 
 TOTAL 74 224 53 146 
?SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation 
information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html  
 
 
Forty-four genes were down-regulated in the acetone treatment alone, while 26, 21, and 99 genes 
were down-regulated in the permethrin LC50, the permethrin LC70, and both the permethrin LC50 
and LC70 treatments, respectively. Among the genes that were down-regulated only in the 
permethrin treatments, more than half of the genes (76) were present in the SCOP 'metabolism' 
category, most notably the carbohydrate metabolism/transport, other enzymes, and redox 
categories, which contained a carboxylesterase (CPIJ018233), four alpha amylase genes 
(CPIJ005062, CPIJ005725, CPIJ801597, CPIJ801761), two alpha-glucosidases (CPIJ009306, 
CPIJ013169), and multiple hexamerin and larval serum storage proteins (CPIJ000056, 
CPIJ001820, CPIJ9033, CPIJ007783, CPIJ009032) (Table 4.3; Appendix 4.3). The second 
65 
 
largest down-regulated SCOP general function category was 'intra-cellular processes', and 
contained, notably, the proteases category, which contained multiple trypsin-like serine proteases 
(Table 4.3; Appendix 4.3). 
 
4.4.4. Functional enrichment of Gene Ontology (GO) terms among the differentially-
expressed genes 
Following the identification of the up- and down-regulation genes, we conducted a functional 
enrichment analysis on the gene ontology (GO) terms associated with the differentially-
expressed genes. This type of analysis will identify GO terms that are statistically enriched 
among either the up- or the down-regulated genes in comparison to all of the genes expressed. 
Among the up-regulated genes, the Biological Process GO terms associated with immune 
response, and oxidation-reduction processes were predominant, while the predominant 
Molecular Function GO terms were oxidoreductase activity, monooxygenase activity, and 
structural constituent of cuticle (Table 4.4). Among the down-regulated genes, the Biological 
Process GO terms associated with carbohydrate metabolic process, lipid metabolic process, and 
proteolysis were identified, while the majority of the Molecular Function GO terms were 
associated with protease functions, phosphatidylcholine 1-acylhydrolase activity, and alkaline 
phosphatase activity (Table 4.4). When the functionally-enriched GO terms from the up- and 
down-regulated genes were connected into a network through their parent-child terms, the 
network revealed that the functionally-enriched GO terms among the up- and down-regulated 
genes shared only three higher-level nodes: metabolic process, catalytic activity, and organic 
substance metabolic process (Fig. 4.2). This indicated that the functionally-enriched GO terms 
from the up-regulated genes formed distinct clusters from the functionally-enriched GO terms 
66 
 
from the down-regulated genes. In particular, GO terms associated with proteolytic and primary 
metabolic processes were functionally-enriched among the down-regulated genes, while the GO 
terms structural constituent of cuticule, oxidoreductase activity, and various immune response 
GO terms were functionally-enriched among the up-regulated genes (Fig. 4.2).  
67 
 
Figure 4.2. Gene ontology term functional enrichment analysis of the differentially-expressed up- and down-regulated genes 
identified in the fourth instar of the permethrin resistant HAmCqG8 strain of Cx. quinquefasciatus following a 24h exposure to 
permethrin.  
68 
 
When the genes associated with the functionally-enriched GO terms were compiled, a total of 29 
and 200 genes were shared among the up- and down-regulated gene sets, respectively.  
 
Table 4.4. Gene Ontology (GO) term enrichment analysis results for differentially expressed 
genes in the HAmCqG8 strain following a 24h exposure to permethrin at the LC50 and LC70 rates. 
GO level GO term? Term domain and name # hits p-value? 
Up-regulated genes    
Biological Process* GO:0009607 response to biotic stimulus 3 1.47?10-4 
 GO:0002376 immune system process 3 2.33?10-2 
 GO:0051704 multi-organism process 3 5.86?10-4 
 GO:0051707 response to other organism 3  
 GO:0009617 response to bacterium 3 1.47?10-4 
 GO:0006952 defense response 3 3.09?10-2 
 GO:0042742 defense response to bacterium 3 1.47?10-4 
 GO:0006955 immune response 3 2.33?10-2 
 GO:0045087 innate immune response 3 5.05?10-3 
 GO:1901615 organic hydroxy compound metabolic process 4 3.74?10-2 
 GO:0006066 alcohol metabolic process 4 2.55?10-2 
 GO:0055114 oxidation-reduction process 14 1.44?10-2 
Molecular Function* GO:0016491 oxidoreductase activity 16 2.09?10-3 
 GO:0004497 monooxygenase activity 7 2.19?10-2 
 GO:0042302 structural constituent of cuticle 8 5.70?10-4 
 GO:0008812 choline dehydrogenase activity 4 1.39?10-3 
 GO:0050660 flavin adenine dinucleotide binding 5 3.62?10-2 
Down-regulated genes    
Biological Process* GO:0005975 carbohydrate metabolic process 21 4.50?10-8 
 GO:0006629 lipid metabolic process 11 8.54?10-4 
 GO:0006508 Proteolysis 28 6.76?10-10 
Molecular Function* GO:0017171 serine hydrolase activity 16 8.90?10-6 
 GO:0016798 hydrolase activityacting on glycosyl bonds 12 1.71?10-7 
 GO:0004553 hydrolase activityhydrolyzing O-glycosyl compounds 9 1.20?10-4 
 GO:0008233 peptidase activity 29 7.76?10-11 
 GO:0008238 exopeptidase activity 12 2.15?10-10 
GO:0004180 carboxypeptidase activity 9 7.32?10-8 
 GO:0008237 metallopeptidase activity 10 3.40?10-4 
 GO:0004181 metallocarboxypeptidase activity 5 8.19?10-3 
 GO:0004175 endopeptidase activity 15 1.17?10-3 
 GO:0008236 serine-type peptidase activity 16 8.90?10-6 
 GO:0008970 phosphatidylcholine 1-acylhydrolase activity 3 1.82?10-3 
 GO:0004035 alkaline phosphatase activity 4 4.88?10-6 
?Annotation from the Gene Ontology consortium (version 1.2084; release date: 12:07:2011) 
? Cumulative hypergeometric p-values for GO terms of transcripts that were differentially 
upregulated in when tested against all transcripts with expression levels of FPKM > 1 using the 
g:SCS threshold. 
*Higher-level GO terms have been removed 
 
Of particular interest among the up-regulated genes with functionally-enriched GO terms were 
69 
 
nine cytochrome P450 genes (CYP325BF1-de1b, CYP325BF1v2, CYP6BY2, CYP6M14, 
CYP4H34, CYP6N19, CYP6M16, CYP6M13, CYP6M15), eight cuticular genes (CPIJ001839, 
CPIJ004289, CPIJ004293, CPIJ008231, CPIJ013788, CPIJ016318, CPIJ017925, CPIJ018582), 
and three genes involved in the insect immune response: two cecropin genes (CPIJ005108, 
CPIJ010699), and a salivary peptide gene (CPIJ010700) (Table 4.5). 
 
Table 4.5. Differentially-expressed genes associated with functionally-enriched Gene Ontology 
(GO) terms in the HAmCqG8 strain following a 24h exposure to permethrin at the LC50 and LC70 
rates. 
GO term Genes sharing a given GO term* 
Up-regulated  
response to biotic stimulus CPIJ005108, CPIJ010699, CPIJ010700 
immune system process CPIJ005108, CPIJ010699, CPIJ010700 
multi-organism process CPIJ005108, CPIJ010699, CPIJ010700 
response to other organism CPIJ005108, CPIJ010699, CPIJ010700 
response to bacterium CPIJ005108, CPIJ010699, CPIJ010700 
defense response CPIJ005108, CPIJ010699, CPIJ010700 
defense response to 
bacterium 
CPIJ005108, CPIJ010699, CPIJ010700 
immune response CPIJ005108, CPIJ010699, CPIJ010700 
innate immune response CPIJ005108, CPIJ010699, CPIJ010700 
organic hydroxy 
compound metabolic 
process 
CPIJ017482, CPIJ001367, CPIJ007619, CPIJ017491 
alcohol metabolic process CPIJ017482, CPIJ001367, CPIJ007619, CPIJ017491 
oxidation-reduction 
process 
CPIJ800256, CPIJ800177, CPIJ800178, CPIJ800210, CPIJ800175, CPIJ800176, 
CPIJ800180, CPIJ017482, CPIJ017198, CPIJ015953, CPIJ013724, CPIJ001367, 
CPIJ007619 
oxidoreductase activity CPIJ800256, CPIJ800177, CPIJ800178, CPIJ800210, CPIJ800175, CPIJ800176, 
CPIJ800180, CPIJ017482, CPIJ017198, CPIJ015953, CPIJ013724, CPIJ007244, 
CPIJ007245, CPIJ001367, CPIJ007619 
monooxygenase activity CPIJ800256, CPIJ800177, CPIJ800178, CPIJ800210, CPIJ800175, CPIJ800176, 
CPIJ800180 
structural constituent of 
cuticle 
CPIJ004293, CPIJ001839, CPIJ017925, CPIJ016318, CPIJ004289, CPIJ008231, 
CPIJ018582, CPIJ013788 
choline dehydrogenase 
activity 
CPIJ017482, CPIJ001367, CPIJ007619, CPIJ017491 
FAD binding CPIJ017482, CPIJ013724, CPIJ001367, CPIJ007619, CPIJ017491 
Down-regulated  
carbohydrate metabolic 
process 
CPIJ801597, CPIJ801761, CPIJ003338, CPIJ003955, CPIJ004229, CPIJ004320, 
CPIJ004321, CPIJ004323, CPIJ004325, CPIJ004733, CPIJ005062, CPIJ005725, 
CPIJ008529, CPIJ008530, CPIJ008531, CPIJ009306, CPIJ010291, CPIJ012138, 
CPIJ013169, CPIJ013477, CPIJ014181 
lipid metabolic process CPIJ801475, CPIJ801474, CPIJ802146, CPIJ002726, CPIJ004224, CPIJ004225, 
CPIJ004226, CPIJ004227, CPIJ004228, CPIJ004230, CPIJ005462 
proteolysis CPIJ011433, CPIJ801485, CPIJ801477, CPIJ801679, CPIJ801680, CPIJ802425, 
CPIJ002128, CPIJ002133, CPIJ002136, CPIJ002137, CPIJ002911, CPIJ002943, 
70 
 
CPIJ004060, CPIJ006077, CPIJ006079, CPIJ008873, CPIJ008874, CPIJ008876, 
CPIJ009738, CPIJ010641, CPIJ010801, CPIJ010805, CPIJ010806, CPIJ011383, 
CPIJ011617, CPIJ012036, CPIJ014108, CPIJ018060 
serine hydrolase activity CPIJ011433, CPIJ802425, CPIJ002128, CPIJ002133, CPIJ002136, CPIJ002137, 
CPIJ002911, CPIJ006077, CPIJ006079, CPIJ008873, CPIJ008874, CPIJ008876, 
CPIJ010641, CPIJ011383, CPIJ011617, CPIJ018060 
hydrolase activity acting 
on glycosyl bonds 
CPIJ801597, CPIJ801761, CPIJ003338, CPIJ004229, CPIJ004320, CPIJ004321, 
CPIJ004323, CPIJ004325, CPIJ005725, CPIJ008529, CPIJ008530, CPIJ008531 
hydrolase activity hydro-
lyzing O-glycosyl 
compounds 
CPIJ003338, CPIJ004229, CPIJ004320, CPIJ004321, CPIJ004323, CPIJ004325, 
CPIJ008529, CPIJ008530, CPIJ008531 
peptidase activity CPIJ011433, CPIJ801485, CPIJ801477, CPIJ801679, CPIJ801680, CPIJ802425, 
CPIJ002128, CPIJ002133, CPIJ002136, CPIJ002137, CPIJ002911, CPIJ002943, 
CPIJ004060, CPIJ006077, CPIJ006079, CPIJ008873, CPIJ008874, CPIJ008876, 
CPIJ009738, CPIJ010641, CPIJ010801, CPIJ010805, CPIJ010806, CPIJ011383, 
CPIJ011617, CPIJ012036, CPIJ014108, CPIJ015407, CPIJ018060 
exopeptidase activity CPIJ801679, CPIJ801680, CPIJ002911, CPIJ004060, CPIJ008873, CPIJ008874, 
CPIJ008876, CPIJ010801, CPIJ010805, CPIJ010806, CPIJ012036, CPIJ015407 
carboxypeptidase activity CPIJ801679, CPIJ801680, CPIJ002911, CPIJ008873, CPIJ008874, CPIJ008876, 
CPIJ010801, CPIJ010805, CPIJ010806 
metallopeptidase activity CPIJ801485, CPIJ801477, CPIJ801679, CPIJ801680, CPIJ002943, CPIJ004060, 
CPIJ010801, CPIJ010805, CPIJ010806, CPIJ012036 
metallocarboxypeptidase 
activity 
CPIJ801679, CPIJ801680, CPIJ010801, CPIJ010805, CPIJ010806 
endopeptidase activity CPIJ011433, CPIJ801485, CPIJ801477, CPIJ002128, CPIJ002133, CPIJ002136, 
CPIJ002137, CPIJ002943, CPIJ004060, CPIJ006077, CPIJ006079, CPIJ010641, 
CPIJ011383, CPIJ011617, CPIJ012036 
serine-type peptidase 
activity 
CPIJ011433, CPIJ802425, CPIJ002128, CPIJ002133, CPIJ002136, CPIJ002137, 
CPIJ002911, CPIJ006077, CPIJ006079, CPIJ008873, CPIJ008874, CPIJ008876, 
CPIJ010641, CPIJ011383, CPIJ011617, CPIJ018060 
phosphatidylcholine 1-
acylhydrolase activity 
CPIJ801475, CPIJ801474, CPIJ004227 
alkaline phosphatase 
activity 
CPIJ001262, CPIJ001264, CPIJ001265, CPIJ018121 
?Annotation from the Gene Ontology consortium (version 1.2084; release date: 12:07:2011) 
*Vectorbase: https://www.vectorbase.org/organisms/culex-quinquefasciatus; release: CpipJ1.3 
2012-04-02 
 
 
Among the down-regulated genes associated with the functionally-enriched GO terms, the 
majority of the genes were associated with proteolytic activity including two aminopeptidase N 
precurors (CPIJ004060, CPIJ012036), a lysosomal pro-X carboxypeptidase (CPIJ008876), and 
an xaa-pro aminopeptidase I (CPIJ015407). In addition, four genes associated with the GO term 
'carbohydrate metabolic process' were gram-negative bacteria binding proteins (CPIJ004320, 
CPIJ004320, CPIJ004320, CPIJ004320), indicating that there were genes involved in the 
immune response of Cx. auinquefasciatus among both the up- and down-regulated genes, 
71 
 
however, these genes in the up-regulated gene set had different immune response functions than 
the down-regulated immune genes. 
 
4.4.5. qRT-PCR Validation of Selected Genes 
The differential up-regulation of cuticular genes in the permethrin treatments compared to the 
acetone treatment coincided with the up-regulation of juvenile hormone (JH) binding protein 
CPIJ006964 (Appendix 4.3). This led us to hypothesize that there may be a developmental delay 
of Cx. quinquefasciatus  
when exposed to permethrin. To investigate if the permethrin exposure delayed the development 
of the fourth instar HAmCqG8 strain, we conducted qRT-PCR analysis on five storage serum 
proteins (CPIJ000056, CPIJ001820, CPIJ009033, CPIJ007783, CPIJ009032) and one 
carboxylesterase (CPIJ018233) previously identified as highly-expressed in the fourth instar 
stage of Cx. quinquefasciatus (Reid et al., 2012). If there is a developmental delay in Cx. 
quinquefasciatus upon exposure to permethrin, there should be a corresponding decrease in the 
expression of storage serum proteins in the permethrin treatment relative to the acetone 
treatment, moreover, if the response to insecticide exposure is related to insecticide resistance, 
the corresponding decrease in the expression of storage serum proteins should be more 
pronounced in the highly permethrin resistant HAmCqG8 strain, than when compared to the 
pyrethroid susceptible S-lab strain. We further investigated six proteases, that had been 
previously identified as up-regulated in the HAmCqG8 strain compared to its parental low 
permethrin resistant strain HAmCqG0 (Reid et al., 2012). The proteases investigated included 
four genes that were up-regulated upon permethrin exposure (two metalloproteases, CPIJ001240 
and CPIJ009594, and two trypsin-like serine proteases, CPIJ002140 and CPIJ016012), as well as 
72 
 
two genes that were down-regulated upon permethrin exposure (CPIJ002142 and CPIJ002156). 
Following a 24h exposure to permethrin at the LC50 rate, one protease, CPIJ009594 was 
significantly up-regulated (P<0.01) in the HAmCqG8 strain compared to the S-lab strain, while 
one protease, CPIJ002142, was significantly down-regulated (P<0.01) (Fig. 4.3).  
When the fourth instar from the two Cx.quinquefasciatus strains were exposed to permethrin at 
the LC50 rate for the longer 48h time period, the up-regulation of CPIJ009594 doubled in the 
permethrin susceptible S-lab strain, but tripled in the permethrin resistant HAmCqG8 strain, 
suggesting that CPIJ009594 (nephrosin) is involved not only in response to permethrin exposure, 
but to insecticide resistance as well. 
When the gene expression levels of the larval serum storage proteins were investigated, all six 
storage proteins had significantly greater down-regulation in the HAmCqG8 strain than in the S-
lab strain, with three of these genes, CPIJ000056, CPIJ001820, and CPIJ018233 being down-
regulated in both mosquito strains relative to a comparable acetone exposure treatment (Fig. 4.3). 
73 
 
Figure 4.3. Gene expression levels for proteases (upper panels A and B) and larval storage 
proteins (lower panels C and D). Bars superseded with a ?*? indicate that the expression level 
between the permethrin susceptible S-lab strain and the permethrin resistant HAmCqG8 strain of 
Cx. quinquefasciatus were significantly different at the ?=0.01 level of significance. Bars shown 
superior to the dependent axis zero line indicate genes that were up-regulated relative to a 
comparative acetone blank treatment control, while genes inferior to the dependent axis zero line 
indicate genes that were down-regulated relative to a comparative acetone blank treatment 
control. 
 
The down-regulation of larval serum storage proteins was more pronounced following the longer 
(48h) permethrin exposure, where all six genes were down-regulated in both the S-lab and the 
HAmCqG8 strains compared to the 48h acetone exposure treatment, with four of the genes, 
CPIJ000056, CPIJ001820, CPIJ007783, and CPIJ018233 having a significantly greater (P<0.01) 
down-regulation in the HAmCqG8 strain compared to the permethrin susceptible S-lab strain.  
 
74 
 
4.5 Discussion 
Overall, a total of 224 genes were up-regulated in response to permethrin exposure and 146 
genes were down-regulated. Several of the genes up-regulated were found among categories 
previously identified as up-regulated in response to permethrin exposure including cytochrome 
P450s and a glutathione S-transferase (Liu et al., 2011; Gong et al., 2013). In addition to the 
expected genes, we identified several novel profiles. The first was the down-regulation of 
multiple proteases in the permethrin treated Cx. quinquefasciatus. Some of the down-regulated 
proteases represent genes that are known to be involved in cell signaling including two 
aminopeptidase N precurors (CPIJ004060, CPIJ012036), a lysosomal pro-X carboxypeptidase 
(CPIJ008876), and an xaa-pro aminopeptidase I (CPIJ015407), while there were fewer proteases 
within the up-regulated genes, notably one protease, a nephrosin CPIJ009594, which was further 
confirmed to be up-regulated in the HAmCqG8 strain compared to the permethrin susceptible S-
lab strain. While no role for nephrosin has been proposed for mosquitoes, it is known to be 
involved in the immune response in fish (Boutet et al., 2006; Darawiroj et al., 2008). Darawiroj 
et al. (2008) further identified that nephrosin was down-regulated the common carp, Cyprinus 
carpio, when exposed to a lipopolysaccharide (LPS) treatment to mimic a gram-negative 
bacterium exposure. Interestingly, we identified that during the permethrin exposure, genes 
involved in gram-negative bacteria binding were down-regulated, while nephrosin was up-
regulated. These results suggested that exposure to permethrin results in changes in the immune 
response status of Cx. quinquefasicatus, and further suggested that nephrosin is involved. The 
hypothesis that there is a correlation between the insect immune response and insecticide 
resistance was further supported by our finding that two cecropin genes (CPIJ005108, 
CPIJ010699) were up-regulated upon permethrin exposure. In insects, there are multiple immune 
75 
 
response pathways, with gram-negative bacteria activating the 'immune deficiency' (IMD) 
pathway and fungi and gram-positive bacteria activating the Toll pathway (DeGregorio et al., 
2002; Hedengren-Olcott, 2004; Pan et al., 2012). Cecropin genes have been shown to be 
regulated via the Toll pathway (Hedengren-Olcott et al., 2004; Pan et al., 2012), while genes 
regulated by the IMD pathway (eg/ gram-negative bacteria binding) were down-regulated. Work 
by Ogawa et al. (2005) found a similar trend in human macrophages, where LPS-inducible genes 
were inhibited by nuclear receptors downstream of the Toll receptor. In addition, there are 
additional insect immune pathways, such as the JAK-STAT pathway, which is up-regulated in 
An. aquasalis in response to Plasmodium vivax infection (Bahia et al., 2011), and the 
prophenyloxidase (PPO) pathway, however no PPO or JAK-STAT regulated genes were 
identified in the up- or down-regulated genes in the permethrin exposed Cx. quinquefasciatus. 
Work by Russell and Dunn (1996) demonstrated that antibacterial proteins were up-regulated in 
the midgut of Manduca sexta during the wandering stage, while recent work on M. sexta by Xu 
et al. (2012b) has further shown that along with immune genes, other genes involved in 
metabolism and transport were up-regulated during the wandering stage. When fourth instar Cx. 
quinquefasciatus were exposed to permethrin at either the LC50 or LC70 rates, we identified that 
multiple gram-negative bacteria binding genes were down-regulated relative to the acetone 
control treatment, as were 18 genes involved in carbohydrate metabolism and transport (Table 
4.3), suggesting that the acetone treated fourth instar were further along with development to the 
pupa than the permethrin treated fourth instar Cx. quinquefasciatus. Although Cx. 
quinquefasciatus does not exhibit a wandering stage similar to M. sexta, it is possible that the 
relatively higher expression levels of the gram-negative bacteria binding genes and the 
carbohydrate metabolism and transport genes indicate that the larvae in the acetone treatment 
76 
 
were closer to pupation than the larvae in either of the permethrin treatments, since these 
mentioned genes are known to be up-regulated in M. sexta during wandering. The differences in 
the gene expression profiles of immune response genes between permethrin exposed and control 
mosquitoes could indicate a delay in development in the fourth instar stage of Cx. 
quinquefasciatus when exposed to permethrin. A possible connection between the developmental 
delay and the immune response status of Cx. quinquefasciatus could be due to the status of the 
nutritional signaling target of rapamycin (TOR) receptor. TOR signaling and downstream TOR 
kinase is involved in the control of cellular activity in response to nutrient availability (Hansen et 
al., 2004) and in the larval stages of D. melanogaster TOR signaling in the fat body has been 
shown to restrict growth via a humoral mechanism, such that when nutrients are limited, the 
TOR pathway is suppressed (Colombani et al., 2003). In addition, connections between the TOR 
pathway and various immune response pathways have been identified. Turnquist et al. (2010) 
identified that inhibition of mTOR (mammalian TOR) induced production of Interleukin-12p70, 
which Lichtenegger et al. (2012) identified to be controlled by the Toll pathway. Taken together, 
these studies connected the TOR and Toll pathways in humans, if a similar connection exists in 
mosquitoes as well, it may explain the observed differences in the immune gene expression 
profiles between permethrin exposed and non-exposed fourth instar Cx. quinquefasciatus, that is: 
if fourth instar Cx. quinquefasciatus cease feeding, the resulting decrease in TOR activity could 
lead to an increase in Toll pathway gene expression. Feeding aversion to insecticide formulations 
has been documented in other insects, most notably glucose aversion in hydramethylnon baits in 
Blatella germanica, where roaches that fed on glucose-spiked hydramethylon developed an 
aversion to glucose (Silverman and Bieman, 1993). The underlying mechanism of glucose 
aversion has been identified to be due to changes in the binding properties of the gustatory 
77 
 
receptors of B. germanica to glucose, where GRN1, which detects glucose in wild type roaches 
became insensitive in glucose averse roaches, while GRN2, which detects bitter compounds in 
wild type roaches, is stimulated by glucose in glucose averse roaches (Wada-Katsumata et al., 
2013). Thus the observed differences in the expression of immune-related genes in permethrin-
exposed Cx. quinquefasciatus may be the result of changes in TOR signaling due to a decrease of 
nutrient availability as a consequence of a cessation of feeding in order to reduce the oral 
exposure of the larvae to permethrin. A delay in the development in permethrin-exposed fourth 
instar Cx. quinquefasciatus due to a cessation of feeding may represent a behavioral resistance 
response to limit the oral exposure of the mosquito larvae to the toxicant. To further investigate if 
fourth instar Cx. quinquefasciatus are developmentally-delayed when exposured to permethrin, 
we investigated the gene expression levels of serum storage proteins that are up-regulated in the 
fourth instar prior to pupation. The results showed that the serum storage proteins were down-
regulated in the permethrin treatments relative the acetone control for both the permethrin 
resistant HAmCqG8 strain, and in the permethrin susceptible S-lab strain. This indicated that the 
development to pupation for fourth instar Cx. quinquefasciatus is likely delayed in multiple 
strains upon exposure to permethrin. Furthermore, the level of down-regulation for the serum 
storage proteins was significantly greater (P<0.01) for the permethrin resistant HAmCqG8 strain 
than for the S-lab strain, suggesting that while permethrin may cause a developmental delay in 
the S-lab strain, the effect is significantly greater in a permethrin resistant strain of Cx. 
quinquefasciatus. Taken together these results suggested that there may a behavioral resistance 
phenomenon among fourth instar Cx. quinquefasciatus to limit oral exposure in response to 
permethrin exposure mediated by a cessation of feeding. 
 
78 
 
4.6 Acknowledgements 
We thank the Hudson Alpha Intsitute for Biotechnology (Huntsville, Alabama) for the 
preparation and sequencing of the RNA-Seq libraries.  
 
4.7 Disclosure 
All authors declare no conflict of interest, financial or otherwise, that might potentially bias this 
work 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
  
79 
 
Chapter 5: Gene expression analysis of a pyrethroid-resistant strain of Aedes aegypti and 
functional testing of selected family 4 cytochrome P450 genes 
 
 
William R. Reid1?, Anne Thornton2??, Julia Pridgeon3?*, James J. Becnel3,  
Fang Tang4, Alden Estep2,3, Gary G. Clark3, Sandra Allen3 
 
 
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849, USA 
2Navy Entomology Center of Excellence, Jacksonville, FL, 32312, USA 
3CMAVE-USDA-ARS, 1600 SW23rd Drive, Gainesville, FL 32682, USA 
4Institute of Vegetables and Flowers, Chinese Academy of Agricultural Science, Beijing 100081, 
China 
?These authors contributed equally 
?Current address: Department of Medicine and Department of Genome Sciences, University of 
Washington, Foege Building S-250, Box 355065 3720 15th Ave NE, Seattle WA 98195-5065 
?Current address: Aquatic Animal Health Research Unit, USDA, ARS, 990 Wire Road, Auburn, 
AL 36832 
*To whom correspondence should be addressed 
 
Submitted for publication in the Journal of Medical Entomology 
 
 
 
5.1 Abstract 
The expression levels of 164 cytochrome P450 genes in the Aedes aegypti genome were 
determined for a pyrethroid-resistant strain of Ae. aegypti collected from Puerto Rico. 
Comparison of the gene expression levels with a pyrethroid-susceptible laboratory strain 
confirmed the up-regulation of certain cytochrome P450 genes identified in other 
80 
 
geographically-diverse populations of insecticide-resistant mosquitoes as well as additional 
genes. To determine if the cytochrome P450s identified as up-regulated were capable of 
conferring metabolic resistance in mosquitoes, transgenic Drosophila melanogaster lines over-
expressing selected cytochrome P450 genes were generated and tested for their ability to survive 
an insecticidal challenge of either permethrin or beta-cypermethrin. Our study adds to the 
knowledge-base of the gene expression profiles of cytochrome P450 genes in insecticide-
resistant Ae. aegypti and the putative functions of these P450 genes. 
 
5.2 Introduction 
The yellow fever mosquito, Aedes aegypti, is a globally-distributed mosquito and the major 
vector of dengue virus (Gubler, 1988; Warren and Mahmoud, 1990; Gubler and Clark, 1995). 
Management of Ae. aegypti is primarily through chemical means, including pyrethroids which 
are preferred due to their low mammalian toxicity and high efficacy against mosquitoes 
(Hougard et al., 2002; Juntarajumnong et al., 2012; Manda et al., 2013). The repeated use of 
insecticides, however, has led to an increase in insecticide resistance among mosquitoes 
(Hemingway et al., 2004, ffrench-Constant et al., 2004; Liu, 2008), which makes the 
management of Ae. aegypti populations problematic since higher doses of insecticide are needed 
to obtain the same level of control, ultimately leading to insecticide failure (Vulule et al., 1994; 
Curtis et al., 1998; Liu, 2008). Insecticide resistance is a multi-faceted phenomenon for which 
the major mechanisms are considered to be: target site insensitivity, reduced penetration rate, and 
metabolic detoxification. In the latter mechanism, three major classes of enzymes degrade 
insecticides; they include: cytochrome P450s, hydrolases, and glutathione-S-transferases 
(Feyereisen, 1995; ffrench-Constant et al., 2004; Hemingway et al., 2004; Yang and Liu, 2011; 
81 
 
Reid et al., 2012; Gong et al., 2013). Among these three categories, studies have investigated the 
role of cytochrome P450s in Ae. aegypti (Strode et al., 2008; Pridgeon et al., 2009; Bariami et al., 
2012; Fonseca-Gonzalez et al., 2011; Poupardin et al., 2010; Saavedra-Rodriguez et al., 2012; 
Strode et al., 2012) and the functionality of selected cytochrome P450s in Ae. aegypti and other 
mosquitoes including Anopheles gambiae (Boonseupsekul et al., 2008; McLaughlin et al., 2008; 
Muller et al., 2008; Stevenson et al., 2011; 2012). Collectively, these studies have investigated 
the importance of multiple cytochrome P450s in pyrethroid resistance in Ae. aegypti and their 
putative functional roles. The goal of our study was to add to this knowledge-base by 
determining the gene expression levels of adult females of a pyrethroid-resistant field population 
of Ae. aegypti and to estimate the functionality of selected, previously uncharacterized, 
cytochrome P450s for their ability to confer resistance to pyrethroids in Ae. aegypti. 
 
5.3 Materials and Methods 
5.3.1. Mosquito Strains 
The Orlando strain of Ae. aegypti has been continuously reared at the Center for Medical, 
Agricultural, and Veterinary Entomology, ARS USDA in Gainesville, FL since 1952 (Clark et al., 
2011). The Puerto Rico strain of Ae aegypti was collected in urban San Juan, PR in October 2008 
and continuously reared in the laboratory as outlined in Clark et al., 2011. No insecticide 
pressuring was performed on the Puerto Rico Ae. aegypti strain, and each generation was tested 
to ensure that the level of pyrethroid resistance was present within the population.  
 
 
5.3.2. Bioassays  
82 
 
For all bioassays, the adult female life stage was used. Adult topical assays were performed as 
described in Pridgeon et al., 2007. Two to five day old adults were collected by aspiration, 
anesthetized at 4?C for 60 minutes, then females were sorted from males and three 250cc plastic 
cups containing 10 adult females each were covered with two layers of tulle mesh and provided 
with cotton balls saturated with 10% sucrose for feeding. A total of three cups (30 insects) were 
used for each permethrin dose and all experiments were repeated in triplicate, with the exception 
of the two-point concentration testing of each generation where a single replicate was used due 
to the small mosquito colony size. The LC50 values were determined using six concentrations 
that resulted in mortality ranging from 10 - 90%along with an acetone (blank carrier) and 
untreated controls. Prior to application, females were anesthetized for 30 seconds with CO2 and 
placed on a 4?C chill table (BioQuip Products, Rancho Dominguez, CA). A 0.5?l droplet of 
either acetone (controls), or permethrin dissolved in acetone was applied directly to the dorsal 
surface of the thorax using a 700 series syringe (Hamilton, Reno, NV).  In the P450 inhibition 
assay, piperonyl butoxide (PBO), the inhibitor of P450s was applied topically to adult female Ae. 
aegypti one hour prior to the application of the permethin to allow for the PBO to inhibit the 
cytochrome P450 activity in the mosquitoes. The maximal concentration of PBO that could be 
applied to adult female Ae. aegypti was first tested against the Orlando strain and a rate of 0.8?g 
per female was determined to be the minimum concentration to result in mortality. Subsequently, 
a rate of 0.4 ?g was used for each female for the PBO inhibitor assays and resulted in no 
mortality in both the Orlando and Puerto Rico strains. 
 
 
5.3.3 RNA extraction, cDNA synthesis, and qRT-PCR gene expression analysis. 
83 
 
Total RNA was isolated using the TRIzol reagent (Invitrogen, Carlsbad, CA) following the 
manufacturer's protocol as outlined in Pridgeon et al., 2008. First strand cDNA synthesis was 
conducted on 5 ?g of total RNA in a 20 ?l reaction mixture using oligo-dT20 primer (Invitrogen, 
Carlsbad, CA). The resulting cDNA was further diluted 5-fold and a total of 1 ?l was used for 
each 15 ?l qRT-PCR reaction. Quantitative PCR was performed using the SYBR Green PCR 
Master Mix on an ABI 7300 quantitative PCR System (Applied Biosystems, Foster City, CA). 
The primers used for each of the cytochrome P450 genes were designed against the Liverpool 
strain genome v1.1 (Nene et al., 2007) (Table 1). The relative expression levels of each of the 
cytochrome P450 genes was normalized to rpL24 within mosquito strain and then the fold 
change in the gene expression level in Puerto Rico compared to Orlando was calculated using the 
equation 2-??Ct using SDS Software (Livak and Schmittgen, 2001). Testing to identify 
statistically significant up-regulated genes was performed using a Welch's T-test in R (R Core 
Team, 2013). 
 
5.3.4 Functional testing of selected cytochrome P450 genes.  
The full lengths of the up-regulated P450 genes from the Puerto Rico strain of Ae. aegypti were 
amplified from cDNA using platinum Taq DNA polymerase High Fidelity (Invitrogen, Carlsbad, 
CA) with specific primer pairs (Table 1) based on the 5? and 3? end sequences of the genes. PCR 
products of the full length genes were purified using a QIAquick Gel Extraction Kit (Qiagen, 
Valencia, CA). The purified PCR products were ligated into pCR 2.1 vector using the Original 
TA Cloning kit (Invitrogen, Carlsbad, CA) as described by the manufacturer. The full lengths of 
the genes were cloned in One Shot TOPO 10F? cells using the One Shot TOP10F? Chemically 
Competent E. coli kit (Invitrogen, Carlsbad, CA). Cloning and sequence analyses of the cDNAs 
84 
 
were repeated at least three times and three TA clones from each replication were verified by 
sequencing.  
Table 5.1. List of primers used for the qRT-PCR determination of P450 gene expression level 
and the primers designed to generate the constructs for the functional testing in transgenic 
Drosophila melanogaster.  
Primer Gene? Vectorbase? Forward primer (5'-3') Reverse primer (5'-3') 
Clan2 P450 CYP15B1 AAEL002067 CGGATTCGTTCCTTCGATAA ATGGAATTCAGCACCGAAAC 
 CYP18A1 AAEL004870 CAGTGAAGGTCAGCTGTGGA CGAGACGGAGAGGTACTTGC 
 CYP303A1ae AAEL012144 GATAGCACGAGCACGACAAA CCAAGTCCGGGTTTCATAGA 
 CYP304B2xx/yy AAEL014412 GATTGGAAGGAGCAGAGACG CCTTTCACCGGTTAGCACAT 
 CYP304B3yy/xx AAEL014411 GGTCAGTTCTACCGGACCAA TCAAATGCCTCAGCACAAAG 
 CYP304C1 AAEL014413 GGGAGAATCTACCGGAAAGG CTCGCGGTACATTTTGGTTT 
 CYP305A6 AAEL002071 GCTCCCATTCTTCGGTAACA TTCCCAATCTGGTTCCCATA 
 CYP305A5 AAEL002043 AGCCCTCTCCAAGCAGTACA AGCCTTGTCCCCATAGTCCT 
 CYP306A1 AAEL004888 TCGTGTGATATCCGCAATGT GCGAGGTTAGTCAGCGTTTC 
 CYP307A1 AAEL009762 GCCCTGCTGAAAAGTCTACG GCCTTTGTCGGTAACGTGAT 
 CYP307A1 AAEL009768 GAGTCAGCCTCAGGAAGTGG CCCGTTCTGATTCAACACCT 
 CYP307B1 AAEL006875 ATCATGGAAGCGCTGAGACT GGTTCTCCCAGAGGTTCTCC 
Clan3 P450 CYP6F2 AAEL014678 CGTGAGTGCACCCAAGACTA GAGCGTACGGTTTGCTCTTC 
 CYP6F3 AAEL014684 GTGGCGTTTGGCATTAAGAT CCGTACGACACCGTTTTTCT 
 CYP6M5 AAEL009117 TGGATCTGCTGATCGCTATG AGCACTTCTTGGACGCATTT 
 CYP6M6 AAEL009128 AGAAAATACCCACCCGTTCC GGTCGAATCTTTTCGGATCA 
 CYP6M10 AAEL009125 TGAGTGCAACTCGATGAAGG ATTCCACCGTGCTTTTTACG 
 CYP6M11 AAEL009127 TTGTTCACGACAGGCAGAAG CCTCGCTGCTTTTATTCTCG 
 CYP6N6 AAEL009126 TTCTTCATCGGTGCTGTGAG TTTGCGCAAGTTCGTACAAG 
 CYP6N9 AAEL009121 ACCGCAACCCAAGACTACAC AAACGCATCCCGATACAGAC 
 CYP6N11 AAEL009119 CTGCCTGTCTACGCAATTCA CAAAATTTTCAACGGGCTTG 
 CYP6N11 AAEL009138 TGGGTTATCTGGCGCTATTC ACACATCCTTGGCAAAGTCC 
 CYP6N12 AAEL009124 TTCACTTGCGCGATCACTAC TGCAGCAATTTCCTCAACAG 
 CYP6N13 AAEL009137 ACAATGTCCCGAACTCGAAC CATCATTCCGAATCGTGTTG 
 CYP6N14 AAEL009133 ACGTTTTCTTCCGGGAAACT TTTCGCCCATTTTTCTGAAC 
 CYP6N15 AAEL009122 GTCAAGGCGTACCGTTCATT CGCGATCGTGAAAGTACTGA 
 CYP6N16 AAEL010151 AAAACCTCGCAAGAAAAGCA GCCACCACCTCGTTCATACT 
 CYP6N17 AAEL010158 AAGCATCACCCAGAACCAAC ACCTTCTTGGCCAGGTTCTT 
 CYP6P12v1 AAEL012491 GGCAGTTTTTGGTGGACAGT CTGCTCGAACACCTTCTTCC 
 CYP6S3 AAEL009120 AGGCAGATGGGGAAGAGAAT TCAACAGCTGCATGAAGTCC 
 CYP6Y3 AAEL009132 GCTAGTGGCTGCCGTTCTAC CAGAGGCGAAGTCAACATGA 
 CYP6Z6 AAEL009123 CGAGGTGTCTACTGCAACGA TAACTTGTGCCCAACATCCA 
 CYP6Z7 AAEL009130 GAGATCCGTTTTCTGCAAGC GGTTCGCGATTCTCAGCTAC 
 CYP6Z8 AAEL009131 CCTGAGATGATCCGATTCGT CTCTTCGAAACCCAAAGCTG 
 CYP6Z9 AAEL009129 TCCAATGGAGCAATCACGTA ATCGTTCCGGAATGTAGCAC 
 CYP6AA5v1 AAEL012492 CCAGCTTCGAGCCTTTTATG TGAAGACTCTGTCGGCAATG 
 CYP6AG3 AAEL007024 CCGAACGTTTTAACCCAGAA CTCGTTTGCCGAAAAGTAGC 
 CYP6AG5 AAEL006984 ACATTCCGCAGAAGATGGTC TAGGTGGATAGCCCAGATCG 
 CYP6AG6 AAEL006992 ACACCCGCGTTTACTACGTC GCGCATCACAAGCAAAGATA 
 CYP6AG7 AAEL006989 TGTTTCCAGCTGCATCTTTG TTTCGCTTGCATCACGATAG 
 CYP6AG8 AAEL003890 ACCAGCACACGGAAAGTACC AACCTGCATACGACCGAAAC 
 CYP6AH1 AAEL007473 CTGCGTGCTGAAAGAGTACG ATCCGCTTACCAACGTCATC 
 CYP6AH1 AAEL015641 CTGCGTGCTGAAAGAGTACG ATCCGCTTACCAACGTCATC 
 CYP6AK1 AAEL004941 AAGGATTGTACGCCGATTTG CTCAAGGAATCCGGTTACGA 
 CYP6AL1 AAEL008889 AACCGAGAATGCACCAAAAC CGACTGTTCGTCACTGGAGA 
 CYP6AL3 AAEL009656 GGCAAAGGTTCATCAGGAAA CACTATGGGTGTGCCCTTCT 
85 
 
 CYP6BB2 AAEL014893 TAGTCGCTAAGGACGGAGGA AAGTACTCCGGATCGTGGTG 
 CYP6BZ1 AAEL012494 GTAGGGCAAATGCTGTGGAT ACTCCGTTGAACGTTGTTCC 
 CYP6CA1 AAEL014680 TCGAGGGACTTTCAGCACTT AACAAATCGGCCACGTCTAC 
 CYP6CB1 AAEL002046 TAAGCAGCGCACCTCCTATT AAAATCAACGGTCAGCATCC 
 CYP6CB1 AAEL009018 GAGTGCAACAGCATGAGGAA GTCATCGTCGTTCAGCTTCA 
 CYP6CB2 AAEL002872 GTTTCGGAGATGGTCCAAGA GGTTGAAGCATCAGCAGTGA 
 CYP6CC1v1 AAEL014890 GGGAACAGTTGGCAGGATAA AAGTCCGTGTTTGGGTCTTG 
 CYP6CD1 AAEL005006 TGGCCATTCTCTAGCGTTCT TGCAGGTGGTGTAATCCGTA 
 CYP9J2 AAEL006805 ACCGTTACGCCAACAAAGAC GACGATTTTCGATCGGTTGT 
 CYP9J6 AAEL002638 CAGCGTCAAACCAAGGGTAT GTTTCAAATCCAGCCAGGAA 
 CYP9J7 AAEL014606 CGGATATGGTGCACTTGTTG GGTTCAACGCCAGTTCGTAT 
 CYP9J8 AAEL006811 CCTCAACCGCAAGTACCAAT GTCCTTGACACCGATTTGCT 
 CYP9J9 AAEL006793 TGATCGCTCAGTGTTTCCTG TTCGTAGGTCAATGGCTTCC 
 CYP9J9 AAEL014605 TGATCGCTCAGTGTTTCCTG TTCGTAGGTCAATGGCTTCC 
 CYP9J10 AAEL006798 TATGGCGGAGTTTTTCAAGG CACCGATAGCGATTGGAAGT 
 CYP9J15 AAEL006795 GTACTACCCACAGCCGGAAA ACACAACCGCTTTCATCTCC 
 CYP9J16 AAEL006815 ACGATTGCCATACACAACGA TCTGCGTCTTCTCCGTAGGT 
 CYP9J17 AAEL009699 GGAGAAATTGGGGGTTGATT TCATCCATCTCGTGCTTCAG 
 CYP9J17 AAEL006784 GAAAGGGAGCACTGAAGCAC AGGTCAAACCCGTAGACACG 
 CYP9J18v1 AAEL006804 TCCCAGATCCAGATCGTTTC AATTTGCGTCTTTTCCGTTG 
 CYP9J19 AAEL006810 CCAACCTTTCTCGTTGGAAA CTTCTACGGGTTGGTCGGTA 
 CYP9J19 AAEL014611 CATCCAGAACGATCCGAAGT GTCCGCTCCAGACTGAACTC 
 CYP9J20v1 AAEL006814 ACGGAACGACATGATCAACA AGCAACTCGTAGGCCAAGAA 
 CYP9J20v2 AAEL014604 TGAGGTTGATGTTCGAGCTG CCCATTGGTGAAGAACTCGT 
 CYP9J21 AAEL014612 GTACAGCGTCTTTCCGAAGC TGCATCAACAGGTGGATCAT 
 CYP9J22 AAEL006802 TGTTGATGCAGGCAAAGAAG CTGCCAGGAAAAAGACGAAG 
 CYP9J23 AAEL014615 GTGCACCTTTCCGGAGTTTA AAGGGTCTTCTCGAACAGCA 
 CYP9J24 AAEL014613 TTCCCAACGTATGCGTTACA GAGGAACTTCCGTCTTGCTG 
 CYP9J26 AAEL014609 AGATGATCGCACAGTGCTTG GGGCCACATTCTCAGTGTTT 
 CYP9J27 AAEL014616 ACGGCAAGAAAATGATGGAC CGGTTCCATGACTCTCCCTA 
 CYP9J27 AAEL014607 CGGCACGGTAAGAAAATGAT AGCCTTGATCGTCTCCTGAA 
 CYP9J28 AAEL014617 TTTCCTCGACAAACCGATTC AAAGTCCTTAACGGCCACCT 
 CYP9J29 AAEL014610 GATGAGCAGCACAGGTCAAA AGTGGATTGCCCATTTGAAG 
 CYP9J30 AAEL014603 TCAAAGTCCTCGGGATGTTC ATATTACGCCATCGCTGACC 
 CYP9J31 AAEL002633 TTTTCAGCGATTGAGTGTCG ATATCCTTGGTCTGGCGTTG 
 CYP9J32 AAEL008846 GCCGTGACTACGTTTTGGAT CTCGATCCAATGCAATTCCT 
 CYP9M4 AAEL001320 GGTTGATCACGAAGGACGTT AACCGTCGTAAATCCAGCAC 
 CYP9M5 AAEL001288 GTCGGTTCTCAGCTTCGTTC ATGGTCCTCGAACGTGTAGG 
 CYP9M6 AAEL001312 CAGTGGCCACCTACGATTTT CGCTGGATCGTGGATAAGAT 
 CYP9M7 AAEL001292 AGGACTATGGCCGGTTTTCT GCCCTAGAATCGGATCAACA 
 CYP9M8 AAEL009591 AGCTGCCACTGTAGCCACTT TTTGCTGCATCGATTCGTAG 
 CYP9M9 AAEL001807 CACTAAGGAAATGGCCTCCA TCCGGATCAAATCTTTCTGG 
 CYP9AE1 AAEL003748 CAGTTCGGGATGGAGTTGTT TCAACTCGTCGTCACTCCAG 
 CYP329B1 AAEL003763 CTTCCTGGACGAAAGCAAAG TAGTTCCGAATCCACGGAAG 
Clan4 P450 CYP4C38 AAEL012266 GAAAAGTCCCACGGCTATGA CTTTCGTGATGAAGGGGAAA 
 CYP4C50 AAEL008017 AAATTCGGAAGCAGAAGCAA ATGCCTCGATCAACAGATCC 
 CYP4C51 AAEL008018 CAATCGACAAGCTCAGACCA GCATTATGCGTCCGATTTCT 
 CYP4C52 AAEL008023 TTCCTCGATCGGGTCATTAG GCTTTTCTCCACCAGCTTTG 
 CYP4D23 AAEL007816 GTTCAACAAGCGCAAGATCA TTTATCGGAGTTCCCATTGC 
 CYP4D24 AAEL007815 TACTTCACCCCGTACCGAAG AGGGGTCTCCCGTCTACTGT 
 CYP4D37 AAEL007795 GGAGACGGTTTGCTTCTGAG CAAAGCGTACAGCAGCACAT 
 CYP4D38 AAEL007807 CAAGCAACCCGATGAATTTT CGAGCCAGTTGGAGAGGTAG 
 CYP4D39 AAEL007808 CGTCGCAGCAATAAAACTCA CCTCTCGATGGTGAGGAAAA 
 CYP4G35 AAEL008345 GGACCGATGGCTTCAGAATA GCATCAAGCAAAAGCAACAA 
 CYP4G35 AAEL006824 GGTCGTCAAGCAGAAGAAGG GAAATCCAGATCGTCCCTGA 
 CYP4G36 AAEL004054 AACACCAATAGCGTGGAAGG CCCATCATCGAAAGGAAGAA 
86 
 
 CYP4H28 AAEL003380 ACACCGAAGGTGAAACCAAG GGGCCATCAACGAGAAGTAA 
 CYP4H29 AAEL007830 TGCAGGCTGTCAAAGAAATG GATTCTTGCCTTGCTTGCTC 
 CYP4H30 AAEL003399 GCTGCTGAAAATAGCGAACC GTCCCCCAGGAATAGGACAT 
 CYP4H31 AAEL002085 ACAATTCGTGACGGTGTTCA TTGGATTCTTCTGGGCATTC 
 CYP4H32 AAEL007812 ATCCAAATGCTTGGGAACAG CTTCCTCTCGGATGTCTTCG 
 CYP4H33 AAEL013798 CAGTAATTGATGCGCGAAGA ATGACCCTCGAACATGAAGG 
 CYP4J13 AAEL013555 CAGGACCGTTGGAAGTTGAT AGAGCGCACAGTACCGTTTT 
 CYP4J14 AAEL013554 AAGTTGTCCACGGTTTCTGG GAACGAATGAACCGGAAGAA 
 CYP4J15v1 AAEL013556 GCTGGATTCGCTTTTACTCG GAAAGCTCGGGATGACTGAG 
 CYP4J15v2 AAEL014829 AAACATCGATGGGCGTTAAG AGCCGCTTTATAGCCTGTCA 
 CYP4J16 AAEL015663 AACGGATCATGAACCCTCTG TTCCGCCAGCAGAAGACTAT 
 CYP4J17 AAEL015370 AGAATTCCCCTACCGCTTGT GGCCAGTAAGGTATCCAGCA 
 CYP4J17 AAEL014019 GGAGGAGATCGAAACCATGA ACTGTGCATCCTCCAAAACC 
 CYP4K3 AAEL007798 GGAAGTGCAACGGAAATTGT CTTCGGACTTTGAGGCGTAG 
 CYP4AR2 AAEL010154 CGGAGGTTTGCAATGATTCT CGTCTGGGTACTTTGCCATT 
 CYP325E3 AAEL000338 CAATAGGGTGTTTCGGGAGA CTGTTAAGGATGCGGGTGTT 
 CYP325G2 AAEL012766 CTTATCGGTTGTGGCCATCT CTGCATATCTTCCGGGTTGT 
 CYP325G3 AAEL012772 TACCCTTTGATCGGAAGTGC ACCGGTGAAGTGAACAGTCC 
 CYP325K2 AAEL005771 ATTTTGCCCGCTATCTTCCT TTCTCCTGGCAATAGGGATG 
 CYP325K3 AAEL005788 ATTCCGAAGGGAACTGTCCT CAAGTCGGTGCTGAGTTCAA 
 CYP325L1v1 AAEL011770 TCGGTGGAAACGAAACTACC GTTCGTCCGAGGATTGTTGT 
 CYP325M1 AAEL012773 AGACGAAAAGTTCGCAGCAT CCTCTTGATAGCAGCGTTCC 
 CYP325M2 AAEL012769 TTCGTTCTTTTGGGTTCCAC TGCTGCTTTCCAACGTATTG 
 CYP325M2 AAEL015591 TTCGTTCTTTTGGGTTCCAC TGCTGCTTTCCAACGTATTG 
 CYP325M3 AAEL012765 CGATCTGTGTGGAGAGCAAA GTTTTCGCCGTTGTTTCATT 
 CYP325M4 AAEL011769 CGTTGAATCCTTCGTTTGGT GGCCGTTGCATAGATTTGAT 
 CYP325M5 AAEL011761 TGGAAAAATCAACGGAAAGC TCGCTGCATATCGAAGTCAC 
 CYP325N1 AAEL012770 GTACCTTGAAGCGCAAGAGG TGTTCAGCATTCCTTGCTTG 
 CYP325N2 AAEL012762 CTTGCCCGGATAGAAATCAA TCCGGGTTGAAGTTTTTGAC 
 CYP325P1 AAEL000340 CGTGGTTGATTTCGGAGTTT GCCTGGGTGTGATTTCTGTT 
 CYP325Q1 AAEL006044 ACCACGGAAGCTCTGAAAAA CATCTGGTCCCCATACATCC 
 CYP325Q2 AAEL015563 ACGAAAGTGCGGAAAGAAGA CAGGTGTAGGAAACGGCATT 
 CYP325R1 AAEL005775 CGGCTTACTCATGGGTTGTT TATCCACTGGAGTCCCTTCG 
 CYP325S1 AAEL000326 CCGATTTTCTTCGACAGCTC GCAAAATTCTCCGGATCAAA 
 CYP325S2 AAEL000325 GCCGAAATCATGGAACACTT CCACATATCCGCTCTTCGAT 
 CYP325S3 AAEL000357 TTGCTCGGCAGTGTATCAAG TCCGGTAGGAAATTGTCTGG 
 CYP325T2 AAEL012761 GAGTTTGCCATCCGGATCTA CCTGCTGCAACACTTTTCAA 
 CYP325T2 AAEL015475 CTCATGGCCTATGCCTGTTT GCCATGTTTTGCCTTACGAT 
 CYP325U1 AAEL000320 GGGGAAAAATGGTGAGGAAT ATTCAGTGCCTTACGCTGCT 
 CYP325X1 AAEL005695 CTGTACCGGTTTGCTGGATT TCGTCATCTTCTCGCAACAC 
 CYP325X2 AAEL005696 TGTCGTTCTACCCGGAAATC TCGAACTCGGCCATATTTTC 
 CYP325X4 AAEL005700 GGCTCAACTCCAGCTTCAAC CGAATTCCTCTTTCCCTTCC 
 CYP325Y1 AAEL006257 GAAATCGTGCTCGATGGAAT AGATAGGCAAATGGGTGACG 
 CYP325Y2v2 AAEL015362 AGGAAGCCCTCCGTATTTGT ATGCCTTTGCTGAACTGCTT 
 CYP325Y3 AAEL006246 GGCATACGCATCCCTAAAGA TCTGCATAATCCGCAACAAA 
 CYP325Y3 AAEL015361 CAATCGCTTGGTGAGGATTT CCTCCGGGTACATTGCTAGA 
 CYP325Z1 AAEL010273 CACCAAATCCAAGCCAAAGT GTCTTTCCGCCTGTGAAGAG 
 CYP325AA1 AAEL004012 TGCTTTCGTGGATCGTAGTG CACCAGCTCTGGATGCTGTA 
Mito P450 CYP12F5 AAEL001960 ACAAGGAGAAAGCTGGCAAA CATCGAGAACTCCCAATCGT 
 CYP12F6 AAEL002005 TACATCGTTGACTCCGGACA CGAAGCGATCACTTTGTTGA 
 CYP12F7 AAEL002031 CTGGAAACGATGGGTGTTCT GATAACCGCGTCATCAACCT 
 CYP12F8 AAEL006827 TGGATAAGGTTGCCCTTCAG TCTCCAGATCGAGGGAAGAA 
 CYP49A1 AAEL008638 GTGCATCAAAGAAACGCTGA CGGTCTGGTTCTGGGAAATA 
 CYP301A1 AAEL014594 CCTGGAACCGAACTTGACAT CGTCCTTCACCCAAGTTCAT 
 CYP302A1v1 AAEL011463 TTTCGATGTACGGTTGGACA GCTTTCGATACGCTGGAGTC 
 CYP302A1v2 AAEL015655 TTTCGATGTACGGTTGGACA GCTTTCGATACGCTGGAGTC 
87 
 
 CYP314A1 AAEL010946 GCGGAGACAAGCAAAAGAAC ACGATTTCGGCGATTGTATC 
 CYP315A1 AAEL011850 ATTCATTGGACGCTTTTTGG TCCCTTCGTAACCACCTTTG 
Other P450 reductase AAEL003349 TTCCTTCCCCGCTTTTATCT CTGTGTAGCGGTGCTTGTGT 
 60S RP-L24 AAEL008329 GAGGCAGTAAAATTTCGCCA AGGTGAAAGTCTTGCCATCG 
Drosophila 
constructs 
CYP4D24 AAEL007815 CCGCTCGAGCAAAATGCTTAT
CTTATTGGCT 
CTAGCTCGAGCCGCACCCTGC
TTCTGATCCT 
 CYP4H29 AAEL007830 CCGGAATTCCAAAATGGTGCC
TCTTCTGATG 
CTAGCTCGAGTCGTGGCACAA
TCTTCACAAA 
 CYP4J15v1 AAEL013556 CCGGAATTCCAAAATGTTGCT
TATTCTAACGC 
CTAGCTCGAGTCTCCTCTCAA
ACCTAACCTC 
 CYP4H33 AAEL013798 CCGGAATTCCAAAATGGATTT
CCTAACGAAT 
CTAGCTCGAGAATTCTTTCCA
CTAGCTTAAT 
?Nomenclature for the cytochrome P450 genes was taken for the Ae. aegypti cytochrome P450 
database at: http://drnelson.uthsc.edu/CytochromeP450.html 
?Vectorbase Ae. aegypti predicted gene set v. AaegL1.1. http://aaegypti.vectorbase.org/ 
 
The clones were then sub-cloned into the pUASTattB vector (a gift from Dr. Johannes Bischof, 
University of Zurich) (Brand and Perrimon, 1993; Bischof et al., 2007). The plasmid of each 
pUASTattB-up-regulated gene was transformed into the germ line of D. melanogaster 
(Bloomington stock #24484, genotype M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP'}ZH-58A), 
resulting in site specific integration on chromosome 2R (Bateman et al., 2006; Rainbow 
Transgenic Flies Inc., Camarillo, CA). Flies were then reciprocally-crossed against a W1118 strain 
to obtain transgenic D. melanogaster with the orange eye phenotype. The flies were then 
balanced against a D. melanogaster balancer strain (Bloomington stock #6312, genotype: 
w[1118]/Dp(1;Y)y[+]; sna[Sco]/CyO, P{ry[+t7.2]=sevRas1.V12}FK1) to generate a 
homozygous line containing the cytochrome P450 transgene on chromosome 2R. The insertion 
of the up-regulated genes in the transgenic fruit fly lines were further confirmed using RT-PCR. 
Transgenic virgin female D. melanogaster were then crossed with male GAL4-expressing D. 
melanogaster (Bloomington stock #3954, genotype: P{Act5C-GAL4}17bFO1) which expresses 
GAL4 under control of the Act5C promoter, resulting in ubiquitous non-tissue-specific 
expression. The F1 generation of these crosses expressed GAL4 and contained a single copy of 
the Cytochrome P450 transgene, which was under control of the UAS enhancer. Permethrin 
88 
 
toxicity bioassays were then conducted on 2-3 day post eclosion female Drosophila of F1 UAS-
GAL4 crosses to examine the toxicity of pyrethroids to transgenic flies. Briefly, serial 
concentrations of each pyrethroid solution in acetone, ranging from 25 ng/?L to 100 ng/?L that 
gave >0 and <100% mortality to the tested insects were prepared. Two hundred ?L of each 
permethrin concentration solution was evenly coated on the inside of individual 20 mL glass 
scintillation vials. Fifteen female flies were transferred to each of the prepared vials, and three 
vials were used for each concentration for each bioassay replicate. The vials were plugged with 
cotton balls soaked with 5% sucrose and the mortality was scored after 24 hr exposure to the 
pyrethroids. Each bioassay was independently replicated three times using only flies that 
exhibited the correct morphological marker (GAL4 red eyes). The D. melanogaster strain 
(Bloomington stock #24484, genotype: M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP'}ZH-58A) 
containing the empty pUAST vector donated insert, but no transgene from M. domestica was 
used as the control reference strain following the identical crossing protocol of virgin control 
females with GAL4 expressing males to obtain the F1 generation for testing. Preliminary testing 
determined that vials coated with 2 and 0.3?g of permethrin and beta-cypermethrin, respectively, 
resulted in nearly complete mortality of the empty-vector control line. Subsequently, the lowest 
insecticide concentrations chosen were 5 and 0.5 ?g of permethrin and beta-cypermethrin, 
respectively, which resulted in 100% mortality of the control mosquitoes for all bioassay 
replicates. All tests were run at 27oC and mortality was assessed after 24 h. All D. melanogaster 
were reared on Jazz-Mix Drosophila food (Fisher Scientific, Kansas City, MO) at 25?2oC under 
a photoperiod of 12:12 (L:D) h following standard protocols (Ashburner et al., 2005). 
 
5.4 Results and Discussion 
89 
 
Topical application of permethrin revealed that the level of permethrin resistance within the 
Puerto Rico strain was 73 times higher than in the laboratory insecticide susceptible Orlando 
strain (Table 2).  
 
Table 5.2. Resistance ratio of the permethrin-resistant strain of Ae. aegypti Puerto Rico 
compared to the laboratory permethrin-susceptible strain Orlando in the presence and absence of 
the cytochrome P450 metabolic inhibitor piperonyl butoxide (PBO). 
 
Strain LD50 (95% CI) ng/insect Slope (SE) ?2 df Fold 
resistance 
Orlando 0.21 (0.12  ?  0.41) 2.89 (0.44) 8.02 4 1.00 
+PBO 0.14 (0.09  ?  0.23) 2.08 (0.29) 6.37 5 0.68 
Puerto Rico 15.20 (1.00 ? 29.90) 1.48 (0.26) 1.39 7 73.07 
+PBO 3.28 (2.02  -  5.85) 0.96 (0.14) 3.99 7 15.76 
 
Following a 1 hour pre-treatment of adult mosquitoes with the cytochrome P450 inhibitor 
piperonyl butoxide (PBO), the resistance ratio of the Puerto Rico strain was decreased to 15-fold 
compared to the insecticide susceptible Orlando strain and 23-fold compared to the Orlando 
strain pre-treated with the PBO (Table 2). These results showed that when the cytochrome P450s 
in the Orlando strain were inhibited by PBO, the resistance level of adult females decreased to 
0.7-fold (30% decrease), whereas when the cytochrome P450s in the Puerto Rico strain were 
inhibited by PBO, the resistance level of adult females decreased to 15-fold (~80% decrease). 
This suggested that cytochrome P450s may have a role in the level of permethrin resistance 
observed in the Puerto Rico strain of Ae. aegypti. We further tracked the level of resistance in 
each generation using a two-point primary component analysis to trace the attenuation of 
permethrin resistance in the Puerto Rico strain. The two doses of permethrin selected were 0.8 ng 
per female, because this rate represented the LD95 for the pyrethroid-susceptible Orlando strain, 
while the higher dose (6.25 ng per female) was intermediate to the LD50 for the Puerto Rico 
90 
 
strain and complete mortality in the Orlando strain. Overall, the level of resistance was found to 
decrease within the first 18 generations, suggesting that to identify which cytochrome P450s 
were involved in the observed resistance, all of the cytochrome P450 gene expression levels in 
both the Puerto Rico and Orlando strains required assessment (Fig. 1). Of the 164 cytochrome 
P450s investigated for their gene expression levels, a total of 33) cytochrome P450s were 
significantly up-regulated (p<0.05) with ? 2-fold increases, while eight cytochrome P450s were 
significantly down-regulated (p<0.05) with ?2-fold decreases (Table 3). The remaining 123 
cytochrome P450 genes showed no significant difference (p>0.05) between the Puerto Rico and 
Orlando strains of Ae. aegypti (Table 4). Among the up-regulated genes, the majority were in 
families CYP4, CYP6, and CYP9 which had 9, 11, and 7 genes, respectively (Table 3).  
Figure 5.1. Two-point mortality for the Orlando strain of Aedes aegypti and the different 
generations of the Puerto Rico Ae. aegypti strain. The 0.8 ng per female (low dose) represents the 
maximum dose that results in survival in the pyrethroid-susceptible Orlando strain, while the 
6.25 ng per female represents the high dose. Puerto Rico generations F1, F2, F6, F7, F8, F14, 
and F17 did not have sufficient numbers for testing. 
 
The remaining up-regulated cytochrome P450 genes included three in clan 4 - CYP325 genes, 
91 
 
two in the mito clan - CYP12F genes, and one in clan 2 - CYP15B1. Earlier studies by multiple 
researchers have shown up-regulation of cytochrome P450 genes in insecticide resistant Ae. 
aegypti (Strode et al., 2008; Marcombe et al., 2009; Bariami et al., 2012; Saavedra-Rodriguez et 
al., 2012).  
 
Table 5.3. List of cytochrome P450 genes differentially expressed between the adult females of 
the pyrethroid-resistant strain of Aedes aegypti (Puerto Rico) and the laboratory susceptible 
strain (Orlando). 
Gene? Name? Fold 
expression in 
Puerto Rico 
Studies that also identified as up-regulated in insecticide-resistant Ae. 
aegypti 
Up-regulated     
Clan 2    
AAEL002067 CYP15B1    2.51?0.03**  
Clan 3    
AAEL007024 CYP6AG3    2.33?0.05**  
AAEL006989 CYP6AG7    2.28?0.08**  
AAEL014893 CYP6BB2    3.01?0.18** (Bariami et al., 2012; Saavedra-Rodriguez et al., 2012) 
AAEL002046 CYP6CB1  14.46?0.28** (Strode et al., 2008; Bariami et al., 2012; Saavedra-Rodriguez et al., 
2012) 
AAEL009018 CYP6CB1  10.60?0.41** (Strode et al., 2008; Bariami et al., 2012) 
AAEL014678 CYP6F2    4.38?0.11**  
AAEL009127 CYP6M11    5.70?0.31** (Poupardin et al., 2008; Marcombe et al., 2009; Bariami et al., 2012) 
AAEL009121 CYP6N9    2.31?0.04** (Bariami et al., 2012) 
AAEL009124 CYP6N12    3.38?0.16** (Bariami et al., 2012) 
AAEL009137 CYP6N13    3.53?0.01**  
AAEL009123 CYP6Z6    3.16?0.02** (Marcombe et al, 2009;  Saavedra-Rodriguez et al., 2012) 
AAEL006805 CYP9J2  12.17?2.83**  
AAEL006798 CYP9J10    2.89?0.29** (Strode et al., 2008; Bariami et al., 2012) 
AAEL006814 CYP9J20v1    3.29?0.20**  
AAEL014612 CYP9J21    3.94?0.42**  
AAEL014609 CYP9J26    2.76?0.22** (Strode et al., 2008; Bariami et al., 2012) 
AAEL014616 CYP9J27    2.85?0.13** (Strode et al., 2008; Bariami et al., 2012 ) 
AAEL002633 CYP9J31    2.30?0.07**  
Clan 4    
AAEL013556 CYP4J15v1    2.30?0.06** (Marcombe et al, 2009?) 
AAEL014829 CYP4J15v2    3.85?0.22** (Marcombe et al, 2009?) 
AAEL007815 CYP4D24    2.81?0.09**  
AAEL008345 CYP4G35    3.03?0.08**  
AAEL006824 CYP4G35    3.44?0.30**  
AAEL007830 CYP4H29    2.52?0.18**  
AAEL003399 CYP4H30    3.85?0.18**  
AAEL013798 CYP4H33    2.73?0.03**  
AAEL004054 CYP4G36    2.84?0.23** (Saavedra-Rodriguez et al., 2012) 
AAEL012766 CYP325G2    2.06?0.04  
AAEL012772 CYP325G3    3.61?0.20**  
AAEL011769 CYP325M4    2.72?0.11**  
Mito clan    
AAEL002005 CYP12F6    2.14?0.06* (Strode et al., 2008) 
92 
 
AAEL006827 CYP12F8    2.30?0.06**  
 
Down-
regulated 
   
Clan 3    
AAEL009119 CYP6N11    0.33?0.01?  
AAEL009131 CYP6Z8    0.06?0.01?  
AAEL006784 CYP9J17    0.31?0.06?  
AAEL014611 CYP9J19    0.04?0.01?  
AAEL014610 CYP9J29    0.39?0.07?  
AAEL003748 CYP9AE1    0.38?0.08?  
Clan 4    
AAEL007812 CYP4H32    0.36?0.02?  
AAEL014019 CYP4J17    0.44?0.03?  
AAEL012765 CYP325M3    0.31?0.02?  
?Nomenclature for the cytochrome P450 genes was taken for the Ae. aegypti cytochrome P450 
database at: http://drnelson.uthsc.edu/CytochromeP450.html 
?Vectorbase Ae. aegypti predicted gene set v. AaegL1.1. http://aaegypti.vectorbase.org/ 
*significantly up-regulated (>2-fold) at the P<0.05 level of significance 
**significantly up-regulated (>2-fold) at the P<0.01 level of significance 
?significantly down-regulated (>2-fold) at the P<0.01 level of significance 
 
In our study, we found that several of the cytochrome P450 genes that we identified as up-
regulated the Puerto Rico field strain were also identified in other studies including: CYP6BB2, 
CYP6CB1, CYP6M1, CYP6N9, CYP6N12, CYP6Z6, CYP9J10, CYP9J26, CYP9J27, CYP4J15, 
CYP4G36, and CYP12F6. These results provided strong evidence that gene over-expression of 
cytochrome P450s was responsible for the observed level of permethrin resistance in the Puerto 
Rico strain of Ae. aegypti. However, further evidence beyond gene over-expression is necessary 
when characterizing cytochrome P450s for their role in insecticide resistance. Recently, Ptitsyn 
et al. (2011) showed that the gene expression of multiple genes within Ae. aegypti followed a 
circadian rhythym, and among these genes were 17 cytochrome P450s, including CYP9J10, 
which was identified as upregulated in our study and other studies that investigated gene up-
regulation in adult female insecticide-resistant Ae. aegypti. In addition, insecticide metabolism 
studies by Stevenson et al. (2012) have shown that not all up-regulated cytochrome P450s in 
insecticide resistant mosquitoes can functionally metabolize insecticides. In their study, 
93 
 
Stevenson et al. looked at several cytochrome P450s, including two identified as up-regulated in 
our study, CYP6CB1 and CYP9J26 for which they found that CYP9J26 was functional for 
metabolizing both permethrin and deltamethrin, while CYP6CB1 did not metabolize either of the 
two pyrethroids tested.  
Table 5.4. Relative cytochrome P450 gene expression values in the pyrethroid-resistant Puerto 
Rico strain compared with the pyrethroid-susceptible Orlando strain. 
 
Clan? 
 
P450? 
 
AAEL? gene number 
Fold upregulated in Puerto 
Rico compared to Orlando 
Clan 2 CYP15B1 AAEL002067   2.51?0.15** 
 CYP18A1 AAEL004870 1.29?0.21 
 CYP303A1ae AAEL012144 1.15?0.16 
 CYP304B2xx/yy AAEL014412 1.29?0.17 
 CYP304B3yy/xx AAEL014411 1.00?0.23 
 CYP304C1 AAEL014413 1.33?0.17 
 CYP305A6 AAEL002071 1.41?0.26 
 CYP305A5 AAEL002043 1.38?0.39 
 CYP306A1 AAEL004888 0.86?0.33 
 CYP307A1 AAEL009762 1.30?0.28 
 CYP307A1 AAEL009768 1.48?0.28 
 CYP307B1 AAEL006875 1.29?0.17 
Clan 3 CYP6F2 AAEL014678   4.38?1.38** 
 CYP6F3 AAEL014684 1.92?0.62 
 CYP6M5 AAEL009117 0.80?0.38 
 CYP6M6 AAEL009128 0.69?0.21 
 CYP6M10 AAEL009125 0.99?0.35 
 CYP6M11 AAEL009127   5.70?0.44** 
 CYP6N6 AAEL009126 1.62?0.16 
 CYP6N9 AAEL009121    2.31?0.17** 
 CYP6N11 AAEL009119 0.33?0.01? 
 CYP6N11 AAEL009138 1.50?0.23 
 CYP6N12 AAEL009124    3.38?0.24** 
 CYP6N13 AAEL009137    3.53?0.31** 
 CYP6N14 AAEL009133 1.45?0.12 
 CYP6N15 AAEL009122 1.61?0.17 
 CYP6N16 AAEL010151 1.42?0.13 
 CYP6N17 AAEL010158 1.48?0.25 
 CYP6P12v1 AAEL012491 1.46?0.13 
 CYP6S3 AAEL009120 1.7?0.09 
 CYP6Y3 AAEL009132 1.5?0.10 
 CYP6Z6 AAEL009123  3.16?0.07** 
 CYP6Z7 AAEL009130 0.89?0.70 
 CYP6Z8 AAEL009131 0.06?0.01? 
94 
 
 CYP6Z9 AAEL009129 1.31?0.06 
 CYP6AA5v1 AAEL012492 1.61?0.09 
 CYP6AG3 AAEL007024   2.33?0.06** 
 CYP6AG5 AAEL006984 1.18?0.14 
 CYP6AG6 AAEL006992 1.29?0.16 
 CYP6AG7 AAEL006989   2.28?0.16** 
 CYP6AG8 AAEL003890 1.37?0.19 
 CYP6AH1 AAEL007473 1.51?0.11 
 CYP6AH1 AAEL015641 1.74?0.26 
 CYP6AK1 AAEL004941 1.92?0.19 
 CYP6AL1 AAEL008889 2.06?0.11 
 CYP6AL3 AAEL009656 0.83?0.16 
 CYP6BB2 AAEL014893   3.01?0.25** 
 CYP6BZ1 AAEL012494 1.67?0.15 
 CYP6CA1 AAEL014680 2.15?0.64 
 CYP6CB1 AAEL002046  14.46?0.05** 
 CYP6CB1 AAEL009018  10.60?0.13** 
 CYP6CB2 AAEL002872 0.52?0.32 
 CYP6CC1v1 AAEL014890 n/d 
 CYP6CD1 AAEL005006 1.52?0.23 
 CYP9J2 AAEL006805 12.17?1.23** 
 CYP9J6 AAEL002638 1.86?0.18 
 CYP9J7 AAEL014606 1.72?0.17 
 CYP9J8 AAEL006811 2.11?0.82 
 CYP9J9 AAEL006793 2.45?0.39 
 CYP9J9 AAEL014605 2.83?0.26 
 CYP9J10 AAEL006798   2.89?0.28** 
 CYP9J15 AAEL006795 0.70?0.53 
 CYP9J16 AAEL006815 0.88?0.39 
 CYP9J17 AAEL009699 0.78?0.24 
 CYP9J17 AAEL006784 0.31?0.06? 
 CYP9J18v1 AAEL006804 0.77?0.41 
 CYP9J19 AAEL006810 1.41?0.20 
 CYP9J19 AAEL014611  0.04?0.01? 
 CYP9J20v1 AAEL006814   3.29?0.44** 
 CYP9J20v2 AAEL014604 2.04?0.50 
 CYP9J21 AAEL014612   3.94?0.43** 
 CYP9J22 AAEL006802 2.30?0.32 
 CYP9J23 AAEL014615   3.77?0.31** 
 CYP9J24 AAEL014613 1.84?0.35 
 CYP9J26 AAEL014609   2.76?0.24** 
 CYP9J27 AAEL014616   2.85?0.16** 
 CYP9J27 AAEL014607   3.17?0.19** 
 CYP9J28 AAEL014617 1.36?0.3 
 CYP9J29 AAEL014610 0.39?0.07? 
 CYP9J30 AAEL014603 1.37?0.33 
95 
 
 CYP9J31 AAEL002633   2.30?0.14** 
 CYP9J32 AAEL008846 1.16?0.15 
 CYP9M4 AAEL001320 1.02?0.30 
 CYP9M5 AAEL001288 1.18?0.34 
 CYP9M6 AAEL001312 1.83?0.23 
 CYP9M7 AAEL001292 1.73?0.38 
 CYP9M8 AAEL009591 1.55?0.21 
 CYP9M9 AAEL001807 1.01?0.14 
 CYP9AE1 AAEL003748  0.38?0.08? 
 CYP329B1 AAEL003763 1.51?0.13 
Clan 4 CYP4C38 AAEL012266 1.09?0.15 
 CYP4C50 AAEL008017 1.20?0.19 
 CYP4C51 AAEL008018 0.85?0.36 
 CYP4C52 AAEL008023 0.61?0.42 
 CYP4D23 AAEL007816 1.68?0.17 
 CYP4D24 AAEL007815   2.81?0.20** 
 CYP4D37 AAEL007795 1.47?0.30 
 CYP4D38 AAEL007807 1.44?0.10 
 CYP4D39 AAEL007808 1.54?0.07 
 CYP4G35 AAEL008345   3.03?0.07** 
 CYP4G35 AAEL006824   3.44?0.20** 
 CYP4G36 AAEL004054   2.84?0.16** 
 CYP4H28 AAEL003380 1.27?0.71 
 CYP4H29 AAEL007830   2.52?0.43** 
 CYP4H30 AAEL003399   3.85?0.50** 
 CYP4H31 AAEL002085 1.36?0.51 
 CYP4H32 AAEL007812 0.36?0.02? 
 CYP4H33 AAEL013798   2.73?0.13** 
 CYP4J13 AAEL013555 1.05?0.15 
 CYP4J14 AAEL013554 1.00?0.11 
 CYP4J15v1 AAEL013556     2.30?0.18** 
 CYP4J15v2 AAEL014829     3.85?0.46** 
 CYP4J16 AAEL015663 1.06?0.29 
 CYP4J17 AAEL015370 1.23?0.42 
 CYP4J17 AAEL014019 0.44?0.03? 
 CYP4K3 AAEL007798 1.19?0.28 
 CYP4AR2 AAEL010154 1.09?0.23 
 CYP325E3 AAEL000338 0.76?0.64 
 CYP325G2 AAEL012766 2.06?0.31 
 CYP325G3 AAEL012772   3.61?1.20** 
 CYP325K2 AAEL005771 1.23?0.24 
 CYP325K3 AAEL005788 2.08?0.19 
 CYP325L1v1 AAEL011770 1.66?0.07 
 CYP325M1 AAEL012773 1.28?0.18 
 CYP325M2 AAEL012769 1.41?0.19 
 CYP325M2 AAEL015591 1.54?0.19 
96 
 
 CYP325M3 AAEL012765  0.31?0.02? 
 CYP325M4 AAEL011769   2.72?0.28** 
 CYP325M5 AAEL011761 1.40?0.18 
 CYP325N1 AAEL012770 0.76?0.34 
 CYP325N2 AAEL012762 0.98?0.14 
 CYP325P1 AAEL000340 1.66?0.13 
 CYP325Q1 AAEL006044 1.16?0.13 
 CYP325Q2 AAEL015563 1.44?0.30 
 CYP325R1 AAEL005775 1.76?0.09 
 CYP325S1 AAEL000326 0.51?0.41 
 CYP325S2 AAEL000325 0.68?0.10 
 CYP325S3 AAEL000357 0.56?0.05 
 CYP325T2 AAEL012761 1.02?0.22 
 CYP325T2 AAEL015475 0.81?0.13 
 CYP325U1 AAEL000320 0.14?0.01 
 CYP325X1 AAEL005695 1.19?0.13 
 CYP325X2 AAEL005696 1.37?0.12 
 CYP325X4 AAEL005700 1.39?0.14 
 CYP325Y1 AAEL006257 1.09?0.20 
 CYP325Y2v2 AAEL015362 0.50?0.23 
 CYP325Y3 AAEL006246 1.21?0.20 
 CYP325Y3 AAEL015361 1.31?0.22 
 CYP325Z1 AAEL010273 1.30?0.13 
 CYP325AA1 AAEL004012 1.51?0.21 
Mito 
Clan 
CYP12F5 AAEL001960 0.47?0.27 
 CYP12F6 AAEL002005  2.14?0.19* 
 CYP12F7 AAEL002031 1.37?0.11 
 CYP12F8 AAEL006827   2.30?0.29** 
 CYP49A1 AAEL008638 1.45?0.14 
 CYP301A1 AAEL014594 1.84?0.15 
 CYP302A1v1 AAEL011463 1.91?0.15 
 CYP302A1v2 AAEL015655 1.46?0.22 
 CYP314A1 AAEL010946 0.77?0.16 
 CYP315A1 AAEL011850 1.92?0.07 
Other NADPH P450 reductase AAEL003349   4.76?0.18** 
?Nomenclature for the cytochrome P450 genes was taken for the Ae. aegypti cytochrome P450 
database at: http://drnelson.uthsc.edu/CytochromeP450.html 
?Vectorbase Ae. aegypti predicted gene set v. AaegL1.1. http://aaegypti.vectorbase.org/ 
*significantly up-regulated (>2-fold) at the P<0.05 level of significance 
**significantly up-regulated (>2-fold) at the P<0.01 level of significance 
?significantly down-regulated (>2-fold) at the P<0.01 level of significance 
 Taken together, these results suggest that the cytochrome P450 genes identified as up-
regulated in the Puerto Rico strain of Ae. aegypti may be involved in insecticide resistance, and 
97 
 
further investigation to test for functionality is needed to identify if they have a role in insecticide 
resistance. Multiple studies have investigated the functional role of insect cytochrome P450s 
(Joussen et al., 2008; Xu et al., 2010; Stevenson et al., 2011; Stevenson et al., 2012; Muller et al., 
2008; Muller et al., 2011; Chandor-Proust et al., 2013; Yang and Liu, 2011), with the main focus 
on characterizing clan 3 cytochrome P450s in families CYP6 and CYP9. In order to add to the 
growing base of literature for cytochrome P450s involved in insecticide resistance, we selected 
genes from family CYP4 for further functional studies. 
Four genes, CYP4D24 (AAEL007815), CYP4H29 (AAEL007830), CYP4J15v1 (AAEL013556), 
and CYP4H33 (AAEL013789), were tested, among which AAEL013556 had been previously 
identified as up-regulated in permethrin resistant Ae. aegpyti (Marcombe et al., 2009), while the 
others had not been previously linked to insecticide resistance in Ae. aegypti. The four P450 
genes from the Puerto Rico strain of Ae aegypti were successfully transferred and expressed in 
D. melanogaster under control of the GAL4-UAS enhancer trap system after full length cloning  
and sequencing (Fig. 2). When adult female D. melanogaster expressing each of the transgenes 
were exposed to either permethrin or beta-cypermethrin (Fig. 3), the results showed a moderate 
increase in survival for transgenic D. melanogaster expressing each of the four CYP4 genes at a 
rate of 5?g/vial permethrin. CYP4D24 (AAEL007815) demonstrated survivorship at 10?g/vial 
suggesting that CYP4D24 may be capable of conferring resistance to type I pyrethroids, although 
CYP4D24 may not be as effective at conferring resistance to pyrethroids as other cytochrome 
P450s. For example, transgenic D. melanogaster expressing CYP6BQ9 from the QTC279 strain 
of Tribolium castaneum under the same Act5c-GAL4:UAS control conferred resistance to 
deltamethrin at a comparable rate (10?g/vial) (Zhu et al., 2010).  
 
98 
 
Figure 5.2. RT-PCR of transgenic D. melanogaster expressing Aedes aegypti cytochrome P450 
genes. The (-) and (+) within gene represent the amplified products from the non-transgenic line 
(-) and the transgenic line (+) of D. melanogaster, respectively.  
 
However the type II pyrethroid deltamethrin has been shown to be more toxic to mosquitoes than 
the type I pyrethroid permethrin (Rettich, F. 1983, Jawara et al., 2001; Allan, 2011). The 
transgenic D. melanogaster testing further showed that the over-expression of CYP4J15v1 
(AAEL013556) conferred a minor level of resistance to both the type I pyrethroid permethrin 
and the type II pyrethroid beta-cypermethrin, while the remaining transgenic D. melanogaster 
lines were not significantly different from each other at the ?=0.05 level of significance and had 
nearly no survival. In addition, CYP4J15v1 was identified to be up-regulated in our study and 
also in a previous study (Marcombe et al., 2009). Taken together, these results suggest that 
99 
 
CYP4J15v1 may have a minor role in conferring pyrethroid resistance to Ae. aegypti. 
Figure 5.3. Survivorship of transgenic D. melanogaster lines following a 24h exposure to either 
permethrin or beta-cypermethrin. Bars within dose superceeded by the same letter are not 
significantly different at the ?=0.05 level of significance. BDRC 24484 is the non-transgenic line 
of D. melanogaster, which had no surviving individuals at any of the doses of the insecticides 
tested. 
 
5.5 Conclusions 
The current study investigated the expression profiles of 164 cytochrome P450 genes in adult 
females of a permethrin-resistant field strain of Ae. aegypti. Overall, a total of 34 genes were 
identified to be up-regulated, several of which were also identified in other field populations of 
insecticide-resistant Ae. aegypti. Functional analysis of some of the lesser-understood 
cytochrome P450s suggested that two genes, CYP4D24 and CYP4J15v1, were capable of 
conferring a low-level of resistance to insecticides when over-expressed in transgenic D. 
melanogaster. Our results add to the body of work that has investigated the gene expression 
profiles of cytochrome P450s in insecticide resistant field strains of Ae. aegypti, and identified a 
100 
 
possible minor role of two family 4 P450 genes, which is important to elucidate the complexity 
of the role of cytochrome P450 genes in pyrethroid resistance in mosquitoes. 
 
5.6 Acknowledgements 
We thank Neil Sanscrainte, Matthew Brown, Francis Golden, and Nathan Newlon for their 
assistance with the rearing of the mosquitoes. We also thank the Deployed War-Fighter 
Protection program for funding. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
  
101 
 
Chapter 6: Temporal gene expression profiles of pre and post blood-fed adult females of the 
Southern house mosquito Culex quinquefasciatus  
 
William R. Reid1 and Nannan Liu1* 
Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849, USA 
 
*To whom correspondence should be addressed 
Prepared for submission to the Journal of Medical Entomology 
 
 
6.1 Abstract  
Prior to acquisition of the first host blood meal, the anautogenous mosquito Culex 
quinquefasciatus requires a period of time in order to prepare for the blood feeding. In the 
current study, we found that adult females required a minimum of 48 h post-eclosion before they 
freely took their first blood meal. We hypothesized that gene expression signatures were altered 
in the mosquitoes before blood feeding in preparation for the acquisition of the blood meal 
through changes in multiple gene expression. To identify the genes involved in the acquisition of 
blood feeding, we quantified the gene expression levels of adult female Cx. quinquefasciatus 
using RNA Seq throughout a pre-blooding period from 2 to 72 h post eclosion at 12 h intervals. A 
total of 325 genes were determined to be differentially-expressed throughout the pre-blooding 
period, with the majority of differentially-expressed genes occurring between the 2 h and 12 h 
post-eclosion time points. Among the up-regulated genes were salivary proteins, odorant-binding 
proteins, and proteases, while the majority of the down-regulated genes were hypothetical or 
cuticular genes. Further analysis of the gene expression profiles following a blood meal 
suggested that only certain vitellogenin genes were highly expressed, and that vitellogenesis in 
102 
 
Cx. quinquefasciatus appears to be a longer process than in Aedes aegypti. Overall, this study 
reviewed multiple genes that might be involved in adult female competency for blood meal 
acquisition of mosquitoes. 
 
Key words: Vitellogenesis, blood feeding, anautogeny 
 
6.2 Introduction 
The Southern house mosquito, Culex quinquefasciatus is a vector of the causative agents of 
several diseases including West Nile Fever, St. Louis Encephalitis, Japanese Encephalitis, and 
lymphatic filariasis. The pathogens vectored by Cx. quinquefasciatus are acquired during the 
blood meal acquisition, which must be taken by the adult female prior to the formation of each 
egg raft (Cupp et al., 2011). Newly eclosed females require a period of time before they are 
capable of taking the blood meal during which, the female mates and continues with the 
necessary development to be competent for the acquisition of the blood meal itself (Williams and 
Patterson, 1969). Many studies have shown that genes and gene up-regulation are involved in the 
processing of the blood meal and subsequently, vitellogenesis (Chen et al., 2004, Hansen et al., 
2005, Bryant et al., 2010). Studies that have characterized the transcriptome expression patterns 
of adult Aedes aegypti (Price et al., 2011) and Anopheles gambiae (Marinotti et al., 2006) have 
shown that multiple genes are involved in blood feeding and that there are different expression 
profiles of these genes both prior to and immediately following the blood meal. The temporal 
characterization of the gene expression profiles of the Cx. quinquefasciatus transcriptome prior 
to the blood meal would provide valuable insight into the genes needed to prepare the female for 
the taking of the blood meal, and also could identify novel targets for controlling Cx. 
103 
 
quinquefasciatus by preventing the blood feeding. Characterization and identification of key 
genes that may be involved in the taking of a blood meal could provide novel targets for novel 
approaches to manage insect disease-vectors. The recent advances in next generation sequencing, 
including RNA Seq, allows for the characterization the gene expression profiles without 
requiring a priori knowledge of which genes to investigate. In the current study, we used RNA 
Seq sequencing to conduct whole transcriptome analyses of adult female mosquitoes during the 
post-eclosion and pre-vitellogenic stages of development to identify genes that are up- or down-
regulated prior to the female freely taking a blood meal and further investigated the temporal 
expression of selected genes following the taking of a blood meal to identify genes that may be 
necessary for both taking of the blood meal, and processing of the blood meal in adult female Cx. 
quinquefasciatus. 
 
6.3 Materials and Methods 
 
6.3.1 Mosquito strains 
Culex quinquefasciatus strain HAmCqG8, whose parental line was originally collected from 
Huntsville, Alabama, has been established in the laboratory where it has been continuously 
reared since 2002 (Liu et al., 2004). All mosquitoes were reared and tested at 25?2oC under a 
photoperiod of 12:12 (L:D) h and fed a diet of Brewer's yeast (Fleishmann, Chesterfield, MO) for 
the larval stages and 10% sucrose and horse blood (College of Veterinary Medicine, Auburn 
University) for the adult stages fed through a stretched Parafilm membrane in a 37oC heated 
water jacketed glass holder. 
 
104 
 
6.3.2 Pre-determination of time period for mosquitoes to take their first blood meal 
 The adult mosquitoes (12 h post eclosion) were divided into 17 groups with a minimum 
of ~60 mosquitoes each in both sexes (~1:1 ratio). The mosquito groups were then independently 
offered pre-warmed (37oC) horse blood meal (College of Veterinary Medicine, Auburn 
University) with an ascending order of every 12 h starting from 24 h after eclosion; i.e., 24, 36, 
48, 60, and 72 84 96 108 120 132 144 h after ecolosion, respectively. Each group of mosquitoes 
was fed for a single blood meal for 2 h and the number of the blood fed female mosquitoes from 
each group were checked after blood-feeding. All blood-feeding time points were repeated in 
triplicate. 
 
6.3.3 RNA extraction  
All collected mosquito samples were flash frozen on dry ice and held at -80?C prior to RNA 
extraction. Total RNA was extracted using the hot acid phenol extraction method as outlined by 
Chomczynski and Sacchi (1987). A total of 30 ?g of RNA was then treated with DNase I using 
the DNA-Free kit from Ambion (Austin, TX) to remove any contaminant DNA and re-extracted 
with two successive acid phenol: chloroform (1:1) steps followed by a final chloroform 
extraction to remove any residual phenol. The RNA was then precipitated over ethanol and re-
suspended in sterile distilled water. After a 1?g aliquot of RNA had been visually inspected for 
quality and for DNA contamination on a 1% agarose gel. The total RNAs were subsequently 
used for either Seq analysis (Hudson Alpha Institute of Biotechnology [HAIB], Huntsville, AL) 
or gene expression analysis.   
 
6.3.4 RNA library preparation, RNA Seq sequencing, Data analysis, and gene expression 
105 
 
processing 
Total RNA quality was assessed by the HAIB using an Agilent 2100 Bioanalyzer and an 
Invitrogen Qubit to ensure quality. Libraries were then prepared using the Illumina RNA Sample 
Prep Kits for mRNA Seq and a 3' poly A tail selection method. Samples were barcoded and run 
as one of four samples on a single lane of an Illumina Hi Seq 2000 chip. Samples for the mRNA 
Seq were run using the PE-50 module (HAIB) which generated paired end libraries with 50 nt 
long sequences on each paired end. Base calling, initial removal of low quality reads, and 
barcode parsing were conducted by the staff at HAIB. Further cleaning of adapter was performed 
using Trimmomatic (Lohse et al., 2012). Paired end reads were then mapped to the Cx 
quinquefasciatus genome from Vectorbase (Megy et al., 2009, Arensberger et al., 2010) using 
Tophat (Trapnell et al., 2009) with mate pair interval of 200 bases and the gtf basefeatures file. 
The -no-novel-juncs flag was used in the alignment to suppress the discovery of novel 
spliceforms in order to estimate gene expression levels based on the Vectorbase annotation of the 
genes. Read counts were determined using Cufflinks, and the testing of differential expression 
was estimated using Cuffdiff as time series data (Roberts et al., 2011). After analysis, only genes 
with expression values ?1, as measured in number of fragments mapped for every thousand 
bases of gene length for every million fragments sequenced (FPKM), were retained for 
expression comparisons (Gan et al., 2010). All data have been submitted to the Gene Expression 
Omnibus at NCBI as accession #GSE51327. 
 
 
 
6.3.5 qPCR gene expression 
106 
 
The total RNA from three independent samples of 20 adult female HAmCqG8 mosquitoes was 
extracted as previously outlined above. The same methodology for obtaining even-aged females 
immediately following eclosion was used to obtain the non-blood-fed females for RNA 
extraction, using the same time points as previously indicated: 2, 12, 24, 36, 48, 60, and 72h 
post-eclosion. In order to obtain the material for the RNA extraction for the post-blood meal 
sampling time points, mosquitoes were initially reared to 7d of age (post-eclosion) prior to the 
offering of a blood meal. Blood meals were then offered for a 2h period at the onset of the 
scotophase, after which blooded females were collected at 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, and 
72h. Females that had not taken a blood meal were removed from the cages immediately 
following the blood meal and the remaining females that had taken a blood meal were held in the 
cages along with the males from the initial population. A total of 20 females were selected for 
each time point and all collections were repeated in triplicate. Total RNA was treated with DNase 
I using the DNA-Free kit from Ambion (Austin, TX) as previously described to remove any 
contaminant DNA, and the DNase I was inactivated using the inactivation buffer from Ambion. 
First strand cDNA was generated from the template RNA using the First strand cDNA synthesis 
kit from Roche (Indianapolis, IN) and an oligo dT primer. RT-qPCR was conducted on an ABI 
7500 Real Time PCR system (Applied Biosystems) using theABI SyBr Green mastermix kit 
(Life Technologies, Carlsbad, CA) and relative gene expression was determined by using the 2(-
??Ct) method (Livak and Schmittgen, 2001) using a portion of the 18S rRNA gene as the 
reference gene. The primers used are provided in supplementary table S1. 
 
 
6.4 Results 
107 
 
 
6.4.1 Determination of the pre-blood meal time period.  
To see the time period needed for mosquitoes to prepare them for the taking of their first blood 
meal, we conducted a time course study on blood feeding with adult Cx. quinquefasciatus and 
tested 11 groups. Each group was offered pre-warmed blood meal starting from 24 h after 
eclosion followed by an ascending order of every 12 h. Our results showed that Cx. 
quinquefasciatus needs a minimum of 48 h after eclosion to prepare the female for the blood 
meal (Fig. 6.1).  
 
Figure 6.1. Box and whisker plot of the percentage of females from even-aged populations of 
Cx. quinquefasciatus strain HAmCqG8 freely taking an offered blood meal. The black lines 
within a bar represent the median percentage of females who freely took a blood meal. The 
upper and lower whiskers represent the highest and lowest observations, respectively, while 
the bars themselves represent the interquartile range (Q1 - Q3). 
 
When mosquito populations had reached 96 h of age (post-eclosion), the average number of 
108 
 
females taking a blood meal plateaued at ~50% with no observable increase in blood meal taking 
by females beyond this time point. Under the rearing conditions tested, some females may 
remain un-mated since the sex ratio was maintained at a consistent ratio. Sebastian and 
DeMeillon (1967) found that mating was a pre-requisite for blood feeding in the closely-related 
mosquito Culex pipiens fatigans, and further identified that a sex ratio of 2:1 (males : females) 
was necessary to maximize insemination, while a sex ratio of 1:1 resulted in an insemination rate 
of only 83%. Since the sex ratio was held at ~1:1 in our study, this may explain why only 50% of 
the females took a blood meal (Craig, 1967).  
Since the objective of the study was to determine the time-to-first blood meal acquisition 
competency, the 96 h time point represented the minimum time to reach maximum first blood 
meal acquisition for females in small populations of even-aged mosquitoes. This suggested that 
under our experimental conditions, the average pre-blood meal competency time period for 
females ranged ~48 h, after which females became competent to take a blood meal, reaching 
maximum blood meal acquisition at ~96 h post-eclosion.  
 
6.4.2 RNA Seq characterization of the pre-blood meal and mating time periods in Cx. 
quinquefasciatus. 
According to the pre-determination of the first blood meal time, we conducted RNA Seq to 
characterize the genes that were involved in the taking of a blood meal. Seven post-eclosion time 
points i.e., 2, 12, 24, 36 48, 60, and 72 h, were selected for the RNA Seq analysis, covering the 
time period from ecosion to the first sign of the blood feeding (i.e., by 48 h post-eclosion) and to 
the maximum mating period of Cx. quinquefasciatus, which has been shown to begin mating 24 
h after ecolosion and reach a maximum by 72 h (Williams and Patterson, 1969). A total of 200 
109 
 
females collected from each of the time points were pooled for the RNA extraction. Except for 
the 2 h time point, in which mosquito pupae were allowed to eclose over the 2 h period only, 
pupae were allowed to eclose over a 12 h period and the females were collected at 12 24, 36, 48, 
60, and 72 h time points after eclosion. Overall, the depths of sequencing for the sample time 
points ranged from 26 to 51 million paired-end reads (Table 6.1) and after mapping the reads to 
the Cx. quinquefasciatus genome, the genes that were identified as expressed (i.e.: those genes 
having an FPKM (fragments per kilo base of gene length per million reads mapped) >1 (Gan et 
al., 2010)), were divided among the Structural Classification Of Proteins (SCOP) general 
function categories of metabolism, regulation, extra-cellular processes, intra-cellular processes, 
information, general, other, and no annotation (Murzin et al., 1995, Andreeva et al., 2004, Vogel 
et al, 2004, Vogel et al., 2005).  
 
Table 6.1. Number of paired end reads from the Illumina HiSeq sequencing and the percentage 
of reads mapped to the Cx. quinquefasciatus (strain: Johannesburg) predicted transcriptome. 
Sampling 
time 
point 
Total paired end 
reads? 
Paired end reads 
discarded? 
Paired end reads used for mapping to 
the Cx. quinquefasciatus genome 
(JHB v1.2) 
2 h 39890830 2950518 36940312 
12 h 36030651 2405121 33625530 
24 h 41173012 2979773 38193239 
36 h 35519459 1894955 33624504 
48 h 34587710 1909928 32677782 
60 h 27128981 1276065 25852916 
72 h 54895903 3819301 51076602 
?Total number of FASTQ (DNA sequence with quality scores) reads passing the Illumina quality 
filter. 
?Number of reads discarded after adapter clipping. 
 
When the expressed genes were pooled into their respective SCOP general function categories 
and their FPKM gene expression values were summed to estimate the total proportion of gene 
110 
 
expression within each of the SCOP general function categories, the pattern revealed that there 
was an overall decrease in total gene expression among the ?No annotation? and the ?General? 
SCOP general function categories occurring from 2 to the 12 h post-eclosion time points, with a 
respective increase in total gene expression for the categories of ?regulation? and ?other? for the 
12 h time point (Fig. 6.2). Beyond the 12 h post-eclosion time point, the total cumulative gene 
expression profiles within each of the SCOP general function categories were similar up to, 72 h 
post-eclosion time point (Fig.6.2). These results suggested that the major global changes in gene 
expression for adult female Cx. quinquefasciatus (prior to the taking of a blood meal) occur 
during the initial 12 h post-eclosion.  
 
Figure 6.2. Total gene expression within the Structural Classification of Proteins (SCOP) general 
function categories for adult sugar-fed female Culex quinquefasciatus, strain HAmCqG8, for the 
initial 72 h post-eclosion. Gene expression values expressed are summed within each SCOP 
category to provide an overall profile of the complete distribution of all gene expression within 
the mosquitoes. 
To further identify candidate genes that may be involved in preparing the female for the taking of 
111 
 
a blood meal, we investigated the genes that were differentially-expressed throughout the time 
course investigated. Overall, the majority of the genes that tested as differentially up- or down-
regulated occurred between the 2 and 12 h post-eclosion time period, which peaked at 12 h, after 
which, the number of genes that were differentially-expressed decreased (Fig. 6.3). Roughly one-
third of the differentially-expressed genes identified (101 genes from a total of 325) had no 
functional annotation in Vectorbase, while the remaining genes had predicted functions 
(Appendix 6.2). At 12 h post-eclosion, the greatest numbers of differentially-expressed genes 
was observed with 159 genes being up-regulated, and 74 down-regulated (Fig. 6.2).  
Figure 6.3. Distribution of genes tested as differentially-expressed for adult sugar-fed female 
Culex quinquefasciatus, strain HAmCqG8, for the initial 72 h post-eclosion period.  
 
Among the up-regulated genes were 32 salivary proteins and two apyrases, which may be 
112 
 
involved in the prevention of platelet clotting during blood feeding (Smith et al., 2002), 10 
cytochrome P450s (CPIJ005952 , CPIJ011837 , CPIJ010225 , CPIJ010227 , CPIJ000294 , 
CPIJ019586 , CPIJ019587 , CPIJ020018 , CPIJ012470, CPIJ010546 ), which were distributed 
among families CYP4, CYP6, CYP9, and CYP325, 20 proteases, and also genes involved in 
embryogenesis including wnt inhibitors and oskar (Chang et al., 2011, Jaglarz et al., 2011). 
Among the genes down-regulated at 12 h post-eclosion were 27 hypothetical proteins, 11 cuticle 
proteins and five cytochrome P450 genes (CPIJ011841, CPIJ011840, CPIJ015954, CPIJ015961, 
and CPIJ015960), which were all in family CYP325. At 24 h post-eclosion, fewer genes were 
identified as differentially-expressed (27 up-regulated; 51 down-regulated). Among the up-
regulated genes at 24 h post-eclosion were nine proteases and one olfactory receptor 
(CPIJ008023), which may be involved in preparation for the blood meal and host seeking, 
respectively. Among the down-regulated genes at 24 h post-eclosion were 32 hypothetical 
proteins, and six cuticle proteins, which may be involved in the transition from the pharate to the 
adult.   
While the majority of differential gene expression was observed in the earlier time points, 
there were a few genes that were up-regulated at 48 and 60 h with a total of 18, 12, 10, and five 
genes for the 36 h, 48 h, 60 h, and 72 h time points, respectively. Notably at 48 h post-eclosion, 
CPIJ006495, a hypothetical protein possessing a ChtBD2 chitin binding motif, which is found in 
insect peritrophin A (Letunic et al., 2012). In addition, at 60 h post-eclosion, multiple proteases 
were identified as up-regulated (CPIJ000990, CPIJ002595, CPIJ003539, and CPIJ007077) as 
well as ficolin-3, which has been linked to the humoral lectin immune defense response in 
mosquitoes (Dimopolous et al., 2002).  
In addition, with the exception of one hypothetical gene at the 48 h time point and the 10 
113 
 
genes up-regulated at the 60 h time point, all of the differentially-expressed genes beyond the 24 
h time point were down-regulated. Furthermore, when the gene expression values (FPKM) were 
considered, there was a sharp decrease in the gene expression values of differentially-expressed 
genes beyond the 36 h time point, with the highest FPKM value of 60 being attributed to a 
hypothetical gene, CPIJ015506 (Table S2). Taken together, these results suggest that the majority 
of the genes that are up-regulated in preparation of the female Cx. quinquefasciatus for the taking 
of their first blood meal are up-regulated within the first 24 h post-eclosion, while a few 
additional genes involved in blood meal taking may be up-regulated at 48 ? 60 h post-eclosion. 
Recent work by Clifton and Noriega (2012) identified that nutritional status in the mosquito 
Aedes aegypti influences the expression of key vitellogenesis-related transcripts, these were: the 
ribosomal 60S protein rpL32, the lipophorin receptor AaLpRov, the vitellogenin receptor 
AaVgR, and heavy-chain clathrin (AaCHC). In our study, we identified a similar trend for these 
genes in Cx. quinquefasciatus and found that the lipophorin receptor (CPIJ018375), the 60S 
protein rpL32 (CPIJ001220), the pro-epidermal growth factor gene (putative vitellogenin 
receptor) (CPIJ020278), and heavy-chain clathrin (CPIJ014882) all gradually increased in 
expression over time, with the predicted genes heavy-chain clathrin and the putative vitellogenin 
receptor continuously increasing from 2 to 72 h post-eclosion (Table 6.2), which follows the data 
previously reported by Clifton and Noriega (2012). 
 
 
 
 
Table 6.2. Expression levels of genes in Culex quinquefasciatus, strain HAmCqG8 for genes 
previously identified as up-regulated in non-blood-fed female Aedes aegypti and linked to 
114 
 
nutritional status with regard to blood-feeding competency. 
  Expression level (FPKM? at time point post-
eclosion (h) 
Gene 
number 
Predicted function? 2 12 24 36 48 60 72 
CPIJ001220 60S ribosomal protein L32  1100 1400 2200 3330 3600 4600 2900 
CPIJ014882 clathrin heavy chain  100 126 154 160 200 150 210 
CPIJ018375 lipophorin receptor  7 20 25 35 37 33 30 
CPIJ020278* pro-epidermal growth 
factor 
3 12 93 130 190 200 240 
?Fragments mapped Per Kilo bases of reference sequence for every Million fragments sequenced 
?Predicted function from Vectorbase, v. 1.2. https://www.vectorbase.org/organisms/culex-
quinquefasciatus 
*Putative vitellogenin receptor based on closest blastx match to Anopheles gambiae  
 
 
6.4.3 Validation of selected RNA Seq genes using qPCR.  
In order to estimate the accuracy of our RNA Seq results, and to determine the expression of 
selected genes throughout the pre blood-feeding and into the post blood-feeding time periods of 
Cx. quinquefasciatus, we selected a total of 36 genes that were predicted by the RNA Seq data to 
show the differential expression during the 72 h post-eclosion time period (Fig. 6.4). Among the 
genes selected were genes putatively involved in host finding or blood feeding behavior 
(odorant-binding proteins, period circadian protein), genes putatively involved in the maturation 
of the pharate female to the adult (cuticular proteins), genes putatively involved in the taking of 
the blood meal (salivary proteins), genes putatively involved in the digestion of the blood meal 
(trypsins, collagenase, lipases, uricase), genes predicted to be involved in the provisioning of 
nutrients to the egg (vitellogenins, adipophilin/perilipin), genes involved in embryogenesis (wnt 
inhibitor, oskar) as well as genes for proteins with other functions including: cytochrome P450s, 
calbindin, and oxidoreductase.  
 
115 
 
Figure 6.4. Heat map displaying the relative increases in gene expression for selected genes for 
the initial 72 h post-eclosion for adult female Cx. quinquefasciatus, strain HAmCqG8, and for 72 
h post blood meal. Females offered a blood meal were 6 days old at the time of the blood 
feeding. 
 
The expression of these 36 genes was investigated from 2 to 72 h post-eclosion using qPCR. In 
addition, we further investigated their gene expression after blood feeding from 2 h post blood-
feeding until 72 h post blood-feeding. The results showed that among the genes that were 
predicted to decrease or to increase and then decrease were genes putatively involved in 
preparation for the blood meal, or possibly host seeking (Fig. 5 upper panels). The general 
odorant-binding proteins (CPIJ01716, CPIJ01719, CPIJ012721) had their highest expression at 
2h post-eclosion and had a slight increase from the lowest expression values from 48h to 72h 
post blood-feeding. This indicated that females initially expressed the odorant-binding proteins to 
aid for food searching (sugar or blood) and also after the blood meal, possibly for aiding in the 
116 
 
identification of suitable oviposition sites. Other genes of interest were the salivary genes 
(CPIJ002046 and CPIJ019052) which reached maximal gene expression values at 24h and 48h, 
respectively, and then remained at low expression levels afterwards (Fig. 6.4).  
Among the genes that were predicted to be up-regulated throughout the post-eclosion and 
pre-blooding time period, the vitellogenin genes CPIJ001357/CPIJ001358 reached maximal gene 
expression at 60h post blood-feeding, while the vitellogenin genes CPIJ010190/CPIJ010191 and 
CPIJ005473 reached maximal expression at 20h post blood-feeding (Fig. 6.4). The major 
vitellogenin gene in Ae. aegypti has been shown to reach maximal expression at 24h post blood-
feeding, which is consistent with our findings for CPIJ010190/CPIJ010191, but not for 
CPIJ001357/CPIJ001358, suggesting that vitellogenesis is a slower process in Cx. 
quniquefasciatus than in Ae. aegypti. Following the blood meal, two trypsins (CPIJ007079, 
CPIJ004660) and one chymotrypsin (CPIJ003915) were up-regulated (Fig. 6.4). Trypsin 
CPIJ007079 was up-regulated immediately following blood feeding, while trypsin CPIJ004660 
and chymotrypsin CPIJ003915 were up-regulated at 48h and 60h post blood-feeding, 
respectively. These proteases are likely involved in the digestion of the blood meal, with the first 
gene representing early trypsin, and the later two representing late trypsins. The uricase gene 
CPIJ003456 reached a maximal expression at 20 h post blood-feeding and decreased by 60 h 
post blood-feeding, suggesting that uricase may be primarily involved in ammonia metabolism as 
related to the processing of the blood meal (Isoe and Scaraffia, 2013).  
We then further selected all of the predicted vitellogenin genes to identify the post-blood 
meal time point at which vitellogenin expression would reach a maximum. Since 10 genes were 
predicted to be vitellogenins by the Vectorbase functional annotation for the Johannesburg strain 
of Cx. quinquefasciatus, with three sets of two each of the genes having nearly identical 
117 
 
sequence, we designed a total of seven qPCR primers to determine which vitellogenins were the 
most likely to be involved in egg provisioning in Cx. quinquefasciatus, and when they reached 
maximal expression. In addition, since we were interested in understanding if the genes 
identified as differentially-expressed in pre blood-fed Cx. quinquefasciatus were involed post 
blood-feeding, we first characterized when vitellogenin expression was at a maximum in blood-
fed Cx. quinquefasciatus (Fig. 6.5). 
 
 
Figure 6.5. Temporal gene expression of vitellogenin genes in adult female Cx. quinquefasciatus 
for the 72 h time period immediately following eclosion and for the 72 h time period 
immediately following the blood meal. 
 
 
 
118 
 
To accomplish this, we selected six of the 10 predicted vitellogenin genes in Cx. 
quinquefasciatus. In order to identify which genes were involved in vitellogenesis, we initially 
investigated the expression profiles of the vitellogenins in female Cx. quinquefasciatus. Overall, 
we identified that the vitellogenins, CPIJ001357/CPIJ001358 were the highest expressed of the 
predicted vitellogenin genes, with more than two logs higher fold gene expression than the next 
highest expressed vitellogenin genes CPIJ010190/CPIJ010191 (Fig. 6.5). In addition, we found 
that these two pairs of vitellogenin genes were up-regulated 12 h post blood-feeding and 
continued to increase, reaching a maximal expression value at 36 h post blood-feeding.  
 
6.5 Discussion 
 Males of Cx. quinquefasciatus have been shown to need a minimum of 24 h of post-
eclosion development in order to mate, with mating reaching a maximum by 72 h (Williams and 
Patterson, 1969). In our study, the 72 h post-eclosion time points indicated the mean age for 
females to become competent to take a blood meal, reaching a maximum by 96 h. This may 
indicate that a male accessory gland factor transferred from the male during mating is necessary 
in order to induce the female to take a blood meal (Craig, 1967). Recently, egg development in 
Anopheles gambiae has been demonstrated to be controlled, in part, by exogenous ecdysone 
transferred to the females from the male accessory gland secretions following mating (Baldini et 
al., 2013). The contribution of the ecdysone was found to be a strong inducer of the mating-
induced stimulator of oogenesis (miso) gene (AGAP002620) (Holt et al., 2012; Baldini et al., 
2013), however in Cx. quinquefasciatus, the two closest homologs of miso, CPIJ018252 and 
CPIJ006083 were found to have low expression throughout the first 72 h post-eclosion time 
period, having their highest expression at 2 h post-eclosion (FPKM = 2 and 3, respectively) 
119 
 
(GEO: #GSE51327). In addition, Baldini et al. (2013) found that ecdysone was not present in the 
male accessory glands of Ae. aegypti or Anopheles albimanus. Taken together, this suggested that 
the role of the male accessory gland factors with respect to mating, egg development, and female 
blood meal competency differ among the various mosquito species. Since mating would have 
occurred after 24 h post-eclosion (Williams and Patterson, 1969), any genes that might be up-
regulated in response to mating should be up-regulated in the time points >24 h post-eclosion. 
Genes up-regulated at the 48 and 60 h time points were related to chitin binding, proteases, and a 
ficolin. These genes may be involved in the preparation of the peritrophic matrix for the taking of 
the blood meal and for providing immunity to pathogens that may be contained within the blood. 
The up-regulation of these genes at 48 - 60 h may be necessary to prepare the female for the 
taking of a blood meal, possibly up-regulated in response to mating.  
 In addition to the genes up-regulated at 48 - 60 h, the differentially expressed genes from 
the 2 to 24 h time points are also likely involved in preparing the female for blood feeding since 
several of these genes could be attributed to genes that aid in the feeding and digestion of the 
blood meal, such as trypsins, apyrase, and salivary proteins (Barillas-Mury, 1995, Chamopagne 
et al., 1995, Sim et al., 2012), while genes having functions related to continued development 
after eclosion, such as cuticle structure were down-regulated (Riehle et al., 2002).  
 The previously un-characterized genes that changed their expression levels over time in our 
study represent novel genes for the investigation of the genetic events that occur prior to blood-
meal acquisition in Cx. quinquefasciatus. Our finding that heavy-chain clathrin in Cx. 
quinquefasciatus was expressed throughout the entire post-eclosion time period, is likely 
involved with aiding in the provisioning of the egg with vitellogenins. Clathrin is involved in 
multiple endocytotic processes, thus the expression of heavy-chain clathrin throughout the entire 
120 
 
post-eclosion time period was expected (Clifton and Noriega, 2012). In contrast, the putative 
vitellogenin receptor, CPIJ020278 had low expression until 24h post-eclosion, suggesting that 
the putative vitellogenin receptor gene is developmentally regulated during the adult stage and is 
switched on prior to the time period when the females freely take an offered blood meal. The 
increase in gene expression for the vitellogenin receptor at 24 h is consistent with observations of 
egg provisioning in an autogenous strain of Cx. quinquefasciatus, where 1-day-old females have 
been shown to be capable of provisioning their eggs in the absence of a blood meal if they were 
exposed to the ecdysone agonist tebufenozide in the immature stages (Gelbi? and Rozsypalov?, 
2012). This demonstrates that 24 h old Cx. quinquefasciatus females are capable of vitellogenesis 
if provided with the appropriate hormonal stimulation (Gelbi? and Rozsypalov?, 2012). 
Vitellogenesis and successful completion of egg formation in mosquitoes, however, requires not 
only ecdysone, but specific amino acids, juvenile hormone, and the activation of various 
signaling pathways and miRNAs as well (Hansen et al., 2004, Hansen et al, 2005, Shiao et al., 
2008, Bryant et al., 2010, Gulia-Nuss et al., 2011). Vitellogenesis has also been shown to 
terminate, resulting in the re-absorption of vitellins, if the nutritional status of Ae. aegypti is not 
sufficient for complete egg maturation (Clifton and Noriega, 2012). Therefore since female Cx. 
quinquefasciatus are capable of vitellogenesis as early as 24 h post-eclosion (Gelbi? and 
Rozsypalov?, 2012), but do not freely take a blood meal until at least 48 - 96 h post-eclosion, the 
genes that were identified as up-regulated at 48 and 60 h may be essential for the taking and 
processing of the blood meal, but not vitellogenesis. Furthermore, the up-regulation of these 
genes may be in response to mating, which begins at 24 h post-eclosion in Cx. quinquefasciatus 
(Williams and Patterson, 1969). 
121 
 
 Overall, our study found that the genes identified in the post-eclosion, but pre-blood-
meal-taking time period represent genes that may be necessary for the female to freely take a 
blood meal. We further identified that it was possible to induce vitellogenesis and egg 
provisioning in Cx. quinquefasciatus prior to the age, at which, mosquitoes would freely take a 
blood meal, and further identified that the induction of vitellogenesis was independent of mating 
status, however none of the vitellogenesis-induced females were capable of laying eggs. Our 
study suggested that in Cx. quinquefasciatus, there is likely a complex of factors necessary to 
prepare the female for the taking of a blood meal that include not only the control of 
vitellogenesis, but the processing of the blood meal and preparation of the female for egg 
development and oviposition as well. 
 
 
6.6 Acknowledgements 
The authors are grateful to Drs. Peter W. Atkinson, Peter Arensburger and the Culex 
quinquefasciatus genome community for the efforts they have devoted to determining the 
genome sequence and making the information available in VectorBase. We would also like to 
thank the Hudson Alpha Institute of Biotechnology for their expertise in conducting the RNA 
sequencing work and for all of their help and support with this study. 
 
 
 
  
122 
 
Chapter 7: Research Summary and Future Studies 
 
7.1 Research Summary 
 In this project, we used RNA-Seq to investigate the transcriptome-wide gene expression 
profiles of the fourth instar stage of a highly permethrin-resistant strain of Culex 
quinquefasciatus HAmCqG8 and its parental low permethrin-resistant strain HAmCqG0. Overall, 
we identified 367 differentially up-regulated genes in the HAmCqG8 strain, namely cytochrome 
P450 genes and proteases. We further utilized qRT-PCR to validate the RNA-Seq results and 
confirmed the up-regulation of 14 cytochrome P450 genes in the HAmCqG8 strain as well as 14 
proteases that had >2-fold up-regulation. Among the up-regulated proteases, one gene, nephrosin 
CPIJ009594, was more than 100 times over-expressed when tested using qRT-PCR validation. 
We proposed that the proteases that are differentially-expressed between the HAmCqG0 and 
HAmCqG8 strains may be involved in the signaling response that controls insecticide resistance 
in Cx. quinquefasciatus. We then investigated the genes that were up-regulated in the fourth 
instar stage of the HAmCqG8 strain following a 24 h chronic exposure to permethrin at the LC50 
and LC70 rates, and identified 224 and 146 genes that were up- and down-regulated solely in 
response to permethrin, respectively. Following Gene Ontology (GO) enrichment of the 
differentially-expressed genes, the GO terms that were statistically enriched among the up-
regulated genes included those GO terms associated with cytochrome P450 activities and 
immune response. Further investigation among the up-regulated genes showed that the up-
regulated immune genes were genes that are controlled by the Toll pathway. Among the GO 
terms that were functionally-enriched among the down-regulated genes, the majority related to 
protease activity and carbohydrate metabolic process. Among the down-regulated genes 
123 
 
associated with carbohydrate metabolic process were immune genes involved in the IMD 
pathway, suggesting that the immune pathways that were active in permethrin and control treated 
Cx. quinquefasciatus differed. We further investigated the larval serum storage proteins as well 
as selected proteases that had been previously identified as up-regulated in HAmCqG8 in our 
earlier study in order to 1) determine if exposure to permethrin resulted in a decrease in serum 
protein expression, which could represent a developmental delay, and 2) investigate the 
connection of proteases that are up-regulated in the HAmCqG8 strain to see if they may be 
involved in the signaling response in permethrin resistance. Our results showed that during 
exposure to permethrin all larval storage proteins decreased in expression, suggesting that larval 
Cx. quinquefasciatus delay development to the pupal form during chronic permethrin exposure, 
possibly due to a redirection of the insect's metabolic processes to detoxification as demonstrated 
by the functional enrichment of GO terms associated with cytochrome P450 activities. We also 
identified that nephrosin, CPIJ009594 was induced during permethrin exposure, and further 
identified that the induction of nephrosin was significantly higher in the HAmCqG8 strain than 
when compared to the insecticide-susceptible S-lab strain and also higher than in the HAmCqG0 
strain (Chapter 3). We proposed that upon exposure to permethrin, insecticide resistant Cx. 
quinquefasciatus cease feeding to reduce oral exposure to the toxicant as a means of behavioral 
resistance. It is possible that insecticide resistant Cx. quinquefasciatus are capable of better-
sensing the permethrin exposure and cease feeding to reduce the oral exposure to the insecticide, 
and that through the cessation of feeding, the TOR pathway is turned off, resulting in a loss of 
repression of the Toll pathway. The rapid response to cease feeding by the HAmCqG8 strain 
would represent an example of behavioral resistance to permethrin oral exposure. We then 
diverged from Cx. quinquefasciatus, to investigate the cytochrome P450s up-regulated in a 
124 
 
permethrin-resistant strain of Aedes aegypti in order to expand the knowledge-base of known 
cytochrome P450s involved in permethrin resistance in mosquitoes. Through a combination of 
qRT-PCR and transgenic Drosophila melanogaster enhancer-trap techniques, we confirmed the 
up-regulation of several cytochrome P450s identified in previous studies on insecticide 
resistance in Ae. aegypti, and further demonstrated that AAEL007815 (CYP4D24) and 
AAEL13556 (CYP4J15v1) were functionally capable of degrading permethrin. Finally, we 
investigated gene expression changes in Cx. quinquefasciatus using RNA-Seq throughout the 
period of time immediately post-eclosion up to the time when females freely took a blood meal. 
We found that while females would not freely take a blood meal prior to 48-72 h post-eclosion, 
the predominance of the changes in gene expression occurred within the first 24 h post-eclosion, 
which coincided with the onset of egg provisioning in autogenous Cx. quinquefasciatus. This 
suggested that the physiological requirements of the female for host seeking and blood meal 
acquisition are independent of vitellogenesis. We further identified that the VitA gene 
(CPIJ001357/CPIJ001358) is the predominant vitellogenin gene in Cx. quinquefasciatus. In 
conclusion, our project proposes a novel model of behavioral resistance in Cx. quinquefasciatus, 
possibly mediated by the protease nephrosin, identified the functional capacity of two 
cytochrome P450s in Ae. aegypti to degrade pyrethroids, and elucidated the gene expression 
profiles of Cx. quinquefasciatus throughout the early part of the adult stage. 
 
 
 
7.2 Edsysteroid UDP-glucosyltransferase in Culex quinquefasciatus as a novel target for 
mosquito management 
125 
 
The predicted genome of Cx. quinquefasciatus possesses two genes that are predicted to be 
ecdysteroid UDP-glucosyltransferases, CPIJ003694 and CPIJ016641. The latter gene, 
CPIJ016641 was found to have no expression in adult female Cx. quinquefasciatus during any 
pre-blooding or post-blooding stage, while CPIJ003694 was identified to be induced at 36 h 
post-blooding, which preceded the maximal expression of E74 by 24 h (Fig. 7.1). 
Figure 7.1 Temporal expression of the ecdysone-inducible gene E74 and the ecdysteroid 
glucosyltransferase gene CPIJ003694. 
 
The gene E74 is inducible by ecdysone and required for the initiation of vitellogenesis in 
mosquitoes (Guoqiang et al., 2002), thus the expression of E74 at 60 h post-blood meal suggests 
that there is a second burst of ecdysone, as is found in Ae. aegypti and other insects as well 
(Shirk et al., 1990), which has been proposed to be necessary for proper egg development. Thus, 
mosquitoes use ecdysone for both the initiation, and the maturation of eggs at different intervals. 
The observed increase in egt expression at 36 h (Fig. 7.1) suggests that there is a need for the 
mosquito to regulate the activity of ecdysone, likely through glucosylation, which has been 
126 
 
shown to inactivate the activity of 20-hydroxyecdysone in Mamestra brassicae  (Clarke et al., 
1996). Since ecdysone is likely necessary for proper egg maturation, it is also likely that egt is 
expressed in a tissue-specific fashion in order to protect specific mosquito tissues from the 
effects of ecdysone. Disruption of the role of egt could be a novel means of mosquito control. 
Future work to investigate the role of egt would be to conduct topical application of ecdysone 
agonists that cannot be glucosylated by egt. The maximal non-toxic rates for both tebufenozide, 
and methoxyfenozide have already been determined in Chapter 5, and along with application of 
20-hydroxyecdysone as a control, the effect of egt could be estimated. That is, the activity of egt 
should be able to negate the effects of externally-applied 20-hydroxyecdysone, but not those of 
the ecdysone agonists. The measureable outcomes for this work would be adult survival, the 
numbers of eggs laid, the numbers of viable larvae, as well as the possible use of RNA-Seq to 
investigate unexpected changes in gene expression profiles. Further confirmation of the role of 
egt could be conducted using RNAi. 
 
7.3 Use of VitA gene as a screening tool for bisacylhydrazines against mosquitoes 
 Non-steroidal ecdysone agonists have been developed for the control of Lepidopteran and 
Coleopteran pests, leading to the potential of these chemicals for the effective control of disease-
vectoring insects, including mosquitoes (Smagghe et al., 2001; Retnakaran et al., 2003; Beckage 
et al., 2004). In Chapter 6, we found that the expression of the vitA gene (CPIJ001357 / 
CPIJ001358) was highly up-regulated (>10,000-fold) following a blood meal compared to the 
vitA gene expression in females that were not given a blood meal. Similar up-regulation patterns 
of vitA expression occurred in non-blood-fed females when these mosquitoes were treated with 
the ecdysone agonists, tebufenozide and methoxyfenozide, and we further found that the dose 
127 
 
required for induction of vitA expression was lower for methoxyfenozide compared with 
tebufenozide, suggesting a more specific effect of methoxyfenozide in Cx. quinquefasciatus (Fig. 
7.2). 
Figure 7.2. Dose-dependent effect of ecdysone agonists on the gene expression of the VitA gene 
(CPIJ001357 / CPIJ001358) against adult female Cx. quinquefasciatus. 
 
Beckage et al. (2004) found that among three mosquito species, methoxyfenozide was more 
active than tebufenozide, suggesting that there may be a correlation between the larvicidal 
activity of ecdysone agonists and their ability to induce VitA expression. In this case, the level of 
VitA gene expression could be used as an indicator of the biological activity of ecdysone 
agonists. Such a system would be advantageous in a large-scale chemical screening program 
because only a few nanomols of test material would initially be needed to determine biological 
activity. In addition, the finding that topical treatment with tebufenozide and methoxyfenozide 
resulted in egg provisioning in Cx. quinquefasciatus would provide an efficient initial screen 
whereby mosquitoes need only be dissected at 48 h post application to determine activity. 
128 
 
Subsequent studies, however, would need to be conducted to optimize a chemical screening 
system, including characterizing the percentage of false negatives due to insufficient chemical 
absorption or females possibly incapable of vitellogenesis.  
 
7.4 Determination of gene copy number in the highly pyrethroid-resistant HAmCqG8 strain 
of Cx. quinquefasciatus 
In addition to testing the gene expression profiles in Chapter 3, we also investigated the SNPs 
that differed between the HAmCqG0 and HAmCqG8 strains. For this, we first mapped all of the 
RNA-Seq reads to the reference genome for Cx. quinquefasciatus, which is the Johannesberg 
strain (Arensburger et al., 2010). This was done so that the RNA-Seq reads could be overlapped 
to a reference genome, allowing for positions with different nucleotides to be determined and 
SNPs to be called (Neilsen et al., 2011). However since we were interested only in SNPs that 
differed between the HAmCqG0 and the HAmCqG8 strain, and not SNPs between the HAmCqG8 
strain and the Johannesberg strain, we further sorted all of the identified SNPs, and retained only 
the SNPs that were different between the HAmCqG0 and HAmCqG8 strains. A minimum coverage 
of 20 reads for each SNP (Neilsen et al., 2011) was required for both the HAmCqG0 and 
HAmCqG8 strains in order to determine the SNPs in the HAmCqG8 strain,. which ensured that the 
SNPs called in the HAmCqG8 strain were different between the permethrin-selected HAmCqG8 
strain and its parental HAmCqG0 strain. In total, >130,000 SNPs were determined between the 
HAmCqG0 and HAmCqG8 strains (Table 7.1). More than 85% of the SNPs identified (112,112 
SNPs) were synonymous SNPs, suggesting that the majority of the SNPs between the HAmCqG0 
and HAmCqG8 strains do not result in a change to the amino acid sequence of the proteins. 
Among all SNPs determined, ~58% (75,229 SNPs) of them were homozygous SNPs and ~42% 
129 
 
were heterozygous (Table 7.1), indicating the more than half of total SNPs had gone to fixation, 
that is, they were completely selected within the HAmCqG8 population (Barreiro et al., 2003). 
 
Table 7.1. Single nucleotide polymorphisms in the pyrethroid-resistant strain of Cx. 
quinquefasciatus, HAmCqG8, compared to the parental reference strain HAmCqG0. 
Region? Total SNPs Homozygous Heterozygous 
synonymous SNPs 112112 64252 47860 
non-synonymous SNPs 17732 10412 7320 
splice site donor 273 234 39 
splice site acceptor 305 245 60 
synonymous stop 57 38 19 
TOTAL 130479 75181 55298 
? As defined for the gene coding regions for the Cx. quinquefasciatus Johannesberg strain v1.3 
Vectorbase, www.vectorbase.org 
 
Other SNPs within the HAmCqG8 strain included the addition of 273 predicted splice site donors 
and 305 splice site acceptors, suggesting that alternative splicing could also play a role in the 
regulation of the up-regulated genes in the HAmCqG8 (Table 7.1). In addition, a total of 57 
synonymous stop SNPs were identified in the HAmCqG8 strain, which are not predicted to result 
in any change to protein function (Table 7.1). To pinpoint the possible importance of the SNPs in 
insecticide resistance, we investigated the SNPs that were present in the up-regulated genes of 
the pyrethroid-resistant HAmCqG8 strain identified in Chapter 3. Among the up-regulated genes 
in HAmCqG8, 132 of them contained SNPs, with a total of 1010 SNPs among the genes (Table 
7.2). The number of SNPs per gene were compared among their Structural Classification of 
Proteins (SCOP) functional categories, which showed that the genes containing SNPs were 
present in the categories of extracellular processes, general, intracellular processes, metabolism, 
regulation, and no annotation (Fig. 7.3). 
Table 7.2. List of genes containing SNPs/indels in the HAmCqG8 strain of Cx. quinquefasciatus 
when compared to the HAmCqG0 strain for genes shown to be up-regulated in the HAmCqG8 
strain. 
Sequence SCOP?  general SCOP?  detailed   
130 
 
variant function function Gene function Gene number? 
Insertion General Small molecule 
binding 
glutathione S-transferase CPIJ006160 
 Metabolism Other enzymes AMP dependent CoA ligase CPIJ000791 
   fumarylacetoacetate hydrolase CPIJ017110 
 Intra-cellular 
processes 
Proteases serpin B6 CPIJ014719 
 Metabolism Redox short chain type dehydrogenase CPIJ005656 
Deletion General Small molecule 
binding 
glutathione S-transferase CPIJ006160, CPIJ002663 
  General sarcoplasmic calcium-binding protein CPIJ001560 
SNP Extra-cellular 
processes 
Blood clotting ficolin-1 precursor CPIJ012830 
  Cell adhesion cadherin CPIJ014101 
 General General asporin precursor CPIJ017510 
   sarcoplasmic calcium-binding protein CPIJ001560 
   troponin C, isoform CPIJ012250, CPIJ016821 
  Protein 
interaction 
TPR repeat-containing protein 
T20B12.1 
CPIJ007346 
  Small molecule 
binding 
D-2-hydroxyglutarate dehydrogenase CPIJ001318 
   glucose oxidase CPIJ007620 
   glutathione S-transferase  CPIJ002663, CPIJ006160 
   multidrug resistance-associated protein CPIJ001520 
   myosin heavy chain, striated muscle CPIJ000853 
   NADP-dependent leukotriene B4 12-
hydroxydehydrogenase 
CPIJ003802 
 Intra-cellular 
processes 
Phospholipid 
m/tr* 
alpha-tocopherol transfer protein CPIJ009746 
   cathepsin B precursor CPIJ001239, CPIJ001240 
  Proteases carboxypeptidase A1 precursor CPIJ010805 
   chymotrypsin-1 CPIJ006543, CPIJ002135, 
CPIJ002137 
   collagenase precursor CPIJ002142, CPIJ016012 
   fxna CPIJ009738, CPIJ014110 
   peptidase family CPIJ801477 
   prolylcarboxypeptidase CPIJ008873 
   serine proteases 1/2 precursor CPIJ002139 
   serpin B6 CPIJ014719 
   transmembrane protease, serine CPIJ001111 
   trypsin-3 precursor CPIJ019428 
   zinc carboxypeptidase     CPIJ801679, CPIJ801680, 
CPIJ801685, CPIJ801686 
  Transport 5'-nucleotidase, C-terminal     CPIJ800110 
   ammonium transporter CPIJ013531 
   blastula protease 10 precursor CPIJ002943 
   zinc metalloproteinase CPIJ002941, CPIJ002942, 
131 
 
CPIJ019029 
 Metabolism Carbohydrate 
m/tr 
1, 4-alpha-glucan-branching enzyme CPIJ006166 
   alpha-amylase A precursor CPIJ005725, CPIJ005060 
   maltose phosphorylase CPIJ008853 
  Energy and E- 
transfer 
acyl-coenzyme A oxidase 1, 
peroxisomal 
CPIJ003059 
   cytochrome b5 CPIJ004595 
   vacuolar ATP synthase subunit C CPIJ002067 
  Lipid m/tr lipoprotein amino region CPIJ801684 
  Other enzymes AMP dependent CoA ligase CPIJ000791, CPIJ006459 
   chitinase class  CPIJ800112 
   esterase B1  CPIJ007824, CPIJ016336 
   fumarylacetoacetate hydrolase domain-
containing protein 
CPIJ017110 
   luciferin 4-monooxygenase CPIJ010716, CPIJ015088 
   lysosomal pro-X carboxypeptidase CPIJ008876 
   phospholipase A1 member A precursor CPIJ004222 
   secreted chitinase CPIJ019598 
   selenium-binding protein 1-A CPIJ013577 
   WD-repeat protein CPIJ002052 
  Polysaccharide 
m/tr 
2-hydroxyacylsphingosine 1-beta-
galactosyltransferase 
CPIJ000226 
   UDP-glucuronosyltransferase 2B17 
precursor 
CPIJ006508  
  Redox basic juvenile hormone sensitive 
hemolymph protein 
CPIJ005187 
   cytochrome b561 domain-containing 
protein 
CPIJ010934 
   cytochrome P450 CPIJ800194 (CYP6AA7)**, 
CPIJ800196 (CYP6AA9), 
CPIJ800216 (CYP6BZ2), 
CPIJ800222 (CYP9J33), 
CPIJ800229 (CYP9J40), 
CPIJ800249 (CYP4D42v1), 
CPIJ800254 (CYP4H30), 
CPIJ800259 (CYP4H37v1), 
CPIJ015681 (CYP4H37v2), 
CPIJ020229 (CYP4D42v2) 
   hexamerin 1.1 precursor CPIJ000056, CPIJ006537, 
CPIJ006538, CPIJ018824, 
CPIJ018825 
   larval serum protein 2 precursor CPIJ001820 
   NADH dehydrogenase CPIJ018667 
   short chain type dehydrogenase CPIJ005656 
  Secondary 
metabolism 
beta-1, 3-glucan-binding protein 
precursor 
CPIJ004320, CPIJ004323 
   venom allergen 3 precursor CPIJ004029 
132 
 
  Transferases cystathionine gamma-lyase CPIJ006619 
 Regulation DNA-binding sterol regulatory element-binding 
protein 
CPIJ018167 
  Signal 
transduction 
Neuronal acetylcholine receptor 
subunit alpha-2 
CPIJ801870 
 NONA? not annotated acidic mammalian chitinase precursor CPIJ000008 
   actin, muscle A2 CPIJ012574 
   astacin precursor CPIJ013319 
   beta-galactosidase precursor CPIJ003338 
   cecropin-A precursor CPIJ010699 
   class VII unconventional myosin CPIJ000852 
   fibrinogen C domain-containing 
protein 
CPIJ005841 
   galactoside-binding lectin  CPIJ802228 
   leucine-rich transmembrane protein CPIJ006150, CPIJ004947, 
CPIJ006515 
   liver carboxylesterase 1 precursor CPIJ018231 
   low choriolytic enzyme precursor CPIJ010224 
   peroxisomal membrane protein 11C CPIJ009744 
   sarcalumenin precursor CPIJ013085 
   SITS-binding protein CPIJ008904 
   translocator protein CPIJ009683 
   conserved hypothetical protein CPIJ002103, CPIJ002117, 
CPIJ003223, CPIJ003485, 
CPIJ007785, CPIJ010305, 
CPIJ012702, CPIJ014226, 
CPIJ014892, CPIJ017149, 
CPIJ017150, CPIJ018791, 
CPIJ001427, CPIJ002070, 
CPIJ002744, CPIJ009034, 
CPIJ010757, CPIJ012287, 
CPIJ012899, CPIJ013195, 
CPIJ013296, CPIJ013736, 
CPIJ017076, CPIJ018002, 
CPIJ020308 
?Cx. quinquefasciatus Johannesberg strain v1.3 Vectorbase, www.vectorbase.org 
? SCOP general function categories annotated using the predicted Cx. quinquefasciatus annotation information 
available at the Superfamily website (version 1.75) supfam.cs.bris.ac.uk/SUPERFAMILY/index.html 
 
*m/tr= metabolism and transport 
**Annotation of Cytochrome P450s taken from: http://drnelson.ut.mem.edu/CytochromeP450.html 
?NONA= No Annotation 
 
Among the SCOP categories, the categories for no annotation, intracellular processes (including 
proteases) and metabolism (including detoxification enzymes such as cytochrome P450s) had the 
greatest numbers of genes that contained SNPs, with the majority of the SNPs in these 
133 
 
catergories being heterozygous (Fig. 7.3). The extracellular processes and regulation categories 
each contained two genes that had SNPs within their sequences (Table 7.2). A total of 12 genes 
in the general function category contained either heterozygous or homozygous SNPs, with one 
gene, CPIJ006160 - glutathione-S-transferase, containing both homozygous and heterozygous 
SNPs. Within the metabolism category genes including two esterases and 10 cytochrome P450 
genes contained both homozygous and heterozygous SNPs (Table 7.2). The median number of 
heterozygous SNPs per gene in metabolism category was six, which was twice the number of 
homozygous SNPs (Fig. 7.3).  
 In the remaining categories of intracellular processes and no annotation, a similar pattern 
of roughly twice as many heterozygous as homozygous SNPs per gene was identified, while the 
genes within the intracellular processes category were predominantly annotated as having 
proteolytic/peptiditic activities, which have been previously linked to insecticide resistance in 
insects as well as gene regulation and cell signaling (Pedra et al., 2004). Of particular interest 
was that among the up-regulated genes in the HAmCqG8 strain, one-third (132 of 367) contained 
SNPs, the majority of which were a combination of both heterozygous and homozygous SNPs. 
In addition, the majority of SNPs were synonymous, suggesting no change in function. As a 
result of the high correlation of both heterozygous and homozygous synonymous SNPs in the up-
regulated genes of HAmCqG8, and since we mapped to the genome of the Johannesburg strain, 
and not to the genome of HAmCqG0 or HAmCqG8, we propose that the high occurrence of SNPs 
in the HAmCqG8 up-regulated genes is due to the cross-mapping of genes duplicated in the 
134 
 
HmCqG8 strain, but not the HAmCqG0 strain. 
Figure 7.3. Distribution of SNPs and indels identified within the up-regulated genes in the 
pyrethroid-resistant HAmCqG8 strain of Cx. quinquefasciatus within the general function 
categories of the Structural Classification of Proteins (SCOP) datatbase. Individual points within 
category represent the actual number of SNPs/indels for a given gene, while the box-whisker 
plots represent the quartile values, where the internal black bar within each box represents the 
median value of SNPs/indels per gene within SCOP general function category. 
 
In order to test this, future work using copy number qRT-PCR (Solomon et al., 2008) on 
the DNA of the HAmCqG0, HAmCqG8, and insecticide susceptible S-lab strains would identify if 
gene duplication is responsible for the high occurrence of SNPs in the up-regulated genes of 
HAmCqG8 strain, and may, in part, explain their up-regulation. 
 
  
135 
 
7.4 References 
Abalis, I.M., Eldefrawi, M.E. and Eldefrawi, A.T. (1986) Effects of insecticides on GABA-
induced chloride influx into rat brain microsacs. J. Toxicol. Environ. Health 18:13-23. 
Ahmed, S., Wilkins, R.M. and Mantle, D. (1998) Comparison of proteolytic enzyme activities in 
adults of insecticide resistant and susceptible strains of the house fly M. domestica L. Insect 
Biochem. Mol. Biol. 28: 629-639. 
Allan, S. (2011) Susceptibility of adult mosquitoes to insecticides in aqueous sucrose baits. J. 
Vector Ecol. 36:59?67. 
Anders, S. and Huber, W. (2010) Differential expression analysis for sequence count data. 
Genome Biol. doi:10.1186/gb-2010-11-10-r106. 
Andreev, D., Kreitman, M., Phillips, T.H., Beeman, R., ffrench-Constant, R.H. (1999) Multiple 
origins of cyclodiene insecticide resistance in Tribolium castaneum (Coleoptera: 
Tenebrionidae). J. Mol. Evol. 48: 615-624. 
Andreeva, A., Howorth, D., Brenner, S.E., Hubbard, T.J., Chothia, C., et al. (2004) SCOP 
database in 2004: refinements integrate structure and sequence family data. Nucleic Acids 
Res. 32: D226-229.  
Andrews, M.C., Callaghan, A., Field, L.E., Williamson, M.S. and Moores, G.D. (2004) 
Identification of mutations conferring insecticide-insensitive AChE in the cotton-melon 
aphid, Aphis gossypii Glover, Insect Mol. Biol. 13:555?561. 
Arensburger, P., Megy, K., Waterhouse, R.M., Abrudan, J., Amedeo, P., et al. (2010) Sequencing 
of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. 
Science. 330: 86-88. 
Ashburner, M., Ball, C., Blake, J., Botstein, D., Butler, H., et al. (2009) Gene Ontology: tool for 
136 
 
the unification of biology. Nat. Genet. 25: 25-29. 
Ashburner, M., Golic, K.G. and Hawley, R.S. (2005) Drosophila: A Laboratory Handbook. NY: 
Cold Spring Harbor Laboratory Press, Woodbury, NY. 
Bahia, A.C., Kubota, M.S., Tempone, A.J., Ara?jo, H.R.C., Guedes, B.M., et al. (2011). The 
JAK-STAT pathway controls Plasmodium vivax load in early stages of Anopheles aquasalis 
infection. PLoS Negl. Trop. Dis. 5, e1317. doi:10.1371/journal.pntd.0001317. 
Baldini, F., Gabrieli, P., South, A., Valim, C., Mancini, F, et al. (2013) The interaction between a 
sexually transferred steroid hormone and a female protein regulates oogenesis in the malaria 
mosquito Anopheles gambiae. PLoS Biol. 11: e1001695. 
Bariami, V., Jones, C.M., Poupardin, R., Vontas, J. and Ranson, H. (2012) Gene Amplification, 
ABC Transporters and Cytochrome P450s: Unraveling the Molecular Basis of Pyrethroid 
Resistance in the Dengue Vector, Aedes aegypti. PLoS Negl. Trop. Dis. 6: e1692. 
doi:10.1371/journal.pntd.0001692. 
Barillas-Mury, C.V., Noriega, F.G. and Wells, M.A. (1995) Early trypsin activity is part of the 
signal transduction system that activates transcription of the late trypsin gene in the midgut of 
the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 25:241-246. 
Barreiro, L.B., Laval, G., Quach, H., Patin, E., and Quintana-Murci, L. (2003) Natural selection 
has driven population differentiation in modern humans. Nat. Genet. 40(3) 
doi:10.1038/ng.78. 
Bateman, J. R., Lee, A. M. and Wu, C. (2006) Site-specific transformation of Drosophila via 
phiC31 integrase-mediated cassette exchange. Genetics. 173:769?77. 
doi:10.1534/genetics.106.056945. 
Beckage, N.E., Marion, K.M., Walton, W.E., Wirth, M.C. and Tan, F.F. (2004). Comparative 
137 
 
Larvicidal Toxicities of Three Ecdysone Agonists on the Mosquitoes Aedes aegypti , Culex 
quinquefasciatus, and Anopheles gambiae, Arch. Insect Biochem. Physiol. 122:111?122. 
Benting, J. and Nauen, R. (2004) Biochemical evidence that an S431F mutation in 
acetylcholinesterase-1 of Aphis gossypii mediates resistance to pirimicarb and omethoate, 
Pest Manag. Sci. 60:1051?1055. 
Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J. et al. (2008) 
Accurate whole human genome sequencing using reversible terminator chemistry. Nature. 
456, 53?59  
Bischof, J., Maeda, R. K., Hediger, M., Karch, F. and Basler, K. (2007) An optimized 
transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Nat. 
Acad. Sci. USA. 104:3312-3317. doi:10.1073/pnas.0611511104. 
Blalock, E.M., Geddes, J.W., Chen, K.C., Porter, N.M. and Markesbery, W.R. (2004) Incipient 
Alzheimer?s disease: microarray correlation analysis reveal major transcriptional and tumor 
suppressor responses. Proc. Natl. Acad. Sci. USA 101: 2173-2178. 
Boonsuepsakul, S., Luepromchai, E. and Rongnoparut, P. (2008) Characterization of Anopheles 
minimus CYP6AA3 expressed in a recombinant baculovirus system. Arch. Insect Biochem. 
Physiol. 69:13-21. doi:10.1002/arch.20248. 
Boublik, Y., Saint-Aguet, P., Lougarre, A., Arnaud, M., Villatte, F., et al. (2002) 
Acetylcholinesterase engineering for detection of insecticide residues. Protein Eng. 15:43?
50. 
Boutet, I., Long K., C.L., and Bonhomme, F. (2006). A transcriptomic approach of salinity 
response in the euryhaline teleost, Dicentrarchus labrax. Gene. 379: 40-50. 
Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates 
138 
 
and generating dominant phenotypes. Development. 118:401-15. 
Brattsten, L.B., Holyoke, C.W., Leeper, J.R. and Raffa, K.F. (1986) Insecticide resistance: 
challenge to pest-management and basic research. Science. 231: 1255-1260. 
Broderick, N.A., Raffa, K.F. and Handelsman, J. (2006) Midgut bacteria required for Bacillus 
thuringiensis insecticidal activity. Proc. Natl. Acad. Sci. USA. 103:15196?15199.  
Bryant, B., Macdonald, W. and Raikhel, A.S. (2010) microRNA miR-275 is indispensable for 
blood digestion and egg development in the mosquito Aedes aegypti. Proc. Natl. Acad. Sci. 
USA. 107:22391-22398. 
Buckingham, S., Biggin, P., Sattelle, B., Brown, L. and Sattelle, D. (2005). Insect GABA 
receptors: splicing, editing, and targeting by antiparasitics and insecticides. Mol. Pharmacol. 
68: 942-51. 
Bull, D.L. and Whitten, C.J. (1972) Factors influencing organophosphorus insecticide resistance 
in tobacco budworms. J. Agric. Food Chem. 20: 561?564. 
Burysek, L., Syrovets, T. and Simmet, T. (2002) The serine protease plasmin triggers expression 
of MCP-1 and CD40 in human primary monocytes via activation of p38 MAPK and janus 
kinase (JAK)/STAT signaling pathways. J. Biol. Chem. 277: 33509-33517.  
Campbell, P.M., Newcomb, R.D., Russell, R.J. and Oakeshott, J.G. (1998) Two different amino 
acid substitutions in the ali-esterase, E3, confer alternative types of organophosphorus 
insecticide resistance in the sheep blowfly, Lucilia cuprina. Insect Biochem. Mol. Biol. 28:139-
50. 
Canard, B. and Sarfati, R. (1994) DNA polymerase fluorescent substrates with reversible 3?-tags. 
Gene 148, 1?6. 
Carino, F.A., Koener, J.F., Plapp, F.W. Jr. and Feyereisen, R. (1992) Expression of the 
139 
 
cytochrome P450 gene CYP6A1 in the housefly, Musca domestica. In Molecular 
Mechanisms of Insecticide Resistance: Diversity Among Insects. Edited by Mullin CA and 
Scott JG. ACS Symposium series 505. Washington DC: American Chemical Society pp. 31?
40. 
Casida, J.E. and Quistad, G.B. (1998) Golden age of insecticide research: past, present, or future? 
Annu. Rev. Entomol. 43:1-16. 
Casida, J.E. and Durkin, K.A. (2013) Neuroactive insecticides: targets, selectivity, resistance, 
and secondary effects. Annu. Rev. Entomol. 58: 99-117. 
Castillo-Davis, C.I. and Hartl, D.L. (2002) GeneMerge-post-genomic analysis, data mining, and 
hypothesis testing. Bioinformatics. 19: 891-892. 
Cestele, S., and Catterall, W.A. (2000) Molecular mechanisms of neurotoxin action on voltage-
gated sodium channels. Biochimie. 82:883?892. 
Chamopagne, D.E., Smart, C.T., Ribeiro, J.M.C. and James, A.A. (1995) The salivary gland-
specific apyrase of the mosquito Aedes aegypti is a member of the 5?-nucleotidase family. 
Proc. Natl. Acad. Sci. USA. 92:694-698. 
Chandor-Proust, A., Bibby, J., Regent-Kloechner, M., Roux, J., Guittard-Crilat, E, et al. (2013) 
The central role of mosquito cytochrome P450 CYP6Za in insecticide detoxification revealed 
by functional expression and structural modelling. Biochem. J. 455: 75-85. 
Chandre, F., Darriet, F., Darder, M., Cuany, A., Doannio, J.M.C., et al. (1998) Pyrethroid 
resistance in Culex quinquefasciatus from West Africa. Med Vet Entomol. 12:359-366. 
Chang, C-W., Nashchekin, D., Wheatley, L., Irion, U., Dahlgaard, K., et al. (2011) Anterior-
posterior axis specification in Drosophila oocytes: identification of novel bicoid and oskar 
mRNA localization factors. Genetics. 188:883-896. 
140 
 
Chareonviriyaphap, T., Bangs, M.J., Suwonkerd, W., Kongmee, M., Corbel, V., et al. (2013) 
Review of insecticide resistance and behavioral avoidance of vectors of human diseases in 
Thailand. Parasites and Vectors. 6:280-308. 
Chavez, V.M., Marques, G., Delbecque, J.P., Kobayashi, K., Hollingsworth, M., et al. (2000) The 
Drosophila disembodied gene controls late embryonic morphogenesis and codes for a 
cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 
4115?4126. doi: 10.1111/j.1365-2583.2010.01024.x.  
Chen, Z. Newcomb, R., Forbes, E., McKenzie, J. and Batterham, P. (2001) The 
acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, 
Lucilia cuprina, Insect Biochem. Mol. Biol. 31 805?816. 
Chen, L., Zhu, J., Sun, G. and Raikhel, A.S. (2004) The early gene Broad is involved in the 
ecdysteroid hierarchy governing vitellogenesis of the mosquito Aedes aegypti. J Mol 
Endocrinol. 33:743-761. 
Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid 
guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry, 162, 156-
159. 
Clark, G.G., Bernier, U.R., Allan, S.A., Kline, D. and Golden, F.V. (2011) Changes in Host-
Seeking Behavior of Puerto Rican Aedes aegypti After Colonization. J. Med. Entomol. 
48:533-37. doi:10.1603/ME10207. 
Clarke, J.D. and Zhu, T. (2006) Microarray analysis of the transcriptome as a stepping stone 
towards understanding biological systems: practical considerations and perspectives. The 
Plant J. 45: 630-650. 
Clarke, E.E., Tristem, M., Cory, J.S. and O'Reilly D.R. (1996) Characterization of the 
141 
 
ecdysteroid UDP-glucosyltransferase gene from Mamestra brassicae nucleopolyhedrovirus. 
J. Gen. Virol. 77:2865-2871. 
Claudianos, C., Russell, R.J. and Oakeshott, J.G. (1999) The same amino acid substitution in 
orthologous esterases confers organophosphate resistance on the house fly and a blowfly. Insect 
Biochem. Mol. Biol. 29:675?86. 
Clifton, M.E. and Noriega, F.G. (2012) The fate of follicles after a blood meal is dependent on 
previtellogenic nutrition and juvenile hormone in Aedes aegypti. J. Insect Physiol. 58:1007-
1019. 
Colombani, J., Raisin, S., Pantalacci, S., Radimerski, T., Montagne, J., et al. (2003). A nutrient 
sensor mechanism controls Drosophila growth. Cell. 114:739?749. 
Craig, G.B. (1967) Mosquitoes: females monogamy induced by male accessory gland substance. 
Science. 156:1499-1501. 
Cupp, E.W., Hassan, H.K., Yue, X., Oldland, W.K., Lilley, B.M., et al. (2011) West Nile Virus 
infection in mosquitoes in the mid-south USA, 2002?2005. J. Med. Entomol. 44: 117-125. 
Curtis, C.F., Miller, J.E., Hodjati, M.H., Kolaczinski, J.H. et al. (1998) Can anything be done to 
maintain the effectiveness of pyrethroid-impregnated bednets against malaria vectors? Phil. 
Trans. Roy Soc London B. 353:1769-1775. 
Darawiroj, D., Kondo, H., Hirono, I. and Aoki, T. (2008). Immune-related gene expression 
profiling of yellowtail (Seriola quinqueradiata) kidney cells stimulated with ConA and LPS 
using microarray analysis. Fish Shellfish Immunol. 24: 260-266. 
David, J.P., Strode, C., Vontas, J., Nikou, D., Vaughan, A., et al. (2005) The Anopheles gambiae 
detoxification chip: a highly specific microarray to study metabolic-based insecticide 
resistance in malaria vectors. Proc Natl Acad Sci USA. 102: 4080-4084. 
142 
 
De Gregorio, E., Spellman, P.T., Tzou, P., Rubin, G.M. and Lemaitre, B. (2002). The Toll and 
Imd pathways are the major regulators of the immune response in Drosophila. The EMBO J. 
21: 2568-2579. 
Dhadialla, T.S., Carlson, G.R. and Le, D.P. (1998) New insecticides with ecdysteroidal and 
juvenile hormone activity. Annu. Rev. Entomol. 43:545-569. 
Dimopoulos, G., Casavant, T. L., Chang, S., Scheetz, T., Roberts, C., et al. (2000) Anopheles 
gambiae pilot gene discovery project: identification of mosquito innate immunity genes from 
expressed sequence tags generated from immune-competent cell lines. Proc. Nat. Acad. Sci. 
USA. 97: 6619 - 6624. 
Dong, K. (1997) A single amino acid change in the para sodium channel protein is associated 
with knockdown-resistance (kdr) to pyrethroid insecticides in German cockroach. Insect 
Biochem. Mol. Biol. 27: 93?100.  
Dong, K. (2007) Insect sodium channels and insecticide resistance. Invert. Neurosci. 7: 17?30.  
Dong, K., Valles, S.M., Scharf, M.E., Zeichner, B. and Bennett, G.W. (1998) The knockdown 
resistance (kdr) mutations in pyrethroid-resistant German cockroaches. Pestic. Biochem. 
Physiol. 60: 195?204.  
Duron, O., Labb?, P., Berticat, C., Rousset, F., Guillot, S., et al. (2006) High Wolbachia density 
correlates with cost of infection for insecticide resistant Culex pipiens mosquitoes. Evolution. 
60: 303-14.  
Farnham, A.W. (1977) Genetics of resistance of houseflies (Musca domestica) to pyrethroids 1. 
Knock-down resistance. Pesticide Sci. 8: 631?636.  
Feyereisen, R. (1995) Molecular biology of insecticide resistance. Toxicol. Letters. 82/83: 83-90. 
Feyereisen, R. (1999) Insect P450 enzymes. Annu. Rev. Entomol. 44: 507-533. 
143 
 
Feyereisen, R. (2011) Arthropod CYPomes illustrate the tempo and mode in P450 evolution. 
Biochem. Biophys. Arch. 1814: 19-28. 
ffrench-Constant R.H., Rocheleau T.A., Steichen J.C., and Chalmers A.E. (1993) A point 
mutation in a Drosophila GABA receptor confers insecticide resistance. Nature 363:449?451. 
ffrench-Constant, R.H., Daborn, P.J., and Le Goff, G. (2004) The genetics and genomics of 
insecticide resistance. Rev. TRENDS in Genet. 20:163-70. 
Field, L.M., and Devonshire, A.L. (1998) Evidence that the E4 and FE4 esterase genes responsible 
for insecticide resistance in the aphid Myzus persicae (Sulzer) are part of a gene family. 
Biochem. J. 330:169?73 
Fonseca, D.M., Keyghobadi, N., Malcolm, C.A., Mehmet, C., Schaffner, F., et al. (2004) 
Emerging vectors in the Culex pipiens complex. Science 303:1535-1538. 
Fonseca-Gonzalez, I., Quinones, M.L., Lenhart, A. and Brogdon, W.G. (2011) Insecticide 
resistance status of Aedes aegypti (L.) from Colombia. Pest Manag. Sci. 67:430-437. 
Fournier, D. and Mutero, A. 1994. Modification of acetylcholinesterase as a mechanism of 
resistance to insecticides. Comp. Biochem. Physiol. 108C:19-31. 
Gan, Q., Schones, D.E., Eun, S.H., Wei, G., Cui, K., et al. (2010) Monovalent and unpoised 
status of most genes in undifferentiated cell-enriched Drosophila testis. Genome Biol. 
doi:10.1186/gb-2010-11-4-r42. 
Gant, D.B., Chalmers, A.E., Wolff, M.A., Hoffman, H.B., and Bushey, D.F. (1998) Fipronil: 
action at the GABA receptor. Rev. Toxicol. 2: 147-156. 
Gelbic, I. and Rozsypalova, P. (2012) Autogeny induced by a nonsteroidal ecdysone agonist 
tebufenozide in the mosquito Culex quinquefasciatus. Physiolog. Entomol. 37:119-126. 
Georghiou, G.P. (1972) The evolution of resistance to pesticides. Annu. Rev. Entomol. 3:133-168. 
144 
 
Georghiou, G.P. and Saito, T. (1983) Pest resistance to pesticides. Plenum Press, New York, NY. 
Gong, Y., Li, T., Zhang, L., Gao, X. and Liu, N. (2013). Permethrin Induction of Multiple 
Cytochrome P450 Genes in Insecticide Resistant Mosquitoes, Culex quinquefasciatus. Int. J. 
Biol. Sci. 9: 863-871. 
Gough, J., Karplus, K., Hughey, R. and Chothia, C. (2001) Assignment of homology to genome 
sequences using a library of hidden Markov models that represent all proteins of known 
structure. J. Mol. Biol. 313: 903-919. 
Griffith, M., Griffith, O.L., Mwenifumbo, J., Goya, R., Morrissy, A.S., et al. (2010) Alternative 
expression analysis by RNA sequencing. Nat Meth 7:843-847. 
Gubler, D.J. (1988) Dengue, pp. 223-260. In T Monarth (ed.), The Arboviruses. Vol II. 
Epidemiology and ecology. CRC Press, Florida. 
Gubler, D.J. and Clark, G.G. (1995) Dengue/dengue hemorrhagic fever: the emergence of a 
global health problem. Emerg. Infect. Dis. 1:55-57. 
Guerrero, F.D., Jamroz, R.C., Kammlah, D., and Kunz, S.E. (1997) Toxicological and molecular 
characterization of pyrethroid-resistant horn flies, Haematobia irritans: identification of kdr 
and super-kdr point mutations. Insect Biochem. Mol. Biol. 27: 745?755. 
Guittard, E., Blais, C., Maria, A., Parvy, J.P., Parishna, S., et al. (2011) CYP18A1, a key enzyme 
of Drosophila steroid hormone inactivation, is essential for metamorphosis. Dev Biol 349: 
35?45. doi: 10.1016/j.ydbio.2010.09.023.   
Gulia-nuss, M., Robertson, A.E., Brown, M.R., and Strand, M.R. (2011) Insulin-Like Peptides 
and the Target of Rapamycin Pathway Coordinately Regulate Blood Digestion and Egg 
Maturation in the Mosquito Aedes aegypti. PLoS ONE. 6. doi:10.1371/journal.pone.0020401. 
Guoqiang, S., Jinsong, Z., Chao, L., Zhijian, T. and Raikhel, A.S. (2002) Two isoforms of the 
145 
 
early E74 gene, an Ets transcription factor homologue, are implicated in the ecdysteroid 
hierarchy governing vitellogenesis of the mosquito, Aedes aegypti. Mol. Cell. Endocrinol. 
190: 147-157. 
Hamdan, H., Sofian-Azirun, M., Ahmad, N.W., and Lim L.H. (2005) Insecticide resistance 
development in Culex quinquefasciatus (Say), Aedes aegypti (L.) and Aedes albopictus 
(Skuse) larvae against malathion, permethrin and temephos. Tropical Biomed. 22:45-52. 
Hansen, I.A, Attardo, G.M., Park, J.-H., Peng, Q., and Raikhel, A.S. (2004) Target of rapamycin-
mediated amino acid signaling in mosquito anautogeny. Proc. Nat. Acad. Sci. USA. 101: 
10626?10631. 
Hansen, I.A., Attardo, G.M., Roy, S.G. and Raikhel, A.S. (2005) Target of rapamycin-dependent 
activation of S6 kinase is a central step in the transduction of nutritional signals during egg 
development in a mosquito. J. Biol. Chem. 280:20565-20572. 
Hardstone, M.C., Komagata, O., Kasai, S., Tomita, T., and Scott, J.G. (2010) Use of isogenic 
strains indicates CYP9M10 is linked to permethrin resistance in Culex pipiens 
quinquefasciatus. Insect Mol. Biol. 19: 717-726. 
Hassall, K.A. (1990) The Biochemistry and Uses of Pesticides. 2nd Edition. VCH Publishers, NY, 
NY. 
Harris, T.D., Buzby, P.R., Babcock, H., Beer, E., Bowers, J. et al. (2008) Single-molecule DNA 
sequencing of a viral genome. Science 320:106-109.  
Hedengren-Olcott, M., Olcott, M.C., Mooney, D.T., Ekengren, S., Geller, B.L., et al. (2004). 
Differential activation of the NF-kappaB-like factors Relish and Dif in Drosophila 
melanogaster by fungi and Gram-positive bacteria. J. Biol. Chem. 279: 21121-21127. 
Hemingway J., Hawkes N.J., McCarroll, L. and Ranson, H. (2004) The molecular basis of 
146 
 
insecticide resistance in mosquitoes. Insect Biochem. Mol. Biol. 34:653-665. 
Hemingway, J., Field, L. and Vontas, J. (2002) An overview of insecticide resistance. Science 
298: 96-97. 
Hemingway, J. and Ranson, H. (2000) Insecticide resistance in insect vectors of human disease. 
Ann. Rev Entomol. 45:371-392. 
Holt, R.A., Subramanian, G.M., Halpern, A., Sutton, G.G., Charlab, R., (2002) The genome 
sequence of the malaria mosquito Anopheles gambiae. Science. 298:129-149. 
Hougard, J.M., Duchon, S., Zaim, M. and Guillet, P. (2002) Bifenthrin: a useful pyrethroid 
insecticide for treatment of mosquito nets. J. Med. Entomol. 39:526-533. 
Huang, H.S., Hu, N.T., Yao, Y.E., Wu, C.Y., Chiang, S.W., et al. (1998) Molecular cloning and 
heterologous expression of a glutathione S-transferase involved in insecticide resistance from 
the diamondback moth, Plutella xylostella. Insect Biochem. Mol. Biol. 28:651?58. 
Hubbard, T., Murzin, A., Brenner, S. and Chothia, C. (1997) SCOP. a structural classification of 
proteins database. Nucl. Acid Res. 25: 236-239. 
Isoe, J. and Scaraffia, P.Y. (2013) Urea synthesis and excretion in Aedes aegypti mosquitoes are 
regulated by a unique cross-talk mechanism. PLoS ONE. 8:e65393. 
Itokawa, K., Komagata, O., Kasai, S., Okamura, Y., Masada, M., et al. (2010) Genomic 
structures of Cyp9m10 in pyrethroid resistant and susceptible strains of Culex 
quinquefasciatus. Insect Biochem. Mol. Biol. 40:631-640. 
Jaglarz, M.K., Kloc, M., Jankowska, W., Szymanska, B. and Bilinski, S.M. (2011) Nuage 
morphogenesis becomes more complex: two translocation pathways and two forms of nuage 
coexist in Drosophila germline syncytia. Cell Tissue Res. 344:169-181. 
Jawara, M., Pinder, M., Cham, B., Walraven, G. and Rowley, J. (2001) Comparison of 
147 
 
deltamethrin tablet formulation with liquid deltamethrin and permethrin for bednet treatment 
in The Gambia. Tropical Med. Int. Health. 6:309-316. 
Johnson, N.F and Triplehorn, C.A. (2004) Borror and DeLong's introduction to the study of insects 
7th edition. Brooks Cole Publishing Company. Pacific Grove, CA. 
Joussen, N., Heckel, D.G., Haas, M., Schuphan, I. and Schmidt, B. (2008) Metabolism of 
imidacloprid and DDT by P450 CYP6G1 expressed in cell cultures of Nicotiana tabacum 
suggests detoxification of these insecticides in Cyp6g1 overexpressing strains of Drosophila 
melanogaster, leading to resistance. Pest Manag. Sci. 64:65-73. 
Juntarajumnong, W., Pimnon, S., Bangs, M.J., Thanispong, K. and Chareonviriyaphap, T. (2012) 
Discriminating lethal concentrations and efficacy of six pyrethroids for control of Aedes 
aegypti in Thailand. J. Amer. Mosq. Contr. Assoc. 28:30-37. 
Kasai, S., Weerashinge, I.S. and Shono, T. (1998) P450 monooxygenases are an important 
mechanism of permethrin resistance in Culex quinquefasciatus Say larvae. Archiv. Insect 
Biochem. Physiol. 37:47-56. 
Kasper, D., Hansen, S.E. and Brenner, S.D. (2010) Biases in Illumina transcriptome sequencing 
caused by random hexamer priming. Nucl. Acid Res. doi:10.1093/nar/gkq224. 
Kikuchi, Y., Hayatsu, M., Hosokawa, T., Nagayama, A., Tao, K., et al. (2012) Symbiont-
mediated insecticide resistance. Proc. Natl. Acad. Sci. USA. 109: 8618-8622. 
Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., et al. (2011) TopHat2: accurate 
alignment of transcriptomes in the presence of insertions, deletions and gene fusions. 
Genome Biol. 14:R36.  
Knipple, D.C., Doyle, K.E., Marsella-Herrick, P.A. and Soderlund, D.M. (1994) Tight genetic 
linkage between the kdr insecticide resistance trait and a voltage-sensitive sodium channel 
148 
 
gene in the house fly. Proc Natl Acad Sci USA 91: 2483?2487. 
Krem, M.M., Rose, T. and Di Cera, E. (2000) Sequence determinants of function and evolution 
in serine proteases. Trends Cardiovasc. Med. 10: 171?176. 
Lee, S.H., Dunn, J.B., Clark, J.M. and Soderlund, D.M. (1999) Molecular analysis of kdr-like 
resistance in a permethrin-resistant strain of Colorado potato beetle. Pestic. Biochem. 
Physiol. 63: 63?75. 
Lee, S.H., Kang, J.S., Min, J.S., Yoon, K.S., Strycharz, J.P., et al. (2010) Decreased 
detoxification genes and genome size make the human body louse an efficient model to study 
xenobiotic metabolism. Insect Mol. Biol. 19: 599?615. 
Lemberg, M.K. (2011) Intramembrane proteolysis in regulated protein trafficking. Traffic 
12:1109-1118. 
Letunic, I., Doerks, T. and Bork, P. (2012) SMART 7: recent updates to the protein domain 
annotation. Nucl. Acid Res. 40: D302-D305. 
Li, F. and Han, Z. (2004) Mutations in acetylcholinesterase associated with insecticide resistance 
in the cotton aphid, Aphis gossypii Glover, Insect Biochem. Mol. Biol. 34:397?405. 
Li, X., Schuler, M.A. and Berenbaum, M.R. (2007) Molecular mechanisms of metabolic 
resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52: 231-253. 
Li, M., Reid, W.R., Zhang, L., Scott, J.G., Gao, X. et al. (2013). A whole transcriptomal linkage 
analysis of gene co-regulation in insecticide resistant house flies, Musca domestica. BMC 
Genomics 14: 803. 
Li, T., Lan, Q. and Liu, N. (2009) Larvicidal activity of mosquito sterol carrier protein-2 
inhibitors to the insecticide resistant mosquito Culex quinquefasciatus (Diptera: Culicidae). J. 
Med. Entomol. 46:1430-1435. 
149 
 
Li, T. and Liu, N. (2010) Genetics and inheritance of permethrin resistance in the mosquito Culex 
quinquefasciatus. J. Med. Entomol. 47: 1127-1134. 
Li, T., Zhang, L., Reid, W.R., Xu, Q., Dong, K., et al. (2012). Multiple mutations and mutation 
combinations in the sodium channel of permethrin resistant mosquitoes, Culex 
quinquefasciatus. Sci. Rep. 2: 781.  
Lichtenegger, F.S., Mueller, K., Otte, B., Beck, B., Hiddemann, W., et al. (2012). CD86 and IL-
12p70 are key players for T helper 1 polarization and natural killer cell activation by Toll-like 
receptor-induced dendritic cells. PLoS ONE 7: e44266. 
Liu, N. (2008) Insecticide resistance in mosquitoes: development and mechanisms. In Recent 
Advances in Insect Physiology, Toxicology and Molecular Biology. Edited by N. Liu. Kerala, 
India: Research Signpostpp. 75-91. 
Liu, N., Liu, H., Zhu, F. and Zhang, L. (2007) Differential expression of genes in pyrethroid 
resistant and susceptible mosquitoes, Culex quinquefasciatus (S.). Gene 394: 61-68. 
Liu, N. and Scott, J.G. (1995) Genetics of resistance to pyrethroid insecticides in the house fly, 
Musca domestica. Pestic. Biochem. Physiol. 52: 116-124. 
Liu, N. and Scott, J.G. (1997) Phenobarbital induction of CYP6D1 is due to a trans acting factor 
on autosome 2 in house flies, Musca domestica. Insect Mol. Biol. 6: 77-81. 
Liu, N. and Scott, J.G. (1998) Increased transcription of CYP6D1 causes cytochrome P450-
mediated insecticide resistance in house fly. Insect Biochem. Mol. Biol. 28: 531-535. 
Liu, N., Xu, Q., Li, T., He, L. and Zhang, L. (2009) Permethrin resistance and target site 
insensitivity in the mosquito Culex quinquefasciatus in Alabama, U.S.A. J. Med. Entomol. 
46: 1424-1429. 
Liu, N. and Yue, X. (2001) Genetics of pyrethroid resistance in the house fly (Diptera: 
150 
 
Muscidae). Pestic. Biochem. Physiol. 70: 151-158. 
Liu, H., Cupp, E.W., Micher, K.M., Guo, A. and Liu, N. (2004) Insecticide resistance and cross-
resistance in Alabama and Florida strains of Culex quinquefasciatus (S.). J. Med. Entomol. 
41:408-413. 
Liu, N, Xu, Q., Zhu, F. and Zhang, L. (2006) Pyrethroid resistance in mosquitoes. Insect Sci. 
13:159-166. 
Liu, N. (2008) Insecticide resistance in mosquitoes: development and mechanisms, pp. 75?91. In 
N. Liu (Ed.) Recent Advances in Insect Physiology, Toxicology and Molecular Biology. 
Research Signpost, Kerala, India. 
Liu, N., Li, T., Reid, W. R., Yang, T. and Zhang, L. (2011). Multiple Cytochrome P450 genes: 
their constitutive overexpression and permethrin induction in insecticide resistant 
mosquitoes, Culex quinquefasciatus. PloS ONE 6: e23403. 
Liu, Z., Valles, S.M., and Dong, K. (2000). Novel point mutations in the German cockroach para 
sodium channel gene are associated with knockdown resistance (kdr) to pyrethroid 
insecticides. Insect Biochem. Mol. Biol. 30: 991?997. 
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time 
quantitative PCR and the 2???CT method. Methods 25: 402-408. 
Lohse, M., Bolger, A.M., Nagel, A., Fernie, A.R., Lunn, J.E., et al. (2012) RobiNA: a user-
friendly, integrated software solution for RNA-Seq-based transcriptomics. Nucl. Acid Res. 
40: W622-627. 
Lounibos, L.P. (2002) Invasions by insect vectors of human disease. Annu. Rev. Entomol. 47:233-
266. 
Mackay, A.J., Kramer, W.L., Meece, J.K., Brumfield, R.T. and Foil, L.D. (2010) Host feeding 
151 
 
patterns of Culex mosquitoes (Diptera: Culicidae) in east Baton Rouge parish, Louisiana. J. 
Med. Entomol. 47: 238-248. 
Manda, H., Shah, P., Polsomboon, S., Chareonviriyaphap, T., Castro-Llanos, F., et al. (2013) 
Contact irritant responses of Aedes aegypti using sublethal concentration and focal 
application of pyrethroid chemicals. PLoS Negl. Trop. Dis. 7: e2074. 
doi:10.1371/journal.pntd.0002074 
Marcombe, S., Poupardin, R., Darriet, F., Reynaud, S., Bonnet, J., et al. (2009) Exploring the 
molecular basis of insecticide resistance in the dengue vector Aedes aegypti: a case study in 
Martinique Island (French West Indies). BMC Genomics. 10:494. doi:10.1186/1471-2164-10-
494. 
Marinotti, O., Calvo, E., Nguyen, Q.K., Dissanayake, S., Ribeiro, J.M.C., et al. 2006. Genome-
wide analysis of gene expression in adult Anopheles gambiae. Insect Mol Biol. 15:1-12. 
Marrs, W.R., Blankman, J.L., Horne, E.A., Thomazeau, A., Lin, Y.H., et al. (2012) The serine 
hydrolase ABHD6 controls the accumulation and efficacy of 2-AG at cannabinoid receptors. 
Nat. Neurosci. 13: 951-957. 
Martinez-Torres, D., Chandre, F., Williamson, M.S., Darriet, F., Berge, J.B., et al. (1998) 
Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria 
vector Anopheles gambiae s.s. Insect Mol. Biol. 7: 179?184. 
Martinez-Torres, D., Foster, S.P., Field, L.M., Devonshire, A.L. and Williamson, M.S., (1999). A 
sodium channel point mutation is associated with resistance to DDT and pyrethroid 
insecticides in the peach potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). 
Insect Mol. Biol. 8: 339?346. 
McAbee, R.D., Kang, K.D., Stanich, M.A., Christiansen, J.A., Wheelock, C.E., et al. (2003) 
152 
 
Pyrethroid tolerance in Culex pipiens pipiens var molestus from Marin County, California. 
Pest Manag. Sci. 60:359-368. 
McLaughlin, L.A., Niazi, U., Bibby, J., David, J.-P., Vontas, J., et al. (2008). Characterization of 
inhibitors and substrates of Anopheles gambiae CYP6Z2. Insect Mol. Biol. 17:125-135. 
Megy, K., Emrich, S.J., Lawson, D., Campbell, D., Dialynas, E., et al. (2012) VectorBase: 
improvements to a bioinformatics resource for invertebrate vector genomics. Nucl. Acid Res. 
40: D729-734. 
Megy, K., Hammond, M., Lawson, D., Bruggner, R.V., Birney, E., et al. (2009) Genomic 
resources for invertebrate vectors of human pathogens, and the role of VectorBase. Infection 
Genet. Evol. 9:308-313. 
Melander, A.L. 1914. Can insects become resistant to sprays? J. Econ. Entomol. 7:167-173.  
Menozzi, P., Shi, M.A., Lougarre, A., Tang, Z.H., and Fournier, D. (2004) Mutations of 
acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster 
populations, BMC Evol. Biol.4: 4. 
Metzker, M.L., Raghavachari, R., Richards, S., Jacutin, S.E., Civitello, A., et al. (1994) 
Termination of DNA synthesis by novel 3?-modified deoxyribonucleoside triphosphates. 
Nucl. Acid Res. 22: 4259?4267. 
Metzker, M.L. (2010) Sequencing technologies ? the next generation. Nat. Rev. Genet. 11: 31-46. 
Morgan, E.T. (1989) Suppression of constitutive cytochrome P-450 gene expression in livers of 
rats undergoing an acute phase response to endotoxin. Mol. Pharmacol. 36: 699-707. 
Morgan, E.T. (1997) Regulation of cytochrome P450 during inflammation and infection. Drug 
Metab. Rev. 29:1129-1188. 
Morgan. E.T. (2001) Regulation of cytochrome P450 by inflammatory mediators: why and how? 
153 
 
Drug Metab. Dispos. 29: 207?212. 
Morin, R.D., Bainbridge, M., Fejes, A., Hirst, M., Krzywinski, M., et al (2008). Profiling the 
HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read 
sequencing. BioTechniques 45: 81?94. 
M?ller, P., Warr, E., Stevenson, B.J., Pignatelli, P.M., Morgan, J.C., et al. (2008). Field-caught 
permethrin-resistant Anopheles gambiae overexpress CYP6P3, a P450 that metabolises 
pyrethroids. PLoS Genet. 4:e1000286. doi:10.1371/journal.pgen.1000286. 
Mutero, A., Pralavorio, M., Bride, J. and Fournier, D. (1994) Resistance-associated point 
mutations in insecticide-insensitive Acetylcholinesterase, Proc. Natl. Acad. Sci. USA 
91:5922?5926. 
Murzin, A.G., Brenner, S.E., Hubbard, T. and Chothia, C. (1995). SCOP: a structural 
classification of proteins database for the investigation of sequences and structures. J. Mol. 
Biol. 247: 536-540.  
Najera, J.A. and Zaim, M. (2001) Malaria vector control: insecticides for indoor residual 
spraying. WHO document WHO/ CDS/WHOPES/2001.3 World Health Organization, 
Geneva. 
Namiki, T., Niwa, R., Sakudoh, T., Shirai, K., Takeuchi, H., et al. (2005) Cytochrome P450 
CYP307A1/Spook: a regulator for ecdysone synthesis in insects. Biochem. Biophys. Res. 
Commun. 337: 367?374. 
Nasci, R. and Miller, B. (1996) Culicine mosquitoes and the agents they transmit. In The Biology 
of Disease Vectors. Edited by Beaty BJ and Marquardt WC. Niwot, Colorado: University 
Press of Colorado pp. 85-97. 
Nelson, D.R. (2009) The Cytochrome P450 homepage. Human Genomics. 4:59-65. 
154 
 
Nene, V., Wortman, J.R., Lawson, D., Haas, B., Kodira, C., et al. (2007) Genome sequence of 
Aedes aegypti, a major arbovirus vector. Science. 316:1718-23. 
Nielsen, R., Paul, J.S., Albrechtsen, A. and Song, Y.S. (2011) Genotype and SNP calling from 
next-generation sequencing data. Nat. Rev. 12:443-451. 
Norris, L.C. and Norris, D.E. (2011) Insecticide resistance in Culex quinquefasciatus mosquitoes 
after the introduction of insecticide-treated bed nets in Macha, Zambia. J. Vector Ecol. 
36:411-420. 
Ogawa, S., Lozach, J., Benner, C., Pascual, G., Tangirala, R.K., et al. (2005). Molecular 
determinants of crosstalk between nuclear receptors and toll-like receptors. Cell 122: 707-
721. 
Ono, H., Rewitz, K.F., Shinoda, T., Itoyama, K., Petryk, A., et al. (2006) Spook and Spookier 
code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev. 
Biol. 298: 555?570. doi: 10.1016/j.ydbio.2006.07.023.  
Oppenoorth, F.J. and Van Asperen, K. (1960) Allelic genes in the housefly producing modified 
enzymes that cause organophosphate resistance. Science 132:298?99. 
Oshlack, A. and Wakeffeld, M.J. (2009) Transcript length bias in RNA-seq data confounds 
systems biology. Biol. Direct 4:14. 
Otsuka, M., Iversen, L.L., Hall, Z.W. and Kravitz E.A. 1966. Release of gamma-aminobutyric 
acid from inhibitory nerves of lobster. Proc. Natl. Acad. Sci. USA. 56:1110?1115. 
Pan, X., Zhou, G., Wu, J., Bian, G., Lu, P., et al. (2012). Wolbachia induces reactive oxygen 
species (ROS)-dependent activation of the Toll pathway to control dengue virus in the 
mosquito Aedes aegypti. Proc. Natl. Acad. Sci. USA. 109: 13-14. 
Patil, V.L. and Guthrie, F.E. (1979) Cuticular lipids of two resistant and a susceptible strain of 
155 
 
house flies. Pestic. Sci. 10:399-403. 
Park, Y. and Taylor, M.F.J. (1997) A novel mutation L1014H in sodium channel gene hscp 
associated with pyrethroid resistance for Heliothis virescens (Lepidoptera: Noctuididae). 
Insect Biochem. Molec. Biol. 27: 9?13.  
Park, Y., Taylor, M.F.J. and Feyereisen, R. (1999) Voltage-gated sodium channel genes hscp and 
hDSC1 of Heliothis virescens F. genomic organization. Insect Mol. Biol. 8: 161?170. 
Pavek, P. and Dvorak, Z. (2008) Xenobiotic-induced transcriptional regulation of xenobiotic 
metabolizing enzymes of the cytochrome P450 superfamily in human extrahepatic tissues. 
Curr. Drug Metab. 9: 129-143. 
Pedra, J.H.F., McIntyre, L.M., Scharf, M.E., and Pittendrigh. BR. (2004) Genome-wide 
transcription profile of field- and laboratory-selected dichlorodiphenyltrichloroethane 
(DDT)- resistant Drosophila. Proc. Natl. Acad. Sci. USA. 101:7034-7039. 
Petryk, A., Warren, J.T., Marques, G., Jarcho, M.P., Gilbert, L.I., et al. (2003) Shade is the 
Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect 
molting hormone 20-hydroxyecdysone. Proc. Natl. Acad. Sci. USA 100: 13773?13778. doi: 
10.1073/pnas.2336088100.  
Phillips, R.S. (2001) Current status of malaria and potential for control. Clin. Microbiol. Rev. 14: 
208-226. 
Picard tools [http://picard.sourceforge.net] 
Plapp, F.W.Jr. and Hoyer, R.F. (1968) Insecticide resistance in the house fly: Decreased rate of 
absorption as the mechanism of action of a gene that acts as an intensifier of resistance. J. 
Econ. Entomol. 61:1298-1303. 
Poupardin, R., Riaz, M., Vontas, J., David, J.P. and Reynaud, S. (2010) Transcription profiling of 
156 
 
eleven cytochrome P450s potentially involved in xenobiotic metabolism in the mosquito 
Aedes aegypti. Insect Mol. Biol. 19:185-193. doi:10.1111/j.1365-2583.2009.00967.x  
Price, D.P., Nagarajan, V., Churbanov, A., Houde, P., Milligan, B., et al. (2011) The fat body 
transcriptomes of the yellow fever mosquito Aedes aegypti, pre- and post-blood meal. PLoS 
ONE. doi:10.1371. 
Pridgeon, J.W., Meepagala, K.M., Becnel, J.J., Clark, G.G., Pereira, R.M., et al. (2007) 
Structure-activity relationships of 33 piperidines as toxicants against female adults of Aedes 
aegypti (Diptera: Culicidae). J. Med. Entomol. 44: 263-269. 
Pridgeon, J.W., Pereira, R.M., Becnel, J.J., Allan, S.A., Clark, G. G., et al. (2008). Susceptibility 
of Aedes aegypti, Culex quinquefasciatus Say, and Anopheles quadrimaculatus Say to 19 
pesticides with different modes of action. J. Med. Entomol. 45: 82?87. 
Pridgeon, J.W., Becnel, J.J., Clark, G.G. and Linthicum, K.J. (2009) Permethrin Induces 
Overexpression of Multiple Genes in Aedes aegypti. J. Med. Entomol. 46:580-587. 
Ptitsyn, A. Reyes-Solis, G., Saavedra-Rodriguez, K., Betz, J., Suchman, E. L., et al. (2011) 
Rhythms and synchronization patterns in gene expression in the Aedes aegypti mosquito. 
BMC Genomics. 12:153. doi:10.1186/1471-2164-12-153. 
Qui, Y, Tittiger, C., Wicker-Thomas, C., Le Goff, G., Young, S., et al. (2012) An insect-specifice 
P450 oxidative decarbonylase for cuticular hydrocarbon biosynthesis. Proc. Natl. Acad. Sci. 
USA doi/10.1073/pnas.1208650109.  
R Core Team. (2013) R: A language and environment for statistical computing. R Foundation for 
Statistical Computing, Vienna, Austria. URL http://www.R-project.org/. 
Ramsay, A.J., Dong, Y., Hunt, M.L., Linn, M.L., Samaratunga, H., et al. (2008) Kallikrein-
related peptidase 4 (KLK4) initiates intracellular signaling via protease-activated receptors 
157 
 
(PARs) KLK4 and PAR-2 are co-expressed during prostate cancer progression. J. Biol. Chem. 
283: 12293-12304.  
Ranson, H., Rossiter, L., Ortelli, F., Jesen, B., Wang, X., et al. (2001) Identification of a novel 
class of insect glutathione S-transferases involved in resistance to DDT in the malaria vector 
Anopheles gambiae. Biochem. J. 359:295?304. 
Ranson, H., Jensen, B., Vulule, J.M., Wang, X., Hemingway, J., et al. (2000) Identification of a 
point mutation in the voltage gated sodium channel gene of Kenyan Anopheles gambiae 
associated with resistance to DDT and pyrethroids. Insect Mol. Biol. 9: 491?497. 
Rapaport, F., Khanin, R., Liang, Y., Pirun, M., Krek, A. et al. (2013) Comprehensive evaluation 
of differential gene expression analysis methods for RNA-seq data. Genome Biol. 14: R95. 
Reid, W.R., Zhang, L., Liu, F. and Liu, N. (2012) The Transcriptome Profile of the Mosquito 
Culex quinquefasciatus following Permethrin Selection. PLoS ONE 7: e47163. 
Reimand, J., Arak, T. and Vilo, J. (2011) g:Profiler - a web server for functional interpretation of 
gene lists (2011 update). Nucl. Acids Res. doi:10.1093/nar/gkr378. 
Reimand, J., Kull, M., Peterson, H., Hansen, J. and Vilo, J. (2007) g:Profiler - a web-based 
toolset for functional profiling of gene lists from large-scale experiments. Nucl. Acid Res. 35: 
W193-W200. 
Reisen, W.K., Pfuntner, A.R., Milby, M.M., Tempelis, C.H. and Presser, S.B. (1990) Mosquito 
bionomics and the lack of arbovirus activity in the Chino area of San Bernardino County, 
California. J. Med. Entomol. 27: 811-818. 
Retnakaran, A., Krell, P., Feng, Q. and Arif, B. (2003) Ecdysone agoinists: mechanism and 
importance in controlling in- sect pests of agriculture and forestry. Arch. Insect Biochem. 
Physiol. 54:187?199. 
158 
 
Rettich, F. (1983) Residual toxicity of deltamethrin and permethrin on various surfaces for 
mosquito species Culex pipiens molestul Forskal. J. Hyg. Epidemiol. Microbiol. Immunol. 
27:229-36. 
Rewitz, K.F. and Gilbert, L.I. (2008) Daphnia Halloween genes that encode cytochrome P450s 
mediating the synthesis of the arthropod molting hormone: evolutionary implications. BMC 
Evol. Biol. 8: 60. doi: 10.1186/1471-2148-8-60.  
Riehle, M.A., Garczynski, S.F., Crim, J.W., Hill, C.A. and Brown, M.A. (2002) Neuropeptides 
and peptide hormones in Anopheles gambiae. Science. 298:172-175. 
Roberts, D.R., Chareonviriyaphap, T., Harlan, H.H. and Hshieh, P. (1997) Methods of testing and 
analyzing excite-repellency responses of malaria vectors to insecticides. J. Am. Mosq. Contr. 
Assoc. 13:13-17. 
Roberts, A., Trapnell, C., Donaghey, J., Rinn, J. and Pachter, L. (2011) Improving RNA-Seq 
expression estimates by correcting for fragment bias. Genome Biol. 12: doi:10.1186/gb-2011-
12-3-r22. 
Roush, R.T., Hoy, C.W., Ferro, D.N. and Tingey, W.M. (1990) Insecticide resistance in the 
Colorado beetle (Coleoptera: Chrysomelidae): influence of crop rotation and insecticide use. 
J. Econ. Entomol. 83: 315-319. 
Russell, V. and Dunn, P.E. (1996) Antibacterial proteins in the midgut of Manduca sexta during 
metamorphosis. J. Insect Physiol. 42: 65-71. 
Saavedra-Rodriguez, K., Suarez, A.F., Salas, I.F., Strode, C., Ranson, H., et al. (2012) 
Transcription of detoxification genes after permethrin selection in the mosquito Aedes 
aegypti. Insect Mol. Biol. 21:61-77. 
Sawicki, R.M. and Denholm, I. (1984) Adaptation of insects to insecticides. Ciba Found. Symp. 
159 
 
102: 152-166. 
Schuler, T.H., Martinez-Torres, D., Thompson, A.J., Denholm, I., Devonshire, A.L., et al. (1998) 
Toxicological, electrophysiological, and molecular characterisation of knockdown resistance 
to pyrethroid insecticides in the diamondback moth, Plutella xylostella (L.). Pestic. Biochem. 
Physiol. 59: 169?192. 
Scott, J.G. (1991) Investigating mechanisms of insecticide resistance: methods, strategies, and 
pitfalls. Pesticide Resistance in Arthropods (eds. R.T. Roush & B.E. Tabashnik), pp. 39-57. 
Chapman and Hall, New York. 
Scott, J.G., and Wen, Z. (2001). Cytochromes P450 of insects: the tip of the iceberg. Pest Manag. 
Sci. 57:958?67. 
Sebastian, A. and DeMeillon, B. (1967) Experiments on the mating of Culex pipiens fatigans in 
the laboratory. Bull. Wld. Hlth. Org. 36:47-52. 
Shiao, S-H., Hansen, I.A., Zhu, J., Sieglaff, D.H. and Raikhel A.S. (2008) Juvenile hormone 
connects larval nutrition with target of rapamycin signaling in the mosquito Aedes aegypti. J. 
Insect Physiol. 54: 231?239. 
Shirk, P.D., Bean, D.W. and Brookes V.J. (1990) Ecdysteroids control vitellogenesis and egg 
maturation in pharate adult females of the Indianmeal moth, Plodila interpunctella. Arch. 
Insect. Biochem. Physiol. 15: 183-199. 
Silverman, J. and Bieman, D.N. (1993). Glucose aversion in the German cockroach Blattella 
germanica. J. Insect Physiol. 39: 925-933. 
Sim, S., Ramirez, J.L. and Dimopoulos, G. (2012) Dengue virus infection of the Aedes aegypti 
salivary gland and chemosensory apparatus induces genes that modulate infection and blood-
feeding behavior. PLoS Pathog. 8:e1002631. doi:10.1371/journal.ppat.1002631. 
160 
 
Smagghe, G., Carton, B., Lecombel, L. and Tirry, L. (2001) Significance of absorption, 
oxidation, and binding to toxicity of four ecdysone agonists in multi-resistant cotton 
leafworm. Arch. Insect Biochem. Physiol. 46:127?239. 
Smith, T.M., Hicks-Berger, C.A., Kim, S. and Kirley, T.L. (2002) Cloning, expression, and 
characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a 
new family of extracellular nucleotides. Arch. Biochem. Biophys. 406:105-115. 
Solomon, P.S., Ipcho, S.V.S., Hane, J.K., Tan, K.-C. and Oliver, R.P. (2008) A quantitative PCR 
approach to determine gene copy number. Fungal Genet. Rep. 55:5-8. 
Stevenson, B.J., Bibby, J., Pignatelli, P., Muangnoicharoen, S., O?Neill, P.M., Lian, L.Y., et al. 
(2011) Cytochrome P450 6M2 from the malaria vector Anopheles gambiae metabolizes 
pyrethroids: sequential metabolism of deltamethrin revealed. Insect Biochem. Mol. Biol. 
41:492-502. 
Stevenson, B.J., Pignatelli, P., Nikou, D. and Paine, M.J. (2012) Pinpointing P450s associated 
with pyrethroid metabolism in the dengue vector, Aedes aegypti: developing new tools to 
combat insecticide resistance. PLoS Negl. Trop. Dis. 6:e1595. 
Strode, C., Steen, K., Ortelli, F. and Ranson, H. (2006) Differential expression of the 
detoxification genes in the different life stages of the malaria vector Anopheles gambiae. 
Insect Mol. Biol. 15: 523-30. 
Strode, C., Wondji, C.S., David, J.-P., Hawkes, N.J., Lumjuan, N., et al. (2008) Genomic analysis 
of detoxification genes in the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 38:113-
123. 
Strode, C., de Melo-Santos, M., Magalh?es, T., Ara?jo, A. and Ayres, C. (2012) Expression 
profile of genes during resistance reversal in a temephos selected strain of the dengue vector, 
161 
 
Aedes aegypti. PloS ONE. 7:e39439. doi:10.1371/journal.pone.0039439. 
Syvanen, M., Zhou, Z., Wharton, J., Goldsbury, C., and Clark, A. (1996) Heterogeneity of the 
glutathione transferase genes encoding enzymes responsible for insecticide degradation in the 
housefly. J. Mol. Evol. 43:236?40. 
Syvanen, M., Zhou, Z.H. and Wang, J.Y. (1994) Glutathione transferase gene family from the 
Musca domestica. Mol. Gen. Genet. 245P:25?31. 
Tan, J., Liu, Z., Wang, R., Huang, Z.Y., Chen, A.C., et al. (2005) Identification of amino acid 
residues in the insect sodium channel critical for pyrethroid binding. Mol. Pharmacol. 67: 
513?522.  
Terriere, L.C. (1982). The Biochemistry and Toxicology of Insecticides. Corvallis. Oregon State 
University. 
Trapnell, C., Pachter, L. and Salzberg, S.L. (2009) TopHat: discovering splice junctions with 
RNA-Seq. Bioinformatics 25: 1105-1111. 
Trejo, J. (2003) Protease-activated receptors: new concepts in regulation of G protein-coupled 
receptor signaling and trafficking. Perspect. Pharmacol. 307:437-442. 
Turnquist, H.R., Cardinal, J., Macedo, C., Rosborough, B.R., Sumpter, T. L., et al. (2010). 
mTOR and GSK-3 shape the CD4+ T-cell stimulatory and differentiation capacity of myeloid 
DCs after exposure to LPS. Blood 115: 4758?4769. 
Unlu, I., Kramer, W.L., Roy, A.F. and Foil, L.D. (2010) Detection of West Nile virus RNA in 
mosquitoes and identification of mosquito blood meals collected at alligator farms in 
Louisiana. J. Med. Entomol. 47: 625-633. 
Vaughan, A.,Rocheleau, T. and ffrench-Constant, R. (1997) Site-directed mutagenesis of an 
acetylcholinesterase gene from the yellow fever mosquito Aedes aegypti confers insecticide 
162 
 
insensitivity, Exp. Parasitol. 87:237?244. 
Vinson, S.B. and Law, P.K. (1971) Cuticular composition and DDT resistance in the tobacco 
budworm. J. Econ. Entomol. 64: 1387-1392. 
Vogel, C., Berzuini, C., Bashton, M., Gough, J. and Teichmann, S.A. (2004) Supra-domains - 
evolutionary units larger than single protein domains. J. Mol.Biol. 336: 809-823. 
Vogel, C., Teichmann, S.A., and Pereira-Leal, J.B. (2005) The relationship between domain 
duplication and recombination. J Mol Biol. 346:355-365.  
Vontas J.G., Small G.J., Nikou D.C., Ranson H. and Hemingway J. (2002) Purification, 
molecular cloning and heterologous expression of a glutathione-S-transferase involved in 
insecticide resistance from the rice brown planthopper, Nilaparvata lugens. Biochem. J. 
362:329?37 
Vontas, J., Blass, C., Koutsos, J.A.C., David, P., Kafatos, F.C., et al. (2005) Gene expression in 
insecticide resistant and susceptible Anopheles gambiae strains constitutively or after 
insecticide exposure. Insect Mol Biol 14: 509-521. 
Vontas, J., Ranson, H. and Alphey, L. (2010) Transcriptomics and disease vector control. BMC 
Biol. 8: 52. doi:10.1186/1741-7007-8-52. 
Vulule, J.M., Beach, R.F., Atieli, F.K., Roberts, J.M., Mount, D.L., et al. (1994) Reduced 
susceptibility of Anopheles gambiae to permethrin associated with the use of permethrin-
impregnated bednets and curtains in Kenya. Med. Vet. Entomol. 8:71-75. 
Wada-Katsumata, A., Silverman, J. and Schal, C. (2013). Changes in taste neurons support the 
emergence of an adaptive behavior in cockroaches. Science 340: 972?975. 
Wang, S.Y. and Wang, G.K. (2003) Voltage-gated sodium channels as primary targets of diverse 
lipid-soluble neurotoxins. Cell Signal 15:151?159. 
163 
 
Warren, J.T., Petryk, A., Marques, G., Jarcho, M., Parvy, J.P., et al. (2002) Molecular and 
biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of 
Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 99: 11043?11048. doi: 
10.1073/pnas.162375799.  
Warren, J.T., Petryk, A., Marques, G., Parvy, J.P., Shinoda, T., et al. (2004) Phantom encodes the 
25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in 
ecdysone biosynthesis. Insect Biochem. Mol. Biol. 34: 991?1010. 
Warren, K.S. and Mahmoud, A.A.F. (1990) Tropical and Geographical Medicine, (2nd ed.). 
McGraw-Hill, New York, NY. 
Weill, M., Lutfalla, G., Mogensen, K., Chandre, F., Berthomieu, A., et al. (2003) Comparative 
genomics: insecticide resistance in mosquito vectors. Nature 423:136?137.  
Weill, M., Malcolm, C., Chandre, F. Mogensen, K., Berthomieu, A., et al. (2004) The unique 
mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors, 
Insect Mol. Biol. 13: 1?7. 
Wheelock, G.D. and Hagedorn, H.H. (1985) Egg maturation and ecdysiotropic activity in 
extracts of mosquito (Aedes aegypti) heads. Gen. Comp. Endocrinol. 60:196-203. 
White, R.E. and Coon, M.J. (1980) Oxygen activation by cytochrome P-450. Annu. Rev. 
Biochem. 49: 315?356. 
Wilkins, R.M., Ahmed, S. and Mantle, D. (1999) Comparative effect of fenitrothion treatment on 
intracellular protease activities in insecticide-resistant and susceptible strains of Musca 
domestica L. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endrocrinol. 124: 337-343. 
Williams, F.M. and Patterson, R.S. (1969). Effect of age on mating of Culex pipiens 
quinquefasciatus. Florida Entomol. 52:259-261. 
164 
 
Williamson, M.S., Denholm, I., Bell, C.A. and Devonshire, A.L. (1993) Knockdown resistance 
(kdr) to DDT and pyrethroid insecticides maps to a sodium channel gene locus in the 
housefly (Musca domestica). Molec. Gen. Genet. 240: 17?22.  
Wood, O.R., Hanrahan, S., Coetzee, M., Koekmoer, L.L. and Brooke, B.D. (2010) Cuticle 
thickening associated with pyrethroid resistance in the major malaria vector Anopheles 
funestus. Parasit. Vect. 3: 1?7. 
World Health Organization (1957) Expert committee on insecticides. WHO Tech Rpt Ser 7th 
Rpt. 
Wu, H.-W., Tian, H.-S., Wu, G.-L., Langdon, G., Kurtis, J., et al. (2004) Culex pipiens pallens: 
identification of genes differentially expressed in deltamethrin-resistant and -susceptible 
strains. Pesticide Biochem. Physiol. 79: 75-83. 
Xu, Q., Liu, H., Zhang, L. and Liu, N. (2005) Resistance in the mosquito, Culex 
quinquefasciatus, and possible mechanisms for resistance. Pest Manag. Sci. 61: 1096-1102. 
Xu, Q., Wang, H., Zhang, L., Liu, N. (2006a) Sodium channel gene expression associated with 
pyrethroid resistant house flies and German cockroaches. Gene 379: 62?67. 
Xu, Q., Wang, H., Zhang, L. and Liu, N. (2006b) Kdr allelic variation in pyrethroid resistant 
mosquitoes, Culex quinquefasciatus (S.). Biochem. Biophys. Res. Comm. 345: 774-780. 
Xu, Q., Zhang, L., Li, T., Zhang, L., He, L., et al. (2012a). Evolutionary adaptation of the amino 
acid and codon usage of the mosquito sodium channel following insecticide selection in the 
field mosquitoes. PloS ONE, 7: e47609. 
Xu, Q., Lu, A., Xiao, G., Yang, B., Zhang, J., et al. (2012b). Transcriptional profiling of midgut 
immunity response and degeneration in the wandering silkworm, Bombyx mori. PLoS ONE 7: 
e43769.  
165 
 
Yu, S.J. and Nguyen, S.N. (1996) Insecticide susceptibility and detoxification enzyme activities 
in permethrin-selected diamondback moths. Pestic. Biochem. Physiol. 56:69-74. 
Yang, T. and Liu, N. (2011). Genome analysis of cytochrome P450s and their expression profiles 
in insecticide resistant mosquitoes, Culex quinquefasciatus. PloS ONE 6: e29418. 
Yu, S.J. (2002) Biochemical characteristics of microsomal and cytosolic glutathione S-transferases 
in the fall armyworm, Spodoptera frugiperda (J.E. Smith). Pestic. Biochem. Physiol. 72:100-
110. 
Yu, S.J. (2008) The toxicology and biochemistry of insecticides. CRC Press. Boca Raton, FL. 
Zhang, H.G., ffrench-Constant, R.H. and Jackson, M.B. (1994) A unique amino acid of the 
Drosophila GABA receptor with influence on drug sensitivity by two mechanisms. J. 
Physiol. 479:65-75. 
Zhang, J., Goyer, C. and Pelletier, Y. (2008) Environmental stresses induce the expression of 
putative glycine-rich insect cuticular protein genes in adult Leptinotarsa decemlineata (Say). 
Insect Mol. Biol. 17: 209?216. 
Zhu, F., Feng, J., Zhang, L., Liu, N. (2008a) Characterization of two novel cytochrome P450 
genes in insecticide resistant house flies. Insect Mol. Biol. 20: 1365-1583. 
Zhu, F., Li, T., Zhang, L., Liu, N. (2008b) Co-up-regulation of three P450 genes in response to 
permethrin exposure in permethrin resistant house flies, Musca domestica. BMC Physiol. 
doi:10.1186/1472-6793-8-18. 
Zhu, F. and Liu, N. (2008) Differential expression of CYP6A5 and CYP6A5v2 in pyrethroid-
resistant house flies, Musca domestica. Arch. Insect Biochem. Physiol. 34: 147-161. 
Zhu, F., Parthasarathy, R., Bai, H., Woithe, K., Kaussmann, M., et al. (2010) A brain specific 
cytochrome P450 responsible for the majority of deltamethrin resistance in the QTC279 
166 
 
strain of Tribolium castaneum. Proc. Natl. Acad. Sci. USA 107:8557-8562. 
Zhu, F., Gujar, H., Gordon, J.R., Haynes, K.F., Potter, M.F. et al. (2013) Bed bugs evolved 
unique adaptive strategy to resisit pyrethroid insecticides. Sci. Rep. 3:1456. doi:10.1038. 
Zinser, M., Ramberg, F. and Willott, E. (2004) Culex quinquefasciatus (Diptera: Culicidae) as a 
potential West Nile virus vector in Tucson, Arizona: blood meal analysis indicates feeding on 
both humans and birds. J. Insect Sci. 4: 20. 
  
167 
 
Appendix 3.1. List and sequences of the qRT-PCR primers used. 
Gene* Sense primer (5' to 3') Antisense primer (5' to 3') 
18S rRNA CGCGGTAATTCCAGCTCCACTA GCATCAAGCGCCACCATATAGG 
CPIJ002802 CTGCATGAAGCTCCGTTGT AGGTGCTCTCGTGGGTAGC 
CPIJ002795 ACGCTCCAGCTCTGTCGTA GTGTAGCTGGTGGCGTGAG 
CPIJ011785 AGCTGGTGTTCCAGGTGTTC AGCTTTTGTTGGGGATTGTG 
CPIJ002943 ATGAGTAACGAGTTCCAGGAGTTG TTCTCGAACAAAATATCGACAAAC 
CPIJ001979 CGAGTCTACCTACACTGGGAAGAT TAATTCCAGCTTGATGGTTCACTA 
CPIJ014110 CAACGGTACTACATCTTTCACCAA ATGTTTGTTTCCAAATGGGTACTT 
CPIJ004594 GGATTTCGGTAAATTTGAAGATGT TTTTCGTACGTCATTTTAAACAGC 
CPIJ014719 TTCAAGGGAACCTGGAAGC ACGCGTTGAGCTCTTCAAA 
CPIJ004323 AAAAGTTCCGACCGGTGAC CGAGGTGTGTCCCATTGAC 
CPIJ002139 TAATCTGTCGTGTCAATTGTCGTA GGAAGCTATGTATTCCGATGAGAT 
CPIJ002942 GACTATGGCAGTGTGATGCACTA CAAGCACCCATACATCAAGTTTAG 
CPIJ001111 ACTGGTTATTCAGCGGTGTACTTT TTTGATCCAAGGAAGATACGTTTT 
CPIJ018037 GGATGTGGTCAGACTGGGTAGTAT AAACGCTACATCTCTCTCCAACTT 
CPIJ006543 AGGTTGATGAGGAGGAGAATACAG GGATAGATATGCTCATCGTGGAAC 
CPIJ002130 GTGGAGGTTCTAAAATTTCCAGTG TCAGGACAAACGTAGACGAAATTA 
CPIJ013319 CTACTACGGTAGCGTGATGCACTA ACATGTAGTTGACTGCAAGGATGT 
CPIJ009106 CAAACCAGAAGAGTACAACTGTCG GTAGGACACAAAGTAGCGCAGATA 
CPIJ001240 AGGACGTGAATATCGTTCTGAAAT GTTCTGATAGATCTCGGCTTTCAT 
CPIJ019428 GGTTCAATAATATCCGAACGATG GGATGCACGAAGATACTACGAAC 
CPIJ004086 TTGAGACGTACAATCAGCAATTTT TTGTTGTAATTCTCCTGCACAAAT 
CPIJ008873 CAGTGAGCTGTTCAATACCTGTTC GAGTTTGACAGAGCCTATCGGTAT 
CPIJ002135 TTCAACGACTATGTTCAACCAATC CGTATACCTCACCATGTCAGATTC 
CPIJ016012 GGGAGTTATGTTGAGGACTTGAAA GAAGGGTGGCACAGTTATTTATTC 
CPIJ002142 TGAAATCCTTAGTAGTGCTTGCAG TGACCAGAGAGAAGGATGTTGATA 
CPIJ006803 GGTAATCTGGTGGAGAGTGACAT AATGAAGTGACGTTCGGTTTTATT 
CPIJ007383 TTTGGTTGACATTGAAAACACTCT AGCTCTCGTTTCATCTTCTTGATT 
CPIJ010224 GAACTATTCGAGACCGGTAGTGAT GTGAAATTTGCTCCTCAAACACTT 
CPIJ014523 TTTTAACGATTACGTTCAACCTGT AATCTCTGGCGCCATAATAGTAAC 
CPIJ019029 CTACACCAACAACAAGTGGAACA GGTTCACGTAGATGTACTCGTCAC 
CPIJ002128 TTGTTATTCTTCTCACAGCAGCTC CATAGTCATACCATTGGTCCAGTC 
CPIJ006542 TGTCGACGAATCAGTTCACTTTAT CACTTCAAAGTGGGTAGCTGAAC 
CPIJ010805 ATTGGAACTACTCATGAGGGAAGA AGATGCATAATGGTCATAATGGTG 
CPIJ006076 CTGAAAACAACACAACCTATGGTC ATTCTCGGAAACCTCTCCACTAAC 
CPIJ001743 GCCTTTGGATGGACTGACTACTAC CTTGTGGGATAGTTTTACCACCTT 
CPIJ003623 CAGTCGAGTAAACATCACCGATAG GACCAAATGAAGTTATGCCGTACT 
CPIJ001742 TGATTTTGAGGAACTTACAACGAA AGATTTCAGCCGTGGAGTAGTAGT 
CPIJ009594 GAAGTATCAGACAACCGCATTCTA TTTCAAGTTGTTCATCACTGGTCT 
CPIJ018233 GTCTGCTTGGGTTCTTCAGC CGTCACATTGTTCGGATCAC 
CPIJ006166 AAGGGAACGTCGGATGAAG CCTTGTCCATCAGCCAGAA 
CPIJ001820 GTTGAATTCTACAAGCACGGTATG CGTAGTAGAAAACGTGGAACAGAG 
CPIJ000056 GAGCTACCTGCCATACTACACCTT GAAGAAGTCAAAGTACGTGAGCAG 
CPIJ009033 ATCGACTTCAGCTATTTCTTCACC GTCGGTAGTGTTTAGTACGACGTG 
CPIJ009032 AGTTGAGATCAAGGAGTTTTCCAG GGGAGTTCTTGTAGTTGAAGGGTA 
CPIJ007783 ACTACCAATTCAAGGATCACCTTC AGTATGTGACCAACTTGTCAATGG 
*Culex quinquefasciatus genome, Johannesburg strain CpipJ1.2, June 2008; 
http://cquinquefasciatus.vectorbase.org/ 
 
 
 
 
168 
 
  
169 
 
 
Appendix 3.2. Lognormal distributions for expressed genes in HAmCqG0 and HAmCqG8 by 
superfamily. 
Superfamily? Strain N? median mean modality kurtosis skewness 
(Trans)glycosidases HAmCqG0 46 1.64 1.60 bimodal -0.51 0.14 
 HAmCqG8 45 1.53 1.55 bimodal -0.42 0.29 
Acetyl-CoA synthetase-like HAmCqG0 38 1.17 1.17 unimodal* -0.86 -0.31 
 HAmCqG8 34 1.16 1.19 unimodal -0.50 -0.17 
Acyl-CoA dehydrogenase C- HAmCqG0 5 1.54 1.46 unimodal* -2.96 -0.32 
terminal domain-like HAmCqG8 5 1.67 1.50 unimodal 4.06 -2.01 
Acyl-CoA N-acyltransferases HAmCqG0 41 1.17 1.18 unimodal* -0.70 -0.05 
HAmCqG8 43 1.04 0.95 unimodal* -1.04 0.02 
ALDH-like HAmCqG0 12 1.81 1.90 bimodal -0.17 0.70 
 HAmCqG8 14 1.82 1.85 unimodal* -0.71 0.29 
Alkaline phosphatase-like HAmCqG0 21 1.04 1.13 bimodal -0.07 0.60 
 HAmCqG8 21 0.86 0.99 bimodal 0.30 1.07 
alpha/beta-Hydrolases HAmCqG0 109 1.17 1.26 unimodal -0.07 0.54 
 HAmCqG8 98 1.17 1.20 unimodal* 0.41 0.70 
Ankyrin repeat HAmCqG0 85 0.79 0.82 unimodal -0.53 0.29 
 HAmCqG8 78 0.70 0.73 unimodal -0.38 0.44 
Arginase/deacetylase HAmCqG0 9 0.69 0.88 unimodal* -0.78 0.25 
 HAmCqG8 7 1.02 0.85 bimodal -0.60 -0.90 
ARID-like HAmCqG0 6 1.12 1.09 unimodal 1.77 -1.05 
 HAmCqG8 6 0.82 0.74 unimodal 0.04 -1.04 
ARM repeat HAmCqG0 136 1.22 1.25 unimodal 0.07 0.14 
 HAmCqG8 133 1.03 1.10 unimodal 0.57 0.71 
C-type lectin-like HAmCqG0 33 1.17 1.39 multimodal -1.06 0.40 
 HAmCqG8 28 1.50 1.41 multimodal -0.72 0.20 
C2H2 and C2HC zinc fingers HAmCqG0 515 0.71 0.73 unimodal 0.06 0.46 
 HAmCqG8 495 0.50 0.56 unimodal 0.55 0.71 
Cadherin-like HAmCqG0 14 1.07 1.00 unimodal* -1.05 -0.10 
 HAmCqG8 14 0.80 0.86 bimodal -0.91 0.49 
Calcium ATPase,  HAmCqG0 14 1.36 1.48 bimodal -0.81 0.33 
transmembrane domain M HAmCqG8 12 1.20 1.47 bimodal 0.75 1.18 
cAMP-binding domain-like HAmCqG0 15 0.69 0.81 bimodal -1.49 0.28 
 HAmCqG8 14 0.49 0.48 unimodal* -1.30 0.35 
Chaperone J-domain HAmCqG0 20 1.20 1.29 unimodal* -0.97 0.12 
 HAmCqG8 21 1.07 1.02 unimodal* 0.10 0.54 
Chemosensory protein Csp2 HAmCqG0 28 1.81 1.71 bimodal -0.94 -0.20 
 HAmCqG8 23 1.66 1.64 bimodal -1.52 -0.04 
Concanavalin A-like  HAmCqG0 45 0.85 0.95 unimodal* 0.58 0.77 
lectins/glucanases HAmCqG8 39 0.73 0.92 unimodal 0.04 0.89 
CRAL/TRIO domain HAmCqG0 48 1.17 1.18 unimodal 0.56 0.54 
 HAmCqG8 43 1.08 1.04 unimodal* 1.11 0.73 
Cysteine proteinases HAmCqG0 62 1.27 1.31 unimodal 0.37 0.65 
 HAmCqG8 60 1.08 1.17 unimodal 0.57 0.76 
Cytochrome b5-like  HAmCqG0 11 1.50 1.42 unimodal -0.60 -0.35 
heme/steroid binding domain HAmCqG8 12 1.17 1.15 bimodal -0.18 -0.51 
Cytochrome P450 HAmCqG0 143 1.10 1.11 unimodal -0.68 0.08 
 HAmCqG8 136 1.21 1.22 unimodal -0.70 0.20 
Di-copper center-containing  HAmCqG0 14 2.13 2.41 multimodal 1.25 -0.22 
domain HAmCqG8 13 3.01 3.06 multimodal -0.91 0.19 
DNA/RNA polymerases HAmCqG0 11 0.81 0.89 unimodal 1.07 -0.10 
170 
 
 HAmCqG8 10 0.69 0.80 unimodal -0.25 0.84 
E set domains HAmCqG0 51 1.56 1.74 unimodal -0.26 0.62 
 HAmCqG8 49 1.39 1.69 unimodal -0.40 0.65 
EF-hand HAmCqG0 51 1.19 1.30 unimodal -0.40 0.60 
 HAmCqG8 48 0.88 1.24 unimodal -0.14 0.94 
EGF/Laminin HAmCqG0 15 0.96 1.00 unimodal 1.73 0.97 
 HAmCqG8 14 0.49 0.62 unimodal* -1.10 0.58 
F-box domain HAmCqG0 19 0.72 0.76 unimodal* -0.78 0.45 
 HAmCqG8 18 0.57 0.66 unimodal 1.10 1.00 
FAD-binding domain HAmCqG0 7 0.36 0.65 bimodal 0.93 1.32 
 HAmCqG8 7 0.59 0.90 bimodal 0.63 1.24 
FAD/NAD(P)-binding domain HAmCqG0 51 1.28 1.27 unimodal -0.20 -0.03 
 HAmCqG8 48 1.15 1.18 unimodal* -0.13 0.53 
Family A G protein-coupled  HAmCqG0 31 0.59 0.56 unimodal* 0.96 0.86 
receptor-like HAmCqG8 21 0.27 0.47 unimodal 2.06 1.50 
Ferritin-like HAmCqG0 14 1.69 1.67 bimodal -0.02 0.54 
 HAmCqG8 14 1.69 1.79 unimodal* -1.02 0.45 
Fibrinogen C-terminal domain- HAmCqG0 42 0.99 1.03 unimodal* -0.66 0.41 
like HAmCqG8 38 0.94 0.94 unimodal* -0.65 0.27 
Fibronectin type III HAmCqG0 32 0.55 0.64 unimodal* -0.30 0.54 
 HAmCqG8 26 0.53 0.51 unimodal* -0.51 0.46 
FnI-like domain HAmCqG0 9 0.95 0.93 unimodal 0.70 0.41 
 HAmCqG8 7 0.57 0.80 unimodal* 1.47 1.46 
FYVE/PHD zinc finger HAmCqG0 32 1.09 0.95 unimodal* -0.55 -0.64 
 HAmCqG8 32 0.76 0.74 unimodal 1.24 0.44 
Galactose mutarotase-like HAmCqG0 7 1.68 1.36 multimodal -0.57 -0.71 
 HAmCqG8 7 1.38 1.31 multimodal -0.04 0.72 
Glucocorticoid receptor-like HAmCqG0 154 0.85 0.87 unimodal 0.99 0.63 
(DNA-binding domain) HAmCqG8 147 0.66 0.72 unimodal 1.54 1.02 
Glutamine synthetase/guanido  HAmCqG0 5 1.75 1.92 bimodal 1.20 1.04 
kinase HAmCqG8 5 1.56 1.99 bimodal 2.73 1.69 
Glutathione S-transferase  HAmCqG0 29 1.66 1.57 unimodal -0.20 -0.59 
(GST), C-terminal domain HAmCqG8 27 1.54 1.52 unimodal* -0.96 -0.07 
Growth factor receptor domain HAmCqG0 11 1.18 1.09 unimodal 0.14 0.30 
 HAmCqG8 11 0.77 0.92 unimodal* -0.35 0.88 
HAD-like HAmCqG0 21 1.23 1.26 unimodal 1.37 0.59 
 HAmCqG8 22 0.97 1.01 unimodal 1.76 0.90 
Histone-fold HAmCqG0 43 0.74 0.80 unimodal* 1.28 1.01 
HAmCqG8 32 0.64 0.70 unimodal 1.86 1.16 
HLH, helix-loop-helix DNA- HAmCqG0 32 1.19 1.08 unimodal* -0.64 0.06 
binding domain HAmCqG8 28 0.81 0.90 unimodal* -0.88 0.33 
HMG-box HAmCqG0 23 0.98 1.06 unimodal 1.80 0.63 
 HAmCqG8 23 0.60 0.74 unimodal* 1.52 0.99 
Homeodomain-like HAmCqG0 85 0.66 0.66 unimodal -0.52 0.35 
 HAmCqG8 57 0.54 0.57 unimodal 0.12 0.69 
Immunoglobulin HAmCqG0 61 0.54 0.64 unimodal* -0.53 0.69 
 HAmCqG8 30 0.65 0.68 unimodal -0.90 0.32 
Insect pheromone/odorant- HAmCqG0 47 0.97 1.14 unimodal 0.01 0.76 
binding proteins HAmCqG8 39 1.00 1.14 unimodal* 1.31 1.06 
Invertebrate chitin-binding HAmCqG0 103 2.19 2.03 unimodal* -0.44 -0.40 
 HAmCqG8 102 2.05 1.87 unimodal* -0.63 -0.38 
L domain-like HAmCqG0 102 0.97 0.99 unimodal -0.68 0.27 
 HAmCqG8 87 0.99 1.01 unimodal 0.55 0.62 
Ligand-binding domain in NO  HAmCqG0 6 1.12 0.99 bimodal -2.30 -0.34 
signaling and Golgi transport HAmCqG8 6 0.70 0.72 unimodal* -1.82 0.24 
Lipocalins HAmCqG0 15 1.30 1.42 unimodal* -0.60 0.25 
171 
 
 HAmCqG8 15 1.36 1.36 multimodal 0.55 -0.05 
Lysozyme-like HAmCqG0 4 1.40 1.48 unimodal 3.22 1.70 
 HAmCqG8 5 1.58 1.49 bimodal 2.67 -1.43 
Metallo-dependent hydrolases HAmCqG0 11 1.41 1.44 unimodal -0.59 -0.09 
 HAmCqG8 11 1.21 1.20 unimodal* 0.02 -0.60 
Metallo-dependent HAmCqG0 23 1.28 1.34 unimodal 0.38 0.51 
phosphatases HAmCqG8 22 1.16 1.26 unimodal* 0.09 0.63 
Metalloproteases ("zincins") HAmCqG0 49 1.40 1.33 unimodal* -0.91 0.11 
 HAmCqG8 47 1.35 1.38 unimodal* -1.01 0.25 
MFS general transporter HAmCqG0 148 1.08 1.05 unimodal 0.41 0.42 
 HAmCqG8 140 0.87 0.96 unimodal 0.94 0.66 
Myosin rod fragments HAmCqG0 5 1.31 1.26 multimodal 0.88 -0.20 
 HAmCqG8 5 1.12 1.16 bimodal 1.51 0.95 
N-acetylmuramoyl-L-alanine  HAmCqG0 9 1.56 1.70 multimodal -0.05 1.18 
amidase-like HAmCqG8 10 0.90 1.42 bimodal 0.56 1.33 
NAD(P)-binding Rossmann HAmCqG0 119 1.45 1.39 unimodal* -0.16 -0.11 
 HAmCqG8 115 1.23 1.25 unimodal 0.51 0.22 
NAD(P)-linked oxidoreductase HAmCqG0 15 1.47 1.45 unimodal* -0.22 -0.55 
 HAmCqG8 14 1.28 1.29 unimodal 0.22 -0.30 
NAP-like HAmCqG0 8 0.73 0.95 multimodal 0.22 0.96 
 HAmCqG8 8 0.85 0.94 bimodal 2.98 1.36 
Neurotransmitter-gated ion- HAmCqG0 10 0.34 0.50 unimodal 0.17 0.99 
channel transmembrane pore HAmCqG8 3 0.32 0.53 bimodal 0.00 1.38 
Nicotinic receptor ligand HAmCqG0 11 0.62 0.69 unimodal* -0.93 0.66 
binding domain-like HAmCqG8 7 0.94 0.90 unimodal* -0.53 0.09 
Nuclear receptor ligand-bind HAmCqG0 18 0.94 0.81 bimodal -1.57 -0.21 
 HAmCqG8 12 0.83 0.74 unimodal* -0.56 -0.36 
Nucleotide-diPO4-sugar transf HAmCqG0 38 0.96 1.03 unimodal -0.38 0.50 
 HAmCqG8 39 0.81 0.84 unimodal -0.01 0.61 
Outer arm dynein light chain 1 HAmCqG0 7 0.96 0.86 unimodal* -0.83 -0.18 
 HAmCqG8 8 0.62 0.61 unimodal -1.21 0.20 
P-loop nucleotide hydrolases HAmCqG0 427 1.09 1.14 unimodal 1.89 0.89 
 HAmCqG8 407 0.90 0.99 unimodal 3.57 1.41 
PDZ domain-like HAmCqG0 44 0.92 0.97 unimodal -0.50 0.07 
 HAmCqG8 36 0.74 0.79 unimodal -0.41 0.48 
Phosphoglycerate mutase-like HAmCqG0 15 1.32 1.29 multimodal 0.08 -0.35 
 HAmCqG8 14 1.14 1.24 unimodal 2.17 1.23 
Phospholipase A2, PLA2 HAmCqG0 6 0.85 0.87 unimodal 1.33 0.29 
 HAmCqG8 7 0.34 0.31 unimodal 4.53 -1.96 
PLC-like phosphodiesterases HAmCqG0 9 0.79 0.87 unimodal* -0.94 0.10 
 HAmCqG8 8 0.67 0.86 bimodal 1.14 1.18 
PLP-binding barrel HAmCqG0 7 0.92 1.20 bimodal 4.16 2.04 
 HAmCqG8 6 1.14 1.33 bimodal 3.56 1.86 
PLP-dependent transferases HAmCqG0 36 1.74 1.65 bimodal -0.52 -0.40 
HAmCqG8 38 1.61 1.49 bimodal -0.76 -0.39 
PR-1-like HAmCqG0 7 0.80 0.86 multimodal -1.39 0.29 
 HAmCqG8 8 0.70 0.95 bimodal -1.91 0.32 
Protein kinase-like (PK-like) HAmCqG0 254 0.97 0.98 bimodal 0.52 0.53 
 HAmCqG8 247 0.79 0.84 bimodal 0.27 0.58 
Proton glutamate symporter HAmCqG0 5 0.95 0.84 unimodal 0.51 -0.85 
 HAmCqG8 4 0.92 1.00 unimodal 2.51 1.59 
Quinoprotein ADH-like HAmCqG0 14 1.10 1.02 bimodal 0.20 -0.93 
 HAmCqG8 13 0.82 0.91 unimodal* 0.12 -0.53 
Retrovirus zinc finger-like HAmCqG0 10 1.06 1.08 bimodal 4.49 1.83 
 HAmCqG8 10 0.99 1.00 bimodal 3.18 0.86 
Ribonuclease H-like HAmCqG0 27 1.12 1.13 unimodal -0.71 -0.26 
172 
 
 HAmCqG8 27 0.89 0.98 unimodal -0.39 -0.37 
RING/U-box HAmCqG0 90 1.12 1.08 unimodal 1.17 0.41 
 HAmCqG8 92 0.82 0.83 unimodal 0.97 0.52 
RNA-binding domain HAmCqG0 131 1.25 1.23 unimodal -0.02 -0.06 
 HAmCqG8 120 1.01 1.04 unimodal 0.46 0.30 
RNI-like HAmCqG0 83 0.71 0.73 unimodal -0.80 0.18 
 HAmCqG8 80 0.63 0.68 unimodal -0.78 0.21 
SAM-methyltransferases HAmCqG0 68 1.14 1.13 unimodal -0.16 -0.18 
 HAmCqG8 67 0.93 0.93 unimodal 0.26 0.26 
Serine protease inhibitors HAmCqG0 5 2.39 1.97 bimodal -2.70 -0.59 
 HAmCqG8 5 2.55 2.03 bimodal 3.08 -1.77 
SET domain HAmCqG0 40 0.91 0.82 unimodal* -1.05 -0.13 
 HAmCqG8 43 0.71 0.63 unimodal -0.92 0.16 
Six-hairpin glycosidases HAmCqG0 11 1.46 1.48 unimodal* -0.06 -0.56 
HAmCqG8 10 1.71 1.64 unimodal* -0.99 -0.01 
Sterol carrier protein HAmCqG0 7 3.32 2.65 bimodal -1.04 -0.97 
 HAmCqG8 7 3.40 2.70 multimodal -1.12 -0.82 
Terpenoid cyclases HAmCqG0 6 1.30 1.13 unimodal* -1.69 -0.86 
 HAmCqG8 6 1.10 1.07 unimodal* -0.53 0.27 
Thiolase-like HAmCqG0 12 1.73 1.70 unimodal -1.03 -0.14 
 HAmCqG8 12 1.58 1.58 unimodal -1.11 0.22 
Thioredoxin-like HAmCqG0 58 1.64 1.69 unimodal 0.62 -0.40 
 HAmCqG8 58 1.52 1.50 unimodal -0.50 -0.20 
TPR-like HAmCqG0 74 1.17 1.17 unimodal 0.17 -0.14 
 HAmCqG8 67 1.07 1.10 unimodal 0.75 0.37 
TRAF domain-like HAmCqG0 16 1.00 0.88 unimodal -0.17 -0.73 
 HAmCqG8 15 0.87 0.86 unimodal -1.04 0.20 
Translation proteins HAmCqG0 13 0.51 1.19 bimodal 0.03 1.15 
 HAmCqG8 9 0.92 1.54 bimodal -1.02 0.87 
Tropomyosin HAmCqG0 9 0.93 1.12 bimodal 2.29 1.40 
 HAmCqG8 11 0.68 0.92 bimodal 5.73 2.21 
Trypsin-like serine proteases HAmCqG0 217 1.22 1.27 unimodal 0.06 0.66 
 HAmCqG8 205 1.07 1.20 unimodal 0.18 0.85 
Tubulin nucleotide-binding HAmCqG0 10 1.97 1.90 multimodal -1.00 -0.51 
 HAmCqG8 11 1.80 1.63 unimodal* -1.07 -0.12 
UBA-like HAmCqG0 11 1.03 1.09 unimodal 2.27 0.17 
 HAmCqG8 10 1.05 1.01 unimodal -0.08 0.42 
Ubiquitin-like HAmCqG0 33 1.42 1.60 unimodal -0.22 0.47 
 HAmCqG8 32 1.36 1.48 unimodal 0.11 0.66 
UDP-Glycosyltransferase HAmCqG0 29 1.38 1.29 unimodal 0.32 -0.52 
 HAmCqG8 33 1.08 1.08 unimodal* -1.08 -0.09 
vWA-like HAmCqG0 13 1.02 1.11 unimodal* -0.86 0.10 
 HAmCqG8 14 0.92 0.96 unimodal* -0.94 -0.15 
WD40 repeat-like HAmCqG0 183 1.06 1.06 unimodal 1.91 0.65 
 HAmCqG8 173 0.89 0.91 unimodal 3.28 1.06 
Winged helix DNA-binding HAmCqG0 57 1.20 1.26 unimodal* 0.89 0.55 
 HAmCqG8 56 0.92 1.07 unimodal* 1.41 0.96 
WW domain HAmCqG0 10 0.86 0.99 unimodal* -0.28 0.62 
HAmCqG8 11 0.67 0.64 unimodal 1.01 1.11 
Zn-dependent exopeptidases HAmCqG0 40 1.54 1.58 unimodal 0.86 -0.01 
 HAmCqG8 41 1.54 1.54 unimodal 0.15 -0.38 
**Carboxylesterases HAmCqG0 17 1 1.12 unimodal*   1.19 0.94 
 HAmCqG8 16 0.71 1.03 bimodal 3.22 1.51 
?Superfamilies from Structural Classification of Proteins (v1.73) 
?Total number of genes detected within the superfamily 
*unimodal, but shouldered distribution 
173 
 
**Not a SCOP superfamily classification. Genes were grouped based on Vectorbase annotation as carboxylesterases. 
174 
 
Appendix 3.3. Complete list of all differentially upregulated genes? in HAmCqG8. 
General 
function* 
Detailed function Superfamily Gene 
accession** 
CpipJ_1.2 annotation HAmCqG8 
FPKM 
Fold FPKM 
relative to 
HAmCqG0  ? 
Extra-cellular 
processes 
Cell adhesion C-type lectin-like CPIJ000449 galactose-specific C-type lectin  52.0 38.6  
   CPIJ015401 galactose-specific C-type lectin  54.1 42.6  
   CPIJ017075 galactose-specific C-type lectin  2.2 -  
   CPIJ019507 salivary C-type lectin  23.8 5.2  
  Cadherin-like CPIJ014101 conserved hypothetical protein  56.6 2.7  
  EGF/Laminin CPIJ014886 conserved hypothetical protein  5.2 4.4  
 Blood clotting Fibrinogen C-terminal domain-
like 
CPIJ010089 microfibril-associated glycoprotein 4  28.8 2.9  
   CPIJ012830 fibrinogen and fibronectin  121.8 6.7  
   CPIJ013294 fibrinogen and fibronectin  11.1 -  
   CPIJ015014 conserved hypothetical protein  9.4 8.3  
   CPIJ018159 fibrinogen and fibronectin  15.1 3.8  
 Cell adhesion Fibronectin type III CPIJ000838 conserved hypothetical protein  2.7 7.6  
  FnI-like domain CPIJ013195 conserved hypothetical protein  53.0 2.4  
  RNI-like CPIJ002173 conserved hypothetical protein  16.0 3.2  
   CPIJ004947 leucine-rich repeat-containing protein 1  58.7 3.5  
   CPIJ011874 predicted protein  1.3 -  
   CPIJ014115 conserved hypothetical protein  10.7 4.0  
   CPIJ014953 membrane glycoprotein LIG-1  10.5 4.0  
   CPIJ016528 conserved hypothetical protein  1.0 -  
   CPIJ019556 predicted protein  8.9 -  
General Protein interaction Ankyrin repeat CPIJ003373 predicted protein  15.5 12.0  
   CPIJ008490 ankyrin repeat domain-containing protein 44  1.3 -  
   CPIJ009398 conserved hypothetical protein  4.6 3.4  
 General ARM repeat CPIJ005388 conserved hypothetical protein  4.0 2.8  
  EF-hand CPIJ001560 calcium-binding protein  1097.9 4.4  
   CPIJ012250 troponin C  567.7 6.3  
   CPIJ016821 troponin C  497.5 4.5  
   CPIJ019636 EF-hand calcium-binding domain-containing 
protein 1  
1.5 -  
 Protein interaction F-box domain CPIJ019555 predicted protein  11.4 34.5  
 Small molecule 
binding 
FAD-binding domain CPIJ001318 d-lactate dehydrognease 2  40.5 2.2  
   CPIJ013647 alkyldihydroxyacetonephosphate synthase  4.3 3.3  
175 
 
   CPIJ016321 alkyldihydroxyacetonephosphate synthase  3.7 3.1  
   CPIJ016322 alkyldihydroxyacetonephosphate synthase  3.9 3.3  
  FAD/NAD(P)-binding domain CPIJ007620 choline dehydrogenase  132.3 2.9  
   CPIJ008048 peroxisomal N1-acetyl-spermine/spermidine 
oxidase  
14.5 2.6  
   CPIJ008445 amine oxidase  21.4 2.8  
   CPIJ017813 spermine oxidase  8.8 2.7  
  Glutathione S-transferase 
(GST), C-terminal domain 
CPIJ002663 glutathione S-transferase 1-1  354.4 2.2  
   CPIJ006160 glutathione s-transferase  173.7 2.4  
   CPIJ018631 glutathione-s-transferase theta, gst  8.3 3.7  
 General L domain-like CPIJ000315 conserved hypothetical protein  1.0 -  
   CPIJ003143 conserved hypothetical protein  14.0 2.9  
   CPIJ004946 leucine-rich repeat-containing protein 15  11.0 2.5  
   CPIJ017510 conserved hypothetical protein  914.6 7.3  
 Small molecule 
binding 
NAD(P)-binding Rossmann-
fold domains 
CPIJ003802 NADP-dependent leukotriene B4 12-
hydroxydehydrogenase  
169.2 4.0  
   CPIJ004379 steroid dehydrogenase  10.5 12.7  
  P-loop containing nucleoside 
triphosphate hydrolases 
CPIJ000853 myosin heavy chain  1750.5 3.8  
   CPIJ001520 multidrug resistance-associated protein 1  34.6 2.7  
   CPIJ003262 zinc finger protein  1.2 -  
   CPIJ004695 dynein-1-beta heavy chain  1.9 2.3  
   CPIJ009034 conserved hypothetical protein  27.0 2.3  
   CPIJ009593 conserved hypothetical protein  8.0 2.9  
   CPIJ015649 DNA-binding protein smubp-2  1.8 4.0  
   CPIJ019948 myosin vii  5.9 2.5  
 Protein interaction TPR-like CPIJ007346 TTC27 protein  37.5 2.7  
  UBA-like CPIJ011358 conserved hypothetical protein  27.9 2.8  
 General Ubiquitin-like CPIJ014273 conserved hypothetical protein  1.1 -  
  WD40 repeat-like CPIJ006339 receptor of activated protein kinase C 1  6.9 5.3  
   CPIJ012294 conserved hypothetical protein  2.0 3.5  
Information DNA 
replication/repair 
FYVE/PHD zinc finger CPIJ002070 conserved hypothetical protein  66.0 4.0  
   CPIJ011117 conserved hypothetical protein  4.3 19.5  
 Chromatin structure NAP-like CPIJ007782 nucleosome assembly protein  7.5 3.2  
 DNA 
replication/repair 
RING/U-box CPIJ000388 ubiquitin conjugating enzyme 7 interacting 
protein  
17.4 2.9  
 Chromatin structure Smc hinge domain CPIJ018617 structural maintenance of chromosomes protein 
3  
10.4 2.8  
176 
 
Intra-cellular 
processes 
Transport Ammonium transporter CPIJ013531 ammonium transporter  31.9 3.0  
 Phospholipid m/tr CRAL/TRIO domain CPIJ001321 conserved hypothetical protein  1.7 -  
   CPIJ003223 conserved hypothetical protein  43.4 2.2  
   CPIJ009746 conserved hypothetical protein  54.3 2.6  
   CPIJ014226 cellular retinaldehyde-binding protein  838.3 2.9  
 Proteases Cysteine proteinases CPIJ001239 cathepsin B  190.2 9.7  
   CPIJ001240 cathepsin B-like thiol protease  99.7 5.3  
 Ion m/tr Ferritin-like CPIJ014287 ferritin heavy chain  202.2 4.0  
 Transport Glycolipid transfer protein, 
GLTP 
CPIJ003328 conserved hypothetical protein  29.9 2.5  
  Lipocalins CPIJ013296 conserved hypothetical protein  29.2 2.7  
   CPIJ015725 apolipoprotein D  457.6 4.6  
 Proteases Metallo-dependent 
phosphatases 
CPIJ018314 5' nucleotidase  43.6 2.8  
  Metalloproteases ("zincins"), 
catalytic domain 
CPIJ001050 protease m1 zinc metalloprotease  266.9 3.6  
   CPIJ002941 high choriolytic enzyme 1  273.8 3.5  
   CPIJ002942 zinc metalloproteinase nas-12  1025.0 2.9  
   CPIJ002943 conserved hypothetical protein  202.6 4.3  
   CPIJ002945 zinc metalloproteinase dpy-31  101.1 3.8  
   CPIJ004086 angiotensin-converting enzyme  292.0 5.7  
   CPIJ006803 zinc metalloproteinase nas-7  22.5 4.5  
   CPIJ007383 endothelin-converting enzyme 1  20.1 2.5  
   CPIJ009106 angiotensin-converting enzyme  209.4 2.7  
   CPIJ012036 aminopeptidase N  30.6 3.1  
 Ion m/tr MFS general substrate 
transporter 
CPIJ001774 synaptic vesicle protein  4.9 3.4  
   CPIJ001812 sugar transporter  3.3 4.8  
   CPIJ005300 sugar transporter  2.9 9.3  
   CPIJ005372 endogenous retrovirus A receptor  3.1 4.4  
   CPIJ008813 sodium-dependent phosphate transporter  4.6 2.8  
   CPIJ014925 solute carrier family 2  20.7 2.3  
 Phospholipid m/tr PLC-like phosphodiesterases CPIJ002103 conserved hypothetical protein  78.7 2.4  
 Transport Proton glutamate symport 
protein 
CPIJ000673 glutamate transporter  22.5 2.4  
 Proteases Serine protease inhibitors CPIJ012287 hypothetical protein  89.0 4.8  
 Cell motility Tropomyosin CPIJ008188 conserved hypothetical protein  3.3 5.4  
 Proteases Trypsin-like serine proteases CPIJ000616 clip-domain serine protease  23.8 3.4  
   CPIJ000617 clip-domain serine protease  18.1 3.6  
177 
 
   CPIJ001979 conserved hypothetical protein  22.0 3.0  
   CPIJ002128 mast cell protease 2  94.1 16.1  
   CPIJ002133 trypsin epsilon  47.8 7.9  
   CPIJ002135 trypsin alpha-4  61.8 5.9  
   CPIJ002137 serine protease1/2  122.4 3.4  
   CPIJ002139 HzC4 chymotrypsinogen  559.8 4.3  
   CPIJ002140 chymotrypsin BI  205.9 3.5  
   CPIJ002142 chymotrypsin BI  5763.6 2.8  
   CPIJ002156 chymotrypsin BI  194.8 2.8  
   CPIJ003623 coagulation factor XII  15.0 7.1  
   CPIJ004594 conserved hypothetical protein  11.0 5.9  
   CPIJ005272 trypsin 3A1  2.4 -  
   CPIJ006543 urokinase-type plasminogen activator  84.5 8.2  
   CPIJ014656 coagulation factor XII  5.8 3.3  
   CPIJ016102 transmembrane protease  29.2 2.7  
   CPIJ018037 serine protease  15.7 3.9  
   CPIJ019428 trypsin 2  36.9 3.4  
  Zn-dependent exopeptidases CPIJ001742 zinc carboxypeptidase  175.1 3.0  
   CPIJ001743 carboxypeptidase A2  91.2 5.4  
   CPIJ001744 zinc carboxypeptidase  195.5 3.5  
   CPIJ001745 zinc carboxypeptidase  80.8 7.4  
   CPIJ009738 conserved hypothetical protein  73.2 2.3  
   CPIJ010805 carboxypeptidase A1  180.8 4.4  
   CPIJ014110 conserved hypothetical protein  35.1 2.4  
Metabolism Carbohydrate m/tr (Trans)glycosidases CPIJ002104 plasma alpha-L-fucosidase  25.6 3.4  
   CPIJ005060 alpha-amylase B  3837.1 2.3  
   CPIJ005725 alpha-amylase A  171.1 3.1  
   CPIJ006166 deltamethrin resistance-associated NYD-GBE  98.8 2.5  
   CPIJ008528 glycoside  hydrolase  7.6 3.9  
   CPIJ009306 neutral alpha-glucosidase ab  10.0 3.7  
 Other enzymes 3-carboxy-cis,cis-mucoante 
lactonizing enzyme 
CPIJ013577 selenium-binding protein 2  164.4 2.7  
  Acetyl-CoA synthetase-like CPIJ000791 conserved hypothetical protein  124.8 2.8  
   CPIJ006459 long-chain-fatty-acid-CoA ligase  114.8 3.5  
   CPIJ010716 luciferin 4-monooxygenase  31.1 2.2  
   CPIJ015088 4-coumarate-CoA ligase 1  34.2 2.2  
 E- transfer Acyl-CoA dehydrogenase C-
terminal domain-like 
CPIJ003059 acyl-CoA oxidase  47.2 4.0  
 Transferases Acyl-CoA N-acyltransferases 
(Nat) 
CPIJ011827 conserved hypothetical protein  1.8 -  
178 
 
 Redox ALDH-like CPIJ009438 aldehyde dehydrogenase  95.0 2.6  
 Other enzymes alpha/beta-Hydrolases CPIJ002715 lipase 3  10.4 3.2  
   CPIJ004222 pancreatic triacylglycerol lipase  1790.9 4.7  
   CPIJ007461 epoxide hydrolase  18.3 2.5  
   CPIJ007824 esterase B1  34.4 2.2  
   CPIJ008876 lysosomal pro-X carboxypeptidase  901.2 3.4  
   CPIJ016336 esterase B1  32.3 2.2  
   CPIJ019917 triacylglycerol lipase  23.0 2.8  
 Secondary 
metabolism 
Concanavalin A-like 
lectins/glucanases 
CPIJ004320 gram-negative bacteria-binding protein 1  221.8 5.6  
   CPIJ004323 gram-negative bacteria binding protein  293.4 4.1  
   CPIJ006421 conserved hypothetical protein  8.8 2.5  
   CPIJ013048 conserved hypothetical protein  2.3 -  
 E- transfer Cytochrome b5-like 
heme/steroid binding domain 
CPIJ004595 cytochrome b5  91.7 2.3  
   CPIJ005308 conserved hypothetical protein  1.4 -  
 Redox Cytochrome P450 CPIJ002538 CYP6AG12 ? 575.0 3.7  
   CPIJ005952 CYP6BB4 ? 4.0 2.8  
   CPIJ005953 CYP6BB3 ? 74.9 2.6  
   CPIJ005955 CYP6P14 ? 126.6 8.2  
   CPIJ005956 CYP6BZ2 ? 460.1 3.3  
   CPIJ005957 CYP6AA9 ? 84.9 6.6  
   CPIJ005959 CYP6AA7 ? 98.3 7.3  
   CPIJ006721 CYP4H37v ?1 56.7 2.3  
   CPIJ007188 CYP4H30 ? 27.9 2.3  
   CPIJ008566 CYP6Z15 ? 5.4 3.3  
   CPIJ009085 CYP6AG13 ? 5.9 3.4  
   CPIJ009478 CYP4D42v1 ? 59.5 2.4  
   CPIJ010225 CYP12F14 ? 30.8 3.9  
   CPIJ010227 CYP12F13 ? 67.8 7.1  
   CPIJ010537 CYP9J45 ? 109.4 4.8  
   CPIJ010538 CYP9J46 ? 35.3 7.5  
   CPIJ010542 CYP9J38 ? 19.6 8.3  
   CPIJ010543 CYP9J40 ? 297.6 7.2  
   CPIJ010544 CYP9J33 ? 58.9 3.1  
   CPIJ010546 CYP9J34 ? 50.9 13.4  
   CPIJ011127 CYP4H34 ? 9.9 2.7  
   CPIJ012470 CYP9AL1 ? 86.2 9.2  
   CPIJ014218 CYP9M10 ? 771.2 3.7  
   CPIJ015681 CYP4H37v2 ? 42.8 2.6  
179 
 
   CPIJ015958 CYP325BC1 ? 2.6 8.1  
   CPIJ017243 CYP304B4 ? 73.4 3.8  
   CPIJ017244 CYP304B5 ? 2.7 18.9  
   CPIJ020229 CYP4D42v2 ? 38.1 2.4  
  Di-copper centre-containing 
domain 
CPIJ000056 larval serum protein 1 beta chain  5111.7 4.9  
   CPIJ001820 larval serum protein 2  9964.0 4.3  
   CPIJ005187 phenoloxidase subunit 1  147.6 2.6  
   CPIJ006537 larval serum protein 1 beta chain  986.8 9.7  
   CPIJ006538 larval serum protein 1 beta chain  1170.3 10.3  
   CPIJ007783 arylphorin subunit alpha  3379.4 2.8  
   CPIJ009032 larval serum protein 2  574.1 3.3  
   CPIJ009033 arylphorin subunit C223  47162.3 2.4  
   CPIJ018824 larval serum protein 1 beta chain  1024.6 7.6  
 Coenzyme m/tr Dihydropteroate synthetase-like CPIJ003752 ficolin-2  14.8 4.1  
 Other enzymes FAH CPIJ017110 fumarylacetoacetate hydrolase  46.7 2.6  
  Fumarate reductase respiratory 
complex transmembrane 
subunits 
CPIJ004125 succinate dehydrogenase  10.6 13.5  
  Galactose mutarotase-like CPIJ004867 conserved hypothetical protein  4.7 3.2  
 Amino acids m/tr Glutamine synthetase/guanido 
kinase 
CPIJ007538 arginine kinase  4762.7 3.5  
 Other enzymes HydA/Nqo6-like CPIJ018869 NADH dehydrogenase iron-sulfur protein 7, 
mitochondrial  
206.2 2.7  
 Carbohydrate m/tr Invertebrate chitin-binding 
proteins 
CPIJ014999 conserved hypothetical protein  36.4 4.9  
 Lipid m/tr Lipovitellin-phosvitin complex, 
superhelical domain 
CPIJ001746 conserved hypothetical protein  1918.0 4.6  
 Other enzymes Lysozyme-like CPIJ018802 endochitinase A  177.0 2.6  
   CPIJ019598 basic endochitinase CHB4  77.3 4.0  
  N-acetylmuramoyl-L-alanine 
amidase-like 
CPIJ006560 peptidoglycan recognition protein-lc  4.6 -  
 Transferases Nucleotide-diphospho-sugar 
transferases 
CPIJ001091 lactosylceramide 4-alpha-galactosyltransferase  1.1 -  
 Other enzymes Phosphoglycerate mutase-like CPIJ014577 phosphoglycerate mutase 2  330.2 2.7  
 Amino acids m/tr PLP-binding barrel CPIJ009094 ornithine decarboxylase 1  16.0 3.0  
 Transferases PLP-dependent transferases CPIJ006619 cystathionine gamma-lyase  120.6 3.4  
 Secondary 
metabolism 
PR-1-like CPIJ000211 cysteine-rich secretory protein-2  2.5 -  
   CPIJ004029 venom allergen 5  72.0 6.1  
180 
 
 Other enzymes Quinoprotein alcohol 
dehydrogenase-like 
CPIJ002052 WD repeat protein 61  28.2 2.3  
 Carbohydrate m/tr Six-hairpin glycosidases CPIJ008853 maltose phosphorylase  53.8 2.2  
 Coenzyme m/tr Sterol carrier protein, SCP CPIJ012490 sterol carrier protein 2  12774.9 3.1  
 Other enzymes Thiolase-like CPIJ003495 fatty acid synthase S-acetyltransferase  7.3 2.7  
 Redox Thioredoxin-like CPIJ018667 NADH dehydrogenase flavoprotein 2, 
mitochondrial  
116.0 2.8  
 Polysaccharide m/tr UDP-
Glycosyltransferase/glycogen 
phosphorylase 
CPIJ000226 glucosyl/glucuronosyl transferase  45.1 2.3  
   CPIJ003692 glucosyl/glucuronosyl transferase  9.3 4.7  
   CPIJ006508 UDP-glucuronosyltransferase 2B4  58.0 3.5  
   CPIJ015996 ecdysteroid UDP-glucosyltransferase  3.2 7.5  
 Energy Vacuolar ATP synthase subunit 
C 
CPIJ002067 vacuolar ATP synthase subunit C  147.7 2.4  
NONA? not annotated NONA CPIJ000008 chitotriosidase-1  64.4 3.7  
   CPIJ000448 conserved hypothetical protein  5.4 6.9  
   CPIJ000494 conserved hypothetical protein  1406.6 3.4  
   CPIJ000665 galectin  223.6 3.6  
   CPIJ000852 myosin-Id  810.6 3.9  
   CPIJ000905 tetraspanin  58.7 2.4  
   CPIJ001111 proacrosin  51.7 3.3  
   CPIJ002056 adenylate cyclase type 2  3.5 2.9  
   CPIJ002117 conserved hypothetical protein  71.4 2.3  
   CPIJ002130 kallikrein-7  23.1 2.4  
   CPIJ002138 chymotrypsinogen  242.3 824.5  
   CPIJ002168 conserved hypothetical protein  43.2 2.7  
   CPIJ002247 elongation factor-1 alpha  2.3 -  
   CPIJ002359 myomesin  30.9 3.2  
   CPIJ002361 sodium/solute symporter  26.5 5.3  
   CPIJ002406 conserved hypothetical protein  2.0 -  
   CPIJ002882 conserved hypothetical protein  7.8 2.5  
   CPIJ003306 conserved hypothetical protein  1.8 12.6  
   CPIJ003317 conserved hypothetical protein  15.2 3.7  
   CPIJ003338 beta-galactosidase  101.7 3.8  
   CPIJ003485 cuticle protein  158.6 2.6  
   CPIJ004394 hypothetical protein  677.2 2.5  
   CPIJ004558 conserved hypothetical protein  6.2 22.0  
   CPIJ004600 oxidoreductase  1.5 -  
   CPIJ004927 potassium channel kcnq  2.0 -  
181 
 
   CPIJ004976 conserved hypothetical protein  5.4 5.1  
   CPIJ005090 conserved hypothetical protein  12.7 3.5  
   CPIJ005451 lysozyme  141.8 2.2  
   CPIJ005479 hypothetical protein  10.1 13.7  
   CPIJ005495 hypothetical protein  806.7 2.5  
   CPIJ005656 oxidoreductase  58.5 2.8  
   CPIJ005841 angiopoietin-1  118.2 8.2  
   CPIJ006076 hypodermin-B  11.5 17.0  
   CPIJ006150 Toll9  30.5 3.0  
   CPIJ006293 conserved hypothetical protein  16.5 2.3  
   CPIJ006294 conserved hypothetical protein  7.7 2.8  
   CPIJ006393 conserved hypothetical protein  6.4 -  
   CPIJ006515 Toll9  25.6 2.5  
   CPIJ006516 conserved hypothetical protein  17.3 9.7  
   CPIJ006542 chymotrypsin-2  64.8 19.7  
   CPIJ006585 glycoprotein  27.6 3.5  
   CPIJ006588 NADH dehydrogenase 1 alpha subcomplex 
subunit 6  
6.5 -  
   CPIJ007033 lipase  112.0 2.7  
   CPIJ007035 lipase  574.2 3.9  
   CPIJ007382 hypothetical protein  7.7 -  
   CPIJ007432 sialin  6.2 2.6  
   CPIJ007683 adam  2.5 -  
   CPIJ007721 hypothetical protein  995.1 2.9  
   CPIJ007785 conserved hypothetical protein  143.6 2.3  
   CPIJ007966 conserved hypothetical protein  19.0 2.3  
   CPIJ008031 conserved hypothetical protein  17.7 2.5  
   CPIJ008110 conserved hypothetical protein  15.8 2.6  
   CPIJ008379 conserved hypothetical protein  583.6 2.7  
   CPIJ008651 solute carrier family 41  23.4 2.7  
   CPIJ008662 conserved hypothetical protein  7.0 8.6  
   CPIJ008663 conserved hypothetical protein  243.3 2.8  
   CPIJ008807 ficolin-1  3.7 -  
   CPIJ008858 conserved hypothetical protein  38.1 3.2  
   CPIJ008873 prolylcarboxypeptidase  83.0 3.5  
   CPIJ008904 alpha-glucosidase  24.3 2.1  
   CPIJ009556 serine threonine-protein kinase  4.7 -  
   CPIJ009594 nephrosin  26.2 21.7  
   CPIJ009609 conserved hypothetical protein  20.7 2.6  
   CPIJ009683 translocator protein  106.8 2.6  
182 
 
   CPIJ009726 conserved hypothetical protein  29.9 3.1  
   CPIJ009744 conserved hypothetical protein  38.3 2.6  
   CPIJ009902 predicted protein  14.3 4.8  
   CPIJ009929 conserved hypothetical protein  14.9 2.4  
   CPIJ010224 metalloproteinase  29.4 2.9  
   CPIJ010247 raw  14.9 2.7  
   CPIJ010305 CHKov1  60.2 4.4  
   CPIJ010426 nucleoporin  2.4 12.7  
   CPIJ010563 conserved hypothetical protein  2.3 -  
   CPIJ010641 prostasin  104.0 24.2  
   CPIJ010699 cecropin A  374.4 2.7  
   CPIJ010757 conserved hypothetical protein  325.2 3.0  
   CPIJ010759 conserved hypothetical protein  1.4 -  
   CPIJ010761 conserved hypothetical protein  738.5 2.8  
   CPIJ010934 conserved hypothetical protein  252.5 2.4  
   CPIJ010987 conserved hypothetical protein  2.5 3.5  
   CPIJ011523 conserved hypothetical protein  16.0 2.8  
   CPIJ012458 chromatin assembly factor 1, p180-subunit  8.8 2.6  
   CPIJ012571 actin  1474.9 4.4  
   CPIJ012573 actin  4309.3 4.8  
   CPIJ012574 actin  97.7 2.1  
   CPIJ012700 CHKov1  5.8 5.8  
   CPIJ012899 secreted protein  91.7 2.3  
   CPIJ013085 sarcalumenin  167.6 2.5  
   CPIJ013319 metalloproteinase  132.2 3.5  
   CPIJ013351 hypothetical protein  2.0 -  
   CPIJ013355 conserved hypothetical protein  55.0 2.4  
   CPIJ013736 hypothetical protein  1306.7 3.1  
   CPIJ014184 conserved hypothetical protein  270.6 -  
   CPIJ014236 conserved hypothetical protein  1.1 -  
   CPIJ014523 elastase-3A  18.3 3.0  
   CPIJ014719 alaserpin  202.3 2.3  
   CPIJ014892 conserved hypothetical protein  29.5 2.4  
   CPIJ015171 hypothetical protein  1.5 -  
   CPIJ015328 nesprin  30.5 3.0  
   CPIJ015823 conserved hypothetical protein  1.3 -  
   CPIJ015857 NADH dehydrogenase  489.7 2.4  
   CPIJ016012 tryptase-2  190.8 2.2  
   CPIJ016374 conserved hypothetical protein  32.9 3.6  
   CPIJ016375 conserved hypothetical protein  3.7 -  
183 
 
   CPIJ016440 dihydroceramide delta (4)-desaturase 18.9 4.1  
   CPIJ016762 conserved hypothetical protein  1.0 -  
   CPIJ016914 hypothetical protein  1.6 -  
   CPIJ017076 conserved hypothetical protein  34.4 3.0  
   CPIJ017149 l(2) long form 57.7 2.9  
   CPIJ017150 l(2) long form 30.0 2.6  
   CPIJ017621 conserved hypothetical protein  1.1 -  
   CPIJ017717 conserved hypothetical protein  27.3 4.1  
   CPIJ017730 hypothetical protein  39.8 9.2  
   CPIJ018002 conserved hypothetical protein  33.5 2.1  
   CPIJ018092 ryanodine receptor 3, brain  9.5 2.5  
   CPIJ018231 carboxylesterase  81.7 3.2  
   CPIJ018233 carboxylesterase  5766.3 3.5  
   CPIJ018544 conserved hypothetical protein  5.8 20.3  
   CPIJ018724 conserved hypothetical protein  70.8 2.5  
   CPIJ018791 conserved hypothetical protein  60.3 2.9  
   CPIJ018967 conserved hypothetical protein  6.6 3.5  
   CPIJ018988 phosphatidylinositol glycan, class c  1.5 -  
   CPIJ019007 polyserase-2  10.4 2.9  
   CPIJ019029 metalloproteinase  181.5 2.6  
   CPIJ019577 alpha-actinin  361.7 2.9  
Other Unknown function Bactericidal permeability-
increasing protein, BPI 
CPIJ020308 conserved hypothetical protein  1742.1 3.1  
  E set domains CPIJ002744 conserved hypothetical protein  944.9 51.0  
   CPIJ018825 larval serum protein 1 beta chain  1061.3 9.4  
  Ligand-binding domain in the 
NO signalling and Golgi 
transport 
CPIJ004088 guanylyl cyclase receptor  7.5 3.2  
 Viral proteins Retrovirus zinc finger-like 
domains 
CPIJ006202 conserved hypothetical protein  10.0 3.4  
Regulation DNA-binding C2H2 and C2HC zinc fingers CPIJ004716 zinc finger protein 266  3.8 5.5  
   CPIJ009633 conserved hypothetical protein  7.6 3.2  
   CPIJ011598 zinc finger protein  2.1 3.5  
   CPIJ015936 hypothetical protein  2.4 -  
 Receptor activity Chemosensory protein Csp2 CPIJ002617 chemosensory protein 1  865.9 2.3  
 Signal transduction Growth factor receptor domain CPIJ005087 cell wall cysteine-rich protein  16.2 2.8  
 DNA-binding HLH, helix-loop-helix DNA-
binding domain 
CPIJ018167 sterol regulatory element-binding protein 1  39.1 2.1  
  Homeodomain-like CPIJ002050 homeobox protein  21.7 2.9  
184 
 
 Signal transduction Insect pheromone/odorant-
binding proteins 
CPIJ001872 Odorant-binding protein 56a  24.7 5.0  
   CPIJ002108 odorant-binding protein  17.2 2.7  
   CPIJ002111 Odorant-binding protein 50d  28.8 4.0  
   CPIJ004145 predicted protein  1.9 -  
   CPIJ009038 odorant binding protein 1  1.8 -  
  Nicotinic receptor ligand 
binding domain-like 
CPIJ002436 neuronal acetylcholine receptor subunit alpha-2  30.1 2.5  
  Nuclear receptor ligand-
binding domain 
CPIJ010249 retinoid X receptor alpha  24.6 2.5  
  PDZ domain-like CPIJ015336 Dlg5 protein  4.0 2.6  
 Kinases/phos-
phatases 
Protein kinase-like (PK-like) CPIJ010307 conserved hypothetical protein  31.9 20.3  
   CPIJ010319 Juvenile hormone-inducible protein  12.6 2.7  
   CPIJ010324 conserved hypothetical protein  19.5 4.2  
   CPIJ012702 conserved hypothetical protein  32.8 2.3  
   CPIJ012763 3-phosphoinositide-dependent protein kinase 1  6.3 2.7  
 RNA binding, m/tr RNA-binding domain, RBD CPIJ001827 conserved hypothetical protein  1.5 7.8  
 Signal transduction TRAF domain-like CPIJ001427 conserved hypothetical protein  28.3 2.3  
   CPIJ006152 conserved hypothetical protein  25.9 2.7  
?Differentially expressed genes represent those genes that differed in their expression level (FPKM) in HAmCqG8 by more than two fold when compared to the 
parental strain HAmCqG0. 
*SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html  
**Culex quinquefasciatus genome, Johannesburg strain CpipJ1.2, June 2008; http://cquinquefasciatus.vectorbase.org/ 
? Annotations for cytochrome P450 genes were taken from the most current annotation based on: Nelson, DR (2009) The Cytochrome P450 Homepage. Human 
Genomics 4, 59-65: http://drnelson.uthsc.edu/CytochromeP450.html 
?NONA: Not annotated 
?Fold FPKM relative to HAmCqG0 indicates the ratio of the FPKM value in HAmCqG8 divided by the FPKM value of HAmCqG0. 
 
 
 
 
 
 
 
 
185 
 
Appendix 3.4. List of genes downregulated by at least two-fold in HAmCqG8 when compared to HAmCqG0. 
Level of SCOP* classification Downregulated genes 
General 
function 
Detailed 
function Superfamily 
Gene 
Accession** Vectorbase annotation
? 
Extra-cellular 
processes Blood clotting Fibrinogen C-terminal domain-like CPIJ000868  conserved hypothetical protein  
   CPIJ001260  fibrinogen and fibronectin  
   CPIJ001908  fibrinogen and fibronectin  
   CPIJ006392  fibrinogen and fibronectin  
   CPIJ012891 scabrous protein  
   CPIJ013288  fibrinogen and fibronectin  
   CPIJ014543  conserved hypothetical protein  
   CPIJ014544  conserved hypothetical protein  
   CPIJ017657  salivary secreted angiopoietin  
   CPIJ017837  angiopoietin 2  
   CPIJ017877  fibrinogen and fibronectin  
   CPIJ018745  zinc finger protein  
   CPIJ018858  fibrinogen and fibronectin  
 Cell adhesion alpha-catenin/vinculin-like CPIJ005773  actin binding protein  
  C-type lectin-like CPIJ000443  galactose-specific C-type lectin  
   CPIJ001323  galactose-specific C-type lectin  
   CPIJ004607  conserved hypothetical protein  
   CPIJ005619  collagen alpha 1 
   CPIJ005984  conserved hypothetical protein  
   CPIJ005987  conserved hypothetical protein  
   CPIJ006092  conserved hypothetical protein  
   CPIJ012139  conserved hypothetical protein  
   CPIJ015742  conserved hypothetical protein  
   CPIJ018154  conserved hypothetical protein  
  Cadherin-like CPIJ017350  conserved hypothetical protein  
   CPIJ018739  conserved hypothetical protein  
   CPIJ018999  conserved hypothetical protein  
  EGF/Laminin CPIJ017322  conserved hypothetical protein  
   CPIJ004682  laminin subunit beta-1  
   CPIJ005569  neurogenic locus notch  
   CPIJ005673  conserved hypothetical protein  
   CPIJ009613  serrate protein  
   CPIJ009614  serrate protein  
186 
 
   CPIJ009802  conserved hypothetical protein  
   CPIJ011761  conserved hypothetical protein  
   CPIJ015361  conserved hypothetical protein  
   CPIJ019124  conserved hypothetical protein  
  FAS1 domain CPIJ003831  conserved hypothetical protein  
   CPIJ004689  conserved hypothetical protein  
  Fibronectin type III CPIJ002017  cell adhesion molecule  
   CPIJ003912  conserved hypothetical protein  
   CPIJ004128  conserved hypothetical protein  
   CPIJ005092  conserved hypothetical protein  
   CPIJ006893  myosin light chain kinase  
   CPIJ008112  cell adhesion molecule  
   CPIJ009217  roundabout 1  
   CPIJ014383  factor for adipocyte differentiation  
   CPIJ014908  host cell factor C1  
   CPIJ018836  conserved hypothetical protein  
   CPIJ020251  conserved hypothetical protein  
  FnI-like domain CPIJ005093  conserved hypothetical protein  
   CPIJ013285  conserved hypothetical protein  
   CPIJ015976  conserved hypothetical protein  
   CPIJ020078  conserved hypothetical protein  
  Immunoglobulin CPIJ003910  conserved hypothetical protein  
   CPIJ004966  conserved hypothetical protein  
   CPIJ007299  beat protein  
   CPIJ009084  conserved hypothetical protein  
   CPIJ009950  conserved hypothetical protein  
   CPIJ012166  conserved hypothetical protein  
   CPIJ012499  conserved hypothetical protein  
   CPIJ014508  conserved hypothetical protein  
   CPIJ015510  conserved hypothetical protein  
   CPIJ017558  defective proboscis extension response  
   CPIJ018083  conserved hypothetical protein  
  Integrin alpha N-terminal domain CPIJ005252  T-cell immunomodulatory protein  
   CPIJ017320  integrin alpha-PS2  
  RNI-like CPIJ002568  f-box/leucine rich repeat protein  
   CPIJ003404  conserved hypothetical protein  
   CPIJ004460  tubulin-specific chaperone  
   CPIJ014282  conserved hypothetical protein  
   CPIJ015037  conserved hypothetical protein  
   CPIJ015883  f-box/lrr protein, drome  
187 
 
   CPIJ016145  predicted protein  
   CPIJ016147  predicted protein  
   CPIJ016518  conserved hypothetical protein  
   CPIJ017031  conserved hypothetical protein  
   CPIJ017284  conserved hypothetical protein  
   CPIJ019360  predicted protein  
  SEA domain CPIJ011474  conserved hypothetical protein  
  Somatomedin B domain CPIJ000705  conserved hypothetical protein  
  Spectrin repeat CPIJ003238  conserved hypothetical protein  
   CPIJ006907  conserved hypothetical protein  
   CPIJ011432  conserved hypothetical protein  
   CPIJ013591  conserved hypothetical protein  
  TSP-1 type 1 repeat CPIJ000706  conserved hypothetical protein  
  vWA-like CPIJ004522  26S proteasome non-ATPase regulatory subunit 4  
   CPIJ005333  transport protein sec23  
   CPIJ006690  integrin beta-PS  
 Immune response Complement control module/SCR domain CPIJ005492  conserved hypothetical protein  
   CPIJ007796  conserved hypothetical protein  
   CPIJ008865  conserved hypothetical protein  
  Tetraspanin CPIJ013906  platelet endothelial tetraspan antigen 3  
   CPIJ017253  conserved hypothetical protein  
  TNF-like CPIJ011491  conserved hypothetical protein  
 Toxins/defense AhpD-like CPIJ010665  P53 regulated pa26 nuclear protein sestrin  
  omega toxin-like CPIJ000956  conserved hypothetical protein  
  Scorpion toxin-like CPIJ011918  conserved hypothetical protein  
  Snake toxin-like CPIJ011561  14.5 kDa salivary peptide  
   CPIJ011853  conserved hypothetical protein  
   CPIJ017088  activin receptor type I  
General General ARM repeat CPIJ006701  26S proteasome non-ATPase regulatory subunit 1  
   CPIJ000004  conserved hypothetical protein  
   CPIJ000739  conserved hypothetical protein  
   CPIJ001288  conserved hypothetical protein  
   CPIJ001478  pre-mRNA-splicing factor cwc22  
   CPIJ004189  conserved hypothetical protein  
   CPIJ004193  conserved hypothetical protein  
   CPIJ004613  importin subunit beta  
   CPIJ004649  cell differentiation protein rcd1  
   CPIJ004747  smaug protein  
188 
 
   CPIJ004787  FKBP12-rapamycin complex-associated protein  
   CPIJ004900  armadillo repeat-containing protein 6  
   CPIJ006132  importin alpha  
   CPIJ006316  conserved hypothetical protein  
   CPIJ006702  26S proteasome non-ATPase regulatory subunit 1  
   CPIJ007322  conserved hypothetical protein  
   CPIJ009961  stromal antigen  
   CPIJ010395  conserved hypothetical protein  
   CPIJ012523  coatomer subunit gamma  
   CPIJ012812  thyroid hormone receptor interactor 12  
   CPIJ013105  sorting nexin  
   CPIJ013982  conserved hypothetical protein  
   CPIJ014675  conserved hypothetical protein  
   CPIJ018110  conserved hypothetical protein  
   CPIJ018379  adaptin, alpha/gamma/epsilon  
   CPIJ018684  conserved hypothetical protein  
   CPIJ019706  26S proteasome non-ATPase regulatory subunit 2  
  BRCT domain CPIJ011710  conserved hypothetical protein  
  Calponin-homology domain, CH-domain CPIJ003234  conserved hypothetical protein  
   CPIJ004533  microtubule binding protein  
   CPIJ008540  muscle-specific protein 20  
  Cryptochrome/photolyase FAD-binding domain CPIJ003975  deoxyribodipyrimidine photo-lyase  
   CPIJ009455  DNA photolyase  
   CPIJ018859  cryptochrome 2  
  EF-hand CPIJ001307  predicted protein  
   CPIJ001896  conserved hypothetical protein  
   CPIJ002594  nadph oxidase  
   CPIJ004307  supercoiling factor  
   CPIJ005099  voltage-dependent p/q type calcium channel  
   CPIJ008225  conserved hypothetical protein  
   CPIJ009356  dynamin-associated protein  
   CPIJ010178  conserved hypothetical protein  
   CPIJ012251  troponin C  
   CPIJ015810  calcium-binding protein E63-1  
   CPIJ015812  calcium-binding protein E63-1  
  Kelch motif CPIJ000983  actin binding protein  
   CPIJ011586  actin binding protein  
   CPIJ011613  conserved hypothetical protein  
   CPIJ014909  host cell factor  
  L domain-like CPIJ001272  leucine-rich transmembrane protein  
189 
 
   CPIJ001895  conserved hypothetical protein  
   CPIJ003386  predicted protein  
   CPIJ003844  leucine-rich transmembrane protein  
   CPIJ004868  leucine-rich transmembrane protein  
   CPIJ005354  conserved hypothetical protein  
   CPIJ006822  leucine-rich transmembrane protein  
   CPIJ011783  conserved hypothetical protein  
   CPIJ012832  conserved hypothetical protein  
   CPIJ013310  adenylate cyclase  
   CPIJ013854  conserved hypothetical protein  
   CPIJ015804  reticulon/nogo receptor  
   CPIJ016693  ras suppressor protein 1  
   CPIJ016806  leucine rich repeat protein  
   CPIJ017602  conserved hypothetical protein  
   CPIJ018453  conserved hypothetical protein  
   CPIJ018876  leucine-rich repeat-containing protein 24  
   CPIJ019625  conserved hypothetical protein  
   CPIJ019816  conserved hypothetical protein  
  Spermadhesin, CUB domain CPIJ003741  conserved hypothetical protein  
   CPIJ015617  conserved hypothetical protein  
   CPIJ018283  conserved hypothetical protein  
  Transthyretin (synonym: prealbumin) CPIJ014057  conserved hypothetical protein  
  Ubiquitin-like CPIJ002389  transcription elongation factor B polypeptide 2  
   CPIJ003604  conserved hypothetical protein  
   CPIJ007098  ubiquitin-fold modifier 1  
   CPIJ011014  peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor protein-1  
   CPIJ011765  conserved hypothetical protein  
   CPIJ014686  conserved hypothetical protein  
   CPIJ019167  peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor protein-1  
  WD40 repeat-like CPIJ000633  conserved hypothetical protein  
   CPIJ001314  WD repeat protein 46  
   CPIJ001915  WD repeat domain 50  
   CPIJ002199  vesicle associated protein  
   CPIJ002451  WD repeat protein 57  
   CPIJ003096  WD repeat protein 7  
   CPIJ003211  WD repeat protein 51B  
   CPIJ003605  vacuolar membrane protein pep11  
   CPIJ004561  pleiotropic regulator 1  
190 
 
   CPIJ005067  G protein beta subunit  
   CPIJ005486  autophagy-specific gene 18  
   CPIJ006095  conserved hypothetical protein  
   CPIJ006523  conserved hypothetical protein  
   CPIJ007014  splicing factor 3B subunit 3  
   CPIJ007402  guanine nucleotide-binding protein subunit beta 1  
   CPIJ009226  groucho protein  
   CPIJ009392  nucleoporin Nup43  
   CPIJ009985  conserved hypothetical protein  
   CPIJ010477  conserved hypothetical protein  
   CPIJ010919  will die slowly  
   CPIJ011032  conserved hypothetical protein  
   CPIJ011061  WD repeat protein 51A  
   CPIJ011261  cell cycle control protein cwf8  
   CPIJ011322  mediator complex, 95kD-subunit  
   CPIJ011395  conserved hypothetical protein  
   CPIJ013687  conserved hypothetical protein  
   CPIJ013831  WD repeat-containing protein srw1  
   CPIJ014207  elongator complex protein 2  
   CPIJ014657  vesicle associated protein  
   CPIJ015003  predicted protein  
   CPIJ015347  receptor for activated protein kinase C  
   CPIJ015352  conserved hypothetical protein  
   CPIJ015911  conserved hypothetical protein  
   CPIJ017007  vesicle associated protein  
   CPIJ017534  serine-threonine kinase receptor-associated protein  
   CPIJ017825  wd-repeat protein  
   CPIJ018264  will die slowly  
   CPIJ018766  WD repeat domain phosphoinositide-interacting protein 2  
   CPIJ019808  receptor for activated protein kinase C  
   CPIJ020009  wd-repeat protein  
 Ion binding Amyloid beta a4 protein copper binding domain (domain 2) CPIJ008559  conserved hypothetical protein  
  ArfGap/RecO-like zinc finger CPIJ002305  arf GTPase-activating protein  
   CPIJ008955  arf GTPase-activating protein  
   CPIJ010923  conserved hypothetical protein  
  B-box zinc-binding domain CPIJ015175  predicted protein  
 Ligand binding GYF domain CPIJ001658  conserved hypothetical protein  
   CPIJ010290  CD2 antigen cytoplasmic tail-binding protein 2  
191 
 
 Protein interaction Ankyrin repeat CPIJ000121  conserved hypothetical protein  
   CPIJ000884  DNA-binding protein rfxank  
   CPIJ001854  conserved hypothetical protein  
   CPIJ002709  conserved hypothetical protein  
   CPIJ004774  developmental protein cactus  
   CPIJ004983  ga binding protein beta chain  
   CPIJ006925  conserved hypothetical protein  
   CPIJ006926  phosphatase 1 regulatory subunit 12b  
   CPIJ009794  conserved hypothetical protein  
   CPIJ010734  sex-determining protein fem-1  
   CPIJ013520  conserved hypothetical protein  
   CPIJ014438  sex-determining protein fem-1  
   CPIJ015938  conserved hypothetical protein  
   CPIJ017182  forked protein  
   CPIJ018599  transient receptor potential channel  
   CPIJ018744  ankyrin 2,3/unc44  
  BAG domain CPIJ002809  conserved hypothetical protein  
  BAR/IMD domain-like CPIJ002500  conserved hypothetical protein  
   CPIJ007107  insulin receptor tyrosine kinase substrate  
   CPIJ011282  islet cell autoantigen 1  
   CPIJ017697  endophilin b  
  Dimerization-anchoring domain of cAMP-dependent PK regulatory subunit CPIJ004553  predicted protein  
   CPIJ015945  conserved hypothetical protein  
  F-box domain CPIJ000909  conserved hypothetical protein  
   CPIJ006380  conserved hypothetical protein  
   CPIJ017453  transmembrane protein 183  
  Hemopexin-like domain CPIJ001428  matrix metalloproteinase  
   CPIJ010856  matrix metalloproteinase  
  HIV integrase-binding domain CPIJ003093  hepatoma-derived GF  
  IP3 receptor type 1 binding core, domain 2 CPIJ012217  inositol 1,4,5-trisphosphate receptor  
  POZ domain CPIJ001236  conserved hypothetical protein  
   CPIJ001455  ankyrin repeat and BTB/POZ domain-containing protein 2  
   CPIJ001669  BTB/POZ domain-containing protein 7  
   CPIJ003990  conserved hypothetical protein  
   CPIJ005014  BTB/POZ and Kelch domain-containing protein  
   CPIJ005696  serine-enriched protein  
   CPIJ007217  speckle-type poz protein  
   CPIJ007547  conserved hypothetical protein  
192 
 
   CPIJ008271  conserved hypothetical protein  
   CPIJ009395  speckle-type poz protein  
   CPIJ009648  conserved hypothetical protein  
   CPIJ012486  conserved hypothetical protein  
   CPIJ012629  conserved hypothetical protein  
   CPIJ013200  conserved hypothetical protein  
   CPIJ013368  microtubule binding protein  
   CPIJ013627  conserved hypothetical protein  
   CPIJ016082  conserved hypothetical protein  
   CPIJ017663  leucine-zipper-like transcriptional regulator 1  
   CPIJ018109  conserved hypothetical protein  
   CPIJ018129  conserved hypothetical protein  
  SNARE-like CPIJ009504  clathrin coat assembly protein AP17  
   CPIJ013281  conserved hypothetical protein  
   CPIJ017540  coatomer subunit delta  
  SWIB/MDM2 domain CPIJ019141  brg-1 associated factor  
   CPIJ019147  brg-1 associated factor  
  TPR-like CPIJ001441  eukaryotic translation initiation factor 3 subunit  
   CPIJ002036  transmembrane and TPR repeat-containing protein  
   CPIJ003799  suppressor of forked  
   CPIJ004405  conserved hypothetical protein  
   CPIJ005156  conserved hypothetical protein  
   CPIJ008245  conserved hypothetical protein  
   CPIJ008355  transmembrane protein 1/tmem1b  
   CPIJ010925  heat shock protein 70  
   CPIJ011544  tetratricopeptide repeat domain 21B  
   CPIJ017131  prolyl 4-hydroxylase subunit alpha-1  
   CPIJ019076  tetratricopeptide repeat protein 15  
  UBA-like CPIJ006055  conserved hypothetical protein  
   CPIJ011493  conserved hypothetical protein  
   CPIJ012192  conserved hypothetical protein  
  Vasodilator-stimulated phosphoprotein, VASP, tetramerisation domain CPIJ004707  vasodilator-stimulated phosphoprotein  
  WW domain CPIJ000289  conserved hypothetical protein  
   CPIJ000291  conserved hypothetical protein  
   CPIJ004712  conserved hypothetical protein  
   CPIJ013704  conserved hypothetical protein  
   CPIJ014839  conserved hypothetical protein  
   CPIJ019077  conserved hypothetical protein  
  FAD/NAD(P)-binding domain CPIJ001215  alcohol dehydrogenase  
193 
 
   CPIJ001367  glucose dehydrogenase  
   CPIJ002196  lysine-specific histone demethylase  
   CPIJ002643  CDNA sequence  
   CPIJ005552  thioredoxin reductase 1, mitochondrial  
   CPIJ007619  glucose dehydrogenase  
   CPIJ007625  alcohol dehydrogenase  
   CPIJ009583  glucose dehydrogenase  
   CPIJ010620  conserved hypothetical protein  
   CPIJ010669  rab protein geranylgeranyltransferase component A 1  
   CPIJ013724  dimethylaniline monooxygenase  
   CPIJ013725  dimethylaniline monooxygenase  
   CPIJ017482  choline dehydrogenase  
   CPIJ017488  glucose dehydrogenase  
   CPIJ017490  glucose dehydrogenase  
   CPIJ017491  glucose dehydrogenase  
  Glutathione S-transferase (GST), C-terminal domain CPIJ002660  glutathione-s-transferase theta, gst  
   CPIJ002680  glutathione S-transferase  
   CPIJ003988  prostaglandin E synthase 2  
   CPIJ014051  glutathione-s-transferase theta, gst  
   CPIJ014053  glutathione-s-transferase theta, gst  
   CPIJ018524  prostaglandin E synthase 2  
   CPIJ018633  glutathione-s-transferase theta  
  NAD(P)-binding Rossmann-fold domains CPIJ016763  short-chain dehydrogenase  
   CPIJ000400  3-hydroxyisobutyrate dehydrogenase  
   CPIJ000841  dimeric dihydrodiol dehydrogenase  
   CPIJ003056  hydroxysteroid dehydrogenase  
   CPIJ003801  NADP-dependent leukotriene B4 12-hydroxydehydrogenase  
   CPIJ003837  short-chain dehydrogenase  
   CPIJ004391  fatty acyl-CoA reductase 1  
   CPIJ004392  fatty acyl-CoA reductase 2  
   CPIJ005892  conserved hypothetical protein  
   CPIJ006479  3-hydroxyacyl-coa dehyrogenase  
   CPIJ007225  3-ketodihydrosphingosine reductase  
   CPIJ007244  fatty acyl-CoA reductase 1  
   CPIJ007245  fatty acyl-CoA reductase 1  
   CPIJ011767  short-chain dehydrogenase  
   CPIJ013219  3-hydroxybutyrate dehydrogenase type 2  
   CPIJ014059  NADP-dependent leukotriene B4 12-hydroxydehydrogenase  
   CPIJ014121  short-chain dehydrogenase  
   CPIJ014122  dehydrogenase/reductase SDR family member 8  
194 
 
   CPIJ014580  dimeric dihydrodiol dehydrogenase  
   CPIJ015671  glyoxylate reductase/hydroxypyruvate reductase  
   CPIJ015685  3-oxoacyl-[acyl-carrier-protein] reductase  
   CPIJ016656  short-chain dehydrogenase  
   CPIJ016657  short-chain dehydrogenase  
   CPIJ016719  alcohol dehydrogenase 1  
   CPIJ016777  hydroxyacyl-coenzyme A dehydrogenase, mitochondrial  
   CPIJ017297  quinone oxidoreductase  
   CPIJ017713  short-chain dehydrogenase  
   CPIJ018318  short-chain dehydrogenase  
   CPIJ019137  dihydropteridine reductase  
   CPIJ019281  conserved hypothetical protein  
   CPIJ019362  dehydrogenase/reductase SDR family member 8  
   CPIJ019941  conserved hypothetical protein  
   CPIJ019942  conserved hypothetical protein  
   CPIJ020005  UDP-glucuronic acid decarboxylase 1  
  Nucleotide-binding domain CPIJ002817  d-amino acid oxidase  
   CPIJ007272  d-amino acid oxidase  
   CPIJ007273  d-amino acid oxidase  
  Obg GTP-binding protein N-terminal domain CPIJ005917  Spo0B-associated GTP-binding protein  
  P-loop containing nucleoside triphosphate hydrolases CPIJ014210  conserved hypothetical protein  
   CPIJ000310  heparan sulfate 2-o-sulfotransferase  
   CPIJ000320  conserved hypothetical protein  
   CPIJ000874  carbohydrate sulfotransferase  
   CPIJ000964  chromosome-associated kinesin KIF4A  
   CPIJ001058  ADP-ribosylation factor  
   CPIJ001311  multidrug resistance-associated protein 2  
   CPIJ001383  kinesin-like protein KIF3A  
   CPIJ001540  abc transporter  
   CPIJ001695  conserved hypothetical protein  
   CPIJ001702  conserved hypothetical protein  
   CPIJ001756  conserved hypothetical protein  
   CPIJ001842  translation initiation factor IF-2, mitochondrial  
   CPIJ001988  ATP-dependent RNA helicase A  
   CPIJ002335  ATP-dependent RNA helicase DDX51  
   CPIJ003150  vesicular-fusion protein Nsf1  
   CPIJ003814  cell cycle checkpoint protein rad17  
   CPIJ003934  RNA helicase  
   CPIJ003935  ATP-dependent RNA helicase p62  
   CPIJ004665  chromodomain helicase-DNA-binding protein 3  
195 
 
   CPIJ004980  ATP-binding cassette sub-family A member 3  
   CPIJ005169  ras-related protein Rab-10  
   CPIJ005172  GTP-binding protein  
   CPIJ005340  ATP-binding cassette transporter  
   CPIJ005341  abc transporter  
   CPIJ005366  GTP-binding protein yptV1  
   CPIJ005545  conserved hypothetical protein  
   CPIJ007064  conserved hypothetical protein  
   CPIJ007231  translation elongation factor  
   CPIJ007588  conserved hypothetical protein  
   CPIJ007795  guanylate kinase  
   CPIJ007814  myosin iii  
   CPIJ007889  abc transporter  
   CPIJ008104  ras-related protein Rab-39B  
   CPIJ008284  canalicular multispecific organic anion transporter 1  
   CPIJ008677  conserved hypothetical protein  
   CPIJ008800  ATP-dependent protease La  
   CPIJ008893  conserved hypothetical protein  
   CPIJ008983  ATP-dependent RNA helicase DBP8  
   CPIJ009005  ATP-dependent DNA helicase MER3  
   CPIJ009065  ras-related protein Rab-9  
   CPIJ009089  ras-related protein Rab-7  
   CPIJ009531  conserved hypothetical protein  
   CPIJ009998  transcriptional regulator ATRX  
   CPIJ010194  ras-related protein  
   CPIJ010818  GTP-binding  protein alpha subunit, gna  
   CPIJ010888  origin recognition complex subunit 1  
   CPIJ010998  werner helicase interacting protein  
   CPIJ011002  bile salt sulfotransferase 1  
   CPIJ011328  GTP:AMP phosphotransferase mitochondrial  
   CPIJ011521  mitochondrial 28S ribosomal protein S29  
   CPIJ011567  conserved hypothetical protein  
   CPIJ011830  serine protease  
   CPIJ012284  abc transporter  
   CPIJ012364  abc transporter  
   CPIJ012365  ATP-binding cassette sub-family G member 4  
   CPIJ012510  ATP-dependent RNA helicase DDX24  
   CPIJ012512  ATP-dependent RNA helicase p62  
   CPIJ012614  sulfotransferase 1A1  
   CPIJ012621  ATP-dependent RNA helicase Ddx1  
196 
 
   CPIJ013250  conserved hypothetical protein  
   CPIJ013393  mitochondrial chaperone BCS1  
   CPIJ013525  conserved hypothetical protein  
   CPIJ013876  DNA polymerase theta  
   CPIJ014038  DEAD-box ATP-dependent RNA helicase 57  
   CPIJ014142  nucleotide-binding protein 1  
   CPIJ014150  ATP-binding cassette sub-family F member 3  
   CPIJ014305  conserved hypothetical protein  
   CPIJ014361  conserved hypothetical protein  
   CPIJ014443  ATP-binding cassette sub-family G member 4  
   CPIJ014693  transcriptional regulator ATRX  
   CPIJ014902  CDC42  
   CPIJ015682  translation initiation factor if-2  
   CPIJ015769  myosin vi  
   CPIJ015845  elongation factor tu  
   CPIJ015898  conserved hypothetical protein  
   CPIJ016097  peroxisomal membrane protein 70 abcd3  
   CPIJ016664  CTP synthase  
   CPIJ016808  ribosome biogenesis protein  
   CPIJ017203  conserved hypothetical protein  
   CPIJ017338  DEAD box ATP-dependent RNA helicase  
   CPIJ017393  conserved hypothetical protein  
   CPIJ017570  myosin IB heavy chain  
   CPIJ017886  ATP-dependent RNA helicase  
   CPIJ018454  chromosome-associated kinesin KIF4A  
   CPIJ018540  hypothetical protein  
   CPIJ019196  DEAD box ATP-dependent RNA helicase  
   CPIJ019594  chromosome transmission fidelity protein 18  
   CPIJ019631  kinesin heavy chain  
   CPIJ019640  conserved hypothetical protein  
  PEBP-like CPIJ003429  brother of ft and tfl1  
   CPIJ008654  phosphatidylethanolamine-binding protein  
Information Chromatin structure NAP-like CPIJ015455  nucleosome assembly protein  
   CPIJ015773  nucleosome assembly protein  
 
DNA 
replication/rep
air 
Chromo domain-like CPIJ007340  conserved hypothetical protein  
   CPIJ014352  conserved hypothetical protein  
   CPIJ019929  conserved hypothetical protein  
197 
 
  DNA polymerase III clamp loader subunits, C-terminal domain CPIJ017857  ATPase WRNIP1  
  DNA/RNA polymerases CPIJ007351  terminal deoxycytidyl transferase rev1  
   CPIJ012266  DNA polymerase subunit gamma 1, mitochondrial  
   CPIJ015260  DNA polymerase alpha catalytic subunit  
  DNase I-like CPIJ006698  type I inositol-1,4,5-trisphosphate 5-phosphatase  
   CPIJ008163  skeletal muscle/kidney enriched inositol 5-phosphatase  
   CPIJ012006  conserved hypothetical protein  
   CPIJ019984  sphingomyelin phosphodiesterase 2  
  FYVE/PHD zinc finger CPIJ001881  conserved hypothetical protein  
   CPIJ002025  conserved hypothetical protein  
   CPIJ004116  zinc finger FYVE domain-containing protein 28  
   CPIJ006170  CpG-binding protein  
   CPIJ009232  conserved hypothetical protein  
   CPIJ009396  inhibitor of growth protein 3  
   CPIJ011285  fetal alzheimer antigen, falz  
   CPIJ013376  phd finger protein  
   CPIJ013847  conserved hypothetical protein  
   CPIJ014289  conserved hypothetical protein  
   CPIJ015635  conserved hypothetical protein  
   CPIJ016701  inhibitor of growth protein 1  
  His-Me finger endonucleases CPIJ002289  deoxyribonuclease I  
   CPIJ006433  caspase-activated nuclease  
  HRDC-like CPIJ009943  conserved hypothetical protein  
  Nucleic acid-binding proteins CPIJ003130  replication factor A, 14kD-subunit  
   CPIJ004582  mitochondrial ribosomal protein S17  
   CPIJ005206  DNA-directed RNA polymeraseI  
   CPIJ005868  multisynthetase complex auxiliary component p43  
   CPIJ006691  insect replication protein a  
   CPIJ008535  conserved hypothetical protein  
   CPIJ019290  DNA ligase 4  
  Nudix CPIJ014785  mitochondrial ribosomal protein, L46  
  Restriction endonuclease-like CPIJ019123  conserved hypothetical protein  
  RING/U-box CPIJ015192  conserved hypothetical protein  
   CPIJ001165  ubiquitin conjugation factor E4 A  
   CPIJ001468  RING-box protein 1a  
   CPIJ003711  E3 ubiquitin-protein ligase MARCH6  
   CPIJ004515  conserved hypothetical protein  
   CPIJ004519  conserved hypothetical protein  
   CPIJ005021  vacuolar protein sorting-associated protein 18  
198 
 
   CPIJ005056  conserved hypothetical protein  
   CPIJ005135  peroxisome assembly factor 1  
   CPIJ006036  ring finger protein  
   CPIJ006232  rolling pebbles  
   CPIJ007831  conserved hypothetical protein  
   CPIJ010005  RING finger protein 126-B  
   CPIJ010511  hypothetical protein  
   CPIJ010577  conserved hypothetical protein  
   CPIJ010613  zinc finger protein  
   CPIJ011856  E3 ubiquitin-protein ligase MARCH5  
   CPIJ012808  conserved hypothetical protein  
   CPIJ014265  zinc and ring finger 2  
   CPIJ015415  conserved hypothetical protein  
   CPIJ016043  autocrine motility factor receptor  
   CPIJ016186  conserved hypothetical protein  
   CPIJ016790  zinc finger protein  
   CPIJ017375  conserved hypothetical protein  
   CPIJ017992  conserved hypothetical protein  
  Tudor/PWWP/MBT CPIJ003208  predicted protein  
   CPIJ005604  conserved hypothetical protein  
   CPIJ012664  conserved hypothetical protein  
   CPIJ014035  conserved hypothetical protein  
 RNA processing EPT/RTPC-like CPIJ009234  RNA 3'-terminal phosphate cyclase  
  Eukaryotic type KH-domain (KH-domain type I) CPIJ002909  far upstream binding protein  
   CPIJ010419  conserved hypothetical protein  
   CPIJ010634  conserved hypothetical protein  
   CPIJ011349  igf2 mRNA binding protein  
   CPIJ014324  conserved hypothetical protein  
   CPIJ015571  heterogeneous nuclear ribonucleoprotein  
   CPIJ018107  zinc finger protein  
  PAP/OAS1 substrate-binding domain CPIJ011744  poly a polymerase  
   CPIJ015488  sigma DNA polymerase  
  RNase III domain-like CPIJ007416  ribonuclease iii  
   CPIJ008368  39S ribosomal protein L44  
   CPIJ013579  ribonuclease iii  
  Translin CPIJ011089  translin associated factor x  
   CPIJ011091  translin associated factor x  
 Transcription beta and beta-prime subunits of DNA dependent RNA-polymerase CPIJ002457  DNA-directed RNA polymerase I 135 kDa polypeptide  
199 
 
   CPIJ018338  DNA-directed RNA polymerase I largest subunit  
  CYTH-like phosphatases CPIJ009805  conserved hypothetical protein  
  occludin/ELL-like CPIJ004404  conserved hypothetical protein  
  RBP11-like subunits of RNA polymerase CPIJ005304  DNA-directed RNA polymerase II subunit J  
  TATA-box binding protein-like CPIJ007600  TATA-box-binding protein  
 Translation Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases CPIJ019163  conserved hypothetical protein  
  Class II aaRS ABD-related CPIJ007439  conserved hypothetical protein  
   CPIJ011030  conserved hypothetical protein  
   CPIJ017958  conserved hypothetical protein  
  EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain CPIJ000412  elongation factor-1 alpha  
   CPIJ005761  elongation factor 1-alpha  
   CPIJ006444  elongation factor 1-alpha  
   CPIJ009508  elongation factor 1 alpha  
  eIF1-like CPIJ009942  density-regulated protein  
   CPIJ013497  eukaryotic translation initiation factor 1b  
  eIF4e-like CPIJ012031  eukaryotic translation initiation factor 4e type  
  Elongation factor TFIIS domain 2 CPIJ013846  conserved hypothetical protein  
  Elongation factor Ts (EF-Ts), dimerisation domain CPIJ004698  elongation factor ts  
  L21p-like CPIJ015639  39S ribosomal protein L21, mitochondrial  
  L27 domain CPIJ009529  membrane-associated guanylate kinase  
  L30e-like CPIJ005818  13 kDa ribonucleoprotein-associated protein  
  L35p-like CPIJ019136  39S ribosomal protein L35, mitochondrial  
  L9 N-domain-like CPIJ013282  39S ribosomal protein L9, mitochondrial  
  Prokaryotic ribosomal protein L17 CPIJ008935  39S ribosomal protein L17, mitochondrial  
  Prokaryotic type KH domain (KH-domain type II) CPIJ013400  ribosomal protein S3  
   CPIJ016018  ribosomal protein S3  
  Release factor CPIJ019188  peptide chain release factor 1  
  Ribosomal L11/L12e N-terminal domain CPIJ013673  39S ribosomal protein L11, mitochondrial  
  Ribosomal protein L16p/L10e CPIJ012999  serrate protein  
   CPIJ009291  60S ribosomal protein L10  
   CPIJ017073  conserved hypothetical protein  
   CPIJ018417  conserved hypothetical protein  
   CPIJ018847  60S ribosomal protein L10  
  Ribosomal protein L20 CPIJ010000  39S ribosomal protein L20, mitochondrial  
  Ribosomal protein L29 (L29p) CPIJ010482  hypothetical protein  
  Ribosomal protein L30p/L7e CPIJ011578  mitochondrial ribosomal protein L30  
   CPIJ012743  60S ribosomal protein L7  
   CPIJ017899  tetratricopeptide repeat protein, tpr  
  Ribosomal protein L36 CPIJ009257  mitochondrial ribosomal protein L36  
200 
 
  Ribosomal protein S10 CPIJ011818  Ded1-like DEAD-box RNA helicase  
   CPIJ017617  40S ribosomal protein S20  
   CPIJ018278  40S ribosomal protein S20  
   CPIJ018511  40S ribosomal protein S20  
  Ribosomal protein S16 CPIJ009237  28S ribosomal protein S16  
  Ribosomal protein S18 CPIJ002644  28S ribosomal protein S18b, mitochondrial  
  Ribosomal protein S3 C-terminal domain CPIJ015427  40S ribosomal protein S3  
  Ribosomal protein S5 domain 2-like CPIJ008237  40S ribosomal protein S2  
   CPIJ013104  40S ribosomal protein S2  
   CPIJ016812  40S ribosomal protein S2  
   CPIJ018157  exosome complex exonuclease RRP46  
   CPIJ018280  conserved hypothetical protein  
  Ribosomal protein S6 CPIJ007632  mitochondrial 28S ribosomal protein S6  
  Ribosomal proteins L15p and L18e CPIJ012021  60S ribosomal protein L18  
  Ribosome inactivating proteins (RIP) CPIJ009211  conserved hypothetical protein  
  Second domain of FERM CPIJ017573  focal adhesion kinase  
  Sm-like ribonucleoproteins CPIJ005588  small nuclear ribonucleoprotein SM D3  
   CPIJ006616  small nuclear ribonucleoprotein-associated protein B  
   CPIJ017424  small nuclear ribonucleoprotein E  
  ThrRS/AlaRS common domain CPIJ015553  alanyl-tRNA synthetase domain-containing protein 1  
  Translation initiation factor 2 beta, aIF2beta, N-terminal domain CPIJ013860  eukaryotic translation initiation factor 2 subunit beta  
  Translation proteins CPIJ007631  elongation factor-1 alpha  
   CPIJ009557  elongation factor 1 alpha  
   CPIJ015678  conserved hypothetical protein  
  Translation proteins SH3-like domain CPIJ008796  39S ribosomal protein L2, mitochondrial  
   CPIJ019257  39S ribosomal protein L19, mitochondrial  
  Translational machinery components CPIJ000042  40S ribosomal protein S14  
   CPIJ000487  conserved hypothetical protein  
   CPIJ000875  40S ribosomal protein S14-A  
   CPIJ002488  40S ribosomal protein S14-B  
   CPIJ002871  40S ribosomal protein S14  
   CPIJ003216  40S ribosomal protein S14-B  
   CPIJ003943  40S ribosomal protein S14  
   CPIJ006101  40S ribosomal protein S14-A  
   CPIJ007174  40S ribosomal protein S14  
   CPIJ008067  40S ribosomal protein S14-A  
   CPIJ009287  conserved hypothetical protein  
   CPIJ010252  40S ribosomal protein S14  
   CPIJ010640  predicted protein  
201 
 
   CPIJ011289  40S ribosomal protein S14  
   CPIJ011697  40S ribosomal protein S141  
   CPIJ012110  40S ribosomal protein S14-A  
   CPIJ013076  40S ribosomal protein S14  
   CPIJ013802  40S ribosomal protein S14-2  
   CPIJ014959  40S ribosomal protein S14-A  
   CPIJ015991  conserved hypothetical protein  
   CPIJ016597  40S ribosomal protein S14  
   CPIJ017293  40S ribosomal protein S14  
   CPIJ018446  40S ribosomal protein S14-B  
  Zn-binding ribosomal proteins CPIJ014045  39S ribosomal protein L32, mitochondrial  
Intra-cellular 
processes 
Cell cycle, 
Apoptosis CAD & PB1 domains CPIJ008787  conserved hypothetical protein  
   CPIJ020175  conserved hypothetical protein  
  Cell cycle regulatory proteins CPIJ006105  cyclin-dependent kinaseregulatory subunit 1  
  Cullin homology domain CPIJ003980  anaphase-promoting complex subunit 2  
  Cystine-knot cytokines CPIJ000272  Sptzle 2  
   CPIJ000273  sptzle 2  
   CPIJ001752  sptzle 3A  
   CPIJ002281  sptzle 6  
   CPIJ012748  conserved hypothetical protein  
  DEATH domain CPIJ010093  netrin receptor unc5  
   CPIJ010503  ankyrin 2,3/unc44  
  Inhibitor of apoptosis (IAP) repeat CPIJ006918  conserved hypothetical protein  
  RCC1/BLIP-II CPIJ011645  hyperplastic discs protein  
   CPIJ015298  regulator of chromosome condensation  
  Rhodanese/Cell cycle control phosphatase CPIJ001662  M-phase inducer phosphatase 2  
   CPIJ013880  heat shock protein 67B2  
 Cell motility Actin depolymerizing proteins CPIJ007823  glial maturation factor  
   CPIJ015839  conserved hypothetical protein  
   CPIJ019500  conserved hypothetical protein  
  Actin-crosslinking proteins CPIJ013211  conserved hypothetical protein  
  DLC CPIJ015622  dynein light chain 1, cytoplasmic-like protein  
   CPIJ015623  predicted protein  
  Formin homology 2 domain (FH2 domain) CPIJ003134  formin 1,2/cappuccino  
   CPIJ006609  conserved hypothetical protein  
   CPIJ007323  formin 3  
  I/LWEQ domain CPIJ004416  huntingtin interacting protein  
  Myosin rod fragments CPIJ014522  lava lamp protein  
   CPIJ017450  mushroom body defect protein  
202 
 
  Outer arm dynein light chain 1 CPIJ012834  conserved hypothetical protein  
   CPIJ015679  conserved hypothetical protein  
  Tropomyosin CPIJ001763  Ofd1 protein  
   CPIJ005452  M-type 9 protein  
  Tubulin nucleotide-binding domain-like CPIJ003263  tubulin beta chain  
   CPIJ011550  tubulin alpha-2 chain  
   CPIJ017383  tubulin alpha-1 chain  
 Ion m/tr Band 7/SPFH domain CPIJ001131  erythrocyte band 7 integral membrane protein  
  Calcium ATPase, transmembrane domain M CPIJ001884  cation-transporting ATPase 13a1  
   CPIJ005964  Na+/K+ ATPase alpha subunit  
   CPIJ005965  conserved hypothetical protein  
   CPIJ013541  conserved hypothetical protein  
  Clc chloride channel CPIJ004937  chloride channel protein 3  
  Cupredoxins CPIJ010466  laccase-like multicopper oxidase 1  
   CPIJ012244  multicopper oxidase  
   CPIJ012357  multicopper oxidase  
   CPIJ016802  laccase-like multicopper oxidase 1  
   CPIJ020002  multicopper oxidase  
  Ferritin-like CPIJ003762  coenzyme q10 biosynthesis protein  
  HMA, heavy metal-associated domain CPIJ015637  antioxidant enzyme  
  MFS general substrate transporter CPIJ000765  monocarboxylate transporter  
   CPIJ000988  sugar transporter  
   CPIJ001970  organic anion transporter  
   CPIJ001971  solute carrier organic anion transporter family member 3A1  
   CPIJ001972  organic anion transporter  
   CPIJ002124  hippocampus abundant  1 protein  
   CPIJ002172  oligopeptide transporter  
   CPIJ003413  UNC93A protein  
   CPIJ003611  sugar transporter  
   CPIJ004177  sodium-dependent phosphate transporter  
   CPIJ005445  glucose transporter  
   CPIJ006419  monocarboxylate transporter  
   CPIJ007434  sodium/phosphate cotransporter  
   CPIJ008117  monocarboxylate transporter  
   CPIJ008119  monocarboxylate transporter  
   CPIJ008274  monocarboxylate transporter 3  
   CPIJ008344  sugar transporter  
   CPIJ008424  integral membrane protein efflux protein efpA  
   CPIJ008947  sugar transporter  
   CPIJ008948  sugar transporter  
203 
 
   CPIJ011542  synaptic vesicle protein  
   CPIJ011543  proton-associated sugar transporter A  
   CPIJ012022  organic cation/carnitine transporter 1  
   CPIJ014358  organic cation transporter  
   CPIJ015155  adenylate cyclase  
   CPIJ015621  cis,cis-muconate transport protein MucK  
   CPIJ015630  conserved hypothetical protein  
   CPIJ017354  adenylate cyclase  
   CPIJ017478  conserved hypothetical protein  
   CPIJ018460  mfs transporter  
   CPIJ018461  mfs transporter  
   CPIJ019487  organic cation transporter  
   CPIJ019488  organic cation transporter  
   CPIJ019562  conserved hypothetical protein  
   CPIJ019820  sugar transporter  
  Multidrug resistance efflux transporter EmrE CPIJ009014  UDP-N-acetylglucosamine transporter  
   CPIJ010400  conserved hypothetical protein  
   CPIJ017962  conserved hypothetical protein  
  Neurotransmitter-gated ion-channel transmembrane pore CPIJ006949  histamine-gated chloride channel subunit  
   CPIJ007636  conserved hypothetical protein  
   CPIJ010616  conserved hypothetical protein  
  Periplasmic binding protein-like II CPIJ006667  glutamate receptor  
   CPIJ007989  porphobilinogen deaminase  
   CPIJ010822  conserved hypothetical protein  
  SET domain CPIJ008357  conserved hypothetical protein  
   CPIJ010143  conserved hypothetical protein  
   CPIJ013516  conserved hypothetical protein  
   CPIJ013517  conserved hypothetical protein  
   CPIJ013971  Mll1 protein  
   CPIJ015254  conserved hypothetical protein  
   CPIJ016652  histone-lysine N-methyltransferase SETDB1  
   CPIJ018501  conserved hypothetical protein  
  Voltage-gated potassium channels CPIJ000215  sodium-and chloride-activated ATP-sensitive potassium channel  
   CPIJ000749  conserved hypothetical protein  
   CPIJ001990  conserved hypothetical protein  
   CPIJ005769  calcium-activated potassium channel alpha chain  
   CPIJ010846  potassium channel subfamily K member 9  
   CPIJ017948  voltage and ligand gated potassium channel  
 Phospholipid CRAL/TRIO domain CPIJ001389  conserved hypothetical protein  
204 
 
m/tr 
   CPIJ005816  CRAL/TRIO domain-containing protein  
   CPIJ008515  cellular retinaldehyde binding protein  
   CPIJ008920  tyrosine phosphatase n9  
   CPIJ009578  CRAL/TRIO domain-containing protein  
   CPIJ013463  conserved hypothetical protein  
   CPIJ013464  conserved hypothetical protein  
   CPIJ013472  conserved hypothetical protein  
   CPIJ013592  conserved hypothetical protein  
   CPIJ013676  cellular retinaldehyde binding protein  
   CPIJ014217  CRAL/TRIO domain-containing protein  
   CPIJ014225  CRAL/TRIO domain-containing protein  
   CPIJ016765  ganglioside induced differentiation associated protein  
   CPIJ018183  conserved hypothetical protein  
   CPIJ018213  CRAL/TRIO domain-containing protein  
  CRAL/TRIO N-terminal domain CPIJ013466  conserved hypothetical protein  
   CPIJ014222  CRAL/TRIO domain-containing protein  
   CPIJ018181  conserved hypothetical protein  
   CPIJ018184  conserved hypothetical protein  
  Phospholipase A2, PLA2 CPIJ001437  phospholipase A2  
   CPIJ011154  secretory Phospholipase A2  
   CPIJ011155  secretory Phospholipase A2  
   CPIJ019557  conserved hypothetical protein  
  PLC-like phosphodiesterases CPIJ008722  conserved hypothetical protein  
 Proteases BPTI-like CPIJ004215  conserved hypothetical protein  
  ClpP/crotonase CPIJ002685  enoyl-CoA hydratase ECHA12  
   CPIJ005435  peroxisomal 3,2-trans-enoyl-CoA isomerase  
   CPIJ009999  methylcrotonoyl-CoA carboxylase beta chain, mitochondrial  
   CPIJ013793  cuticle protein 8  
   CPIJ020263  fatty acid oxidation complex subunit alpha  
  Creatinase/aminopeptidase CPIJ011945  methionine aminopeptidase 2  
   CPIJ020069  methionine aminopeptidase 2  
   CPIJ006323  xaa-Pro aminopeptidase 1  
   CPIJ014907  xaa-pro dipeptidase  
  Cystatin/monellin CPIJ002770  cystatin-like protein  
   CPIJ002771  cystatin-like protein  
  Cysteine proteinases CPIJ000133  conserved hypothetical protein  
   CPIJ000575  oryzain gamma chain  
   CPIJ003218  ubiquitin carboxyl-terminal hydrolase 22  
   CPIJ004347  Autophagy-specific protein  
205 
 
   CPIJ005164  ubiquitin specific proteinase  
   CPIJ005165  ubiquitin specific proteinase  
   CPIJ005440  conserved hypothetical protein  
   CPIJ007009  conserved hypothetical protein  
   CPIJ010867  conserved hypothetical protein  
   CPIJ013438  conserved hypothetical protein  
   CPIJ014293  ubiquitin specific protease 2  
   CPIJ014687  ubiquitin carboxyl-terminal hydrolase 14  
   CPIJ014690  conserved hypothetical protein  
   CPIJ015776  OTU domain-containing protein 6B  
   CPIJ016134  ubiquitin carboxyl-terminal hydrolase 64E  
  DPP6 N-terminal domain-like CPIJ008362  DET1 protein  
  Elafin-like CPIJ006214  salivary cysteine-rich peptide  
   CPIJ019874  salivary cysteine-rich peptide  
  HSP40/DnaJ peptide-binding domain CPIJ006891  tumorous imaginal discs, mitochondrial  
  Kazal-type serine protease inhibitors CPIJ011189  predicted protein  
  LuxS/MPP-like metallohydrolase CPIJ001880  mitochondrial-processing peptidase alpha subunit  
   CPIJ019576  mitochondrial-processing peptidase subunit beta  
  Metallo-dependent phosphatases CPIJ000169  sphingomyelin phosphodiesterase  
   CPIJ001371  serine/threonine-protein phosphatase 4 catalytic subunit  
   CPIJ004547  lariat debranching enzyme  
   CPIJ009664  purple acid phosphatase  
  Metalloproteases ("zincins"), catalytic domain CPIJ001052  aminopeptidase 2, mitochondrial  
   CPIJ001462  conserved hypothetical protein  
   CPIJ001808  conserved hypothetical protein  
   CPIJ005931  ADAM 17  
   CPIJ006295  protease m1 zinc metalloprotease  
   CPIJ011458  aminopeptidase N  
   CPIJ012680  ADAM 12  
   CPIJ013386  zinc metalloproteinase nas-14  
   CPIJ014660  protease m1 zinc metalloprotease  
   CPIJ017830  conserved hypothetical protein  
  PMP inhibitors CPIJ010990  pacifastin light chain  
  Protease propeptides/inhibitors CPIJ016547  proprotein convertase subtilisin/kexin type 4, furin  
  Rhomboid-like CPIJ003969  stem cell tumor  
   CPIJ014344  conserved hypothetical protein  
   CPIJ014350  transmembrane protein 115  
   CPIJ015372  rhomboid protein 1, mitochondrial  
  Serpins CPIJ000915  serpin B3  
   CPIJ005227  serine protease inhibitor  
206 
 
   CPIJ010186  conserved hypothetical protein  
   CPIJ012016  serine protease inhibitor, serpin  
   CPIJ016299  serine protease inhibitor, serpin  
   CPIJ017784  serpin B8  
  Subtilisin-like CPIJ013852  tripeptidyl-peptidase 2  
   CPIJ015180  proprotein convertase subtilisin/kexin type 4, furin  
   CPIJ015181  proprotein convertase subtilisin/kexin type 4, furin  
  Thyroglobulin type-1 domain CPIJ001687  conserved hypothetical protein  
  Trypsin-like serine proteases CPIJ000593  coagulation factor XI  
   CPIJ001059  serine protease  
   CPIJ001060  coagulation factor XI  
   CPIJ001099  serine protease  
   CPIJ001107  serine protease 27  
   CPIJ001109  serine protease  
   CPIJ001983  trypsin 5G1  
   CPIJ002490  conserved hypothetical protein  
   CPIJ002491  conserved hypothetical protein  
   CPIJ002531  serine protease  
   CPIJ004037  serine protease  
   CPIJ004038  clip-domain serine protease  
   CPIJ004091  trypsin eta  
   CPIJ004093  coagulation factor XI  
   CPIJ004094  serine protease  
   CPIJ004095  serine protease  
   CPIJ004304  serine protease  
   CPIJ004990  serine protease1/2  
   CPIJ005480  serine protease  
   CPIJ005904  anionic trypsin-2  
   CPIJ006226  serine protease  
   CPIJ006544  chymotrypsinogen 2  
   CPIJ006568  chymotrypsin 1  
   CPIJ006869  mast cell protease 3  
   CPIJ008062  conserved hypothetical protein  
   CPIJ008523  serine-type enodpeptidase  
   CPIJ008567  serine protease  
   CPIJ008568  serine protease  
   CPIJ009113  chymotrypsin BI  
   CPIJ009142  coagulation factor VII  
   CPIJ009480  tryptase gamma  
   CPIJ009592  serine-type enodpeptidase  
207 
 
   CPIJ009624  serine protease  
   CPIJ009792  conserved hypothetical protein  
   CPIJ009890  serine proteinase stubble  
   CPIJ009891  serine protease  
   CPIJ009893  serine protease  
   CPIJ009894  serine protease  
   CPIJ010297  coagulation factor X  
   CPIJ010615  proclotting enzyme  
   CPIJ011477  conserved hypothetical protein  
   CPIJ012017  serine protease  
   CPIJ013043  chymotrypsin A  
   CPIJ013044  anionic trypsin  
   CPIJ013362  conserved hypothetical protein  
   CPIJ013396  urokinase-type plasminogen activator  
   CPIJ013616  trypsin 5  
   CPIJ015405  serine protease  
   CPIJ016103  serine protease  
   CPIJ016220  serine protease  
   CPIJ017794  220 kDa silk protein  
   CPIJ017797  neurohypophysial hormones  
   CPIJ017798  serine protease  
   CPIJ017990  serine protease1/2  
   CPIJ018529  trypsin 1  
   CPIJ019031  chymotrypsin BII  
   CPIJ019291  serine protease htra2  
   CPIJ019781  trypsin 1  
   CPIJ019952  serine protease  
   CPIJ020116  conserved hypothetical protein  
  Zn-dependent exopeptidases CPIJ001174  plasma glutamate carboxypeptidase  
   CPIJ009394  zinc carboxypeptidase  
   CPIJ009466  conserved hypothetical protein  
   CPIJ010806  conserved hypothetical protein  
   CPIJ012908  glutaminyl-peptide cyclotransferase  
   CPIJ015253  zinc carboxypeptidase A 1  
   CPIJ019695  plasma glutamate carboxypeptidase  
   CPIJ019890  carboxypeptidase D  
 Protein modification ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase CPIJ011247  heat shock protein 82  
  Chaperone J-domain CPIJ007923  conserved hypothetical protein  
   CPIJ008583  DnaJ domain containing protein  
208 
 
   CPIJ011412  M-phase phosphoprotein 11  
   CPIJ017724  conserved hypothetical protein  
   CPIJ018848  mitochondrial protein import protein MAS5  
  Cyclophilin-like CPIJ004991  peptidyl-prolyl cis-trans isomerase  
   CPIJ011947  peptidyl-prolyl cis-trans isomerase 10  
   CPIJ016592  peptidyl-prolyl cis-trans isomerase  
   CPIJ020068  peptidyl-prolyl cis-trans isomerase cyp8  
  FKBP-like CPIJ011777  FK506-binding protein 2  
   CPIJ014691  FK506-binding protein 59  
   CPIJ014950  FK506-binding protein  
   CPIJ014951  conserved hypothetical protein  
  GroEL equatorial domain-like CPIJ008889  60 kDa heat shock protein, mitochondrial  
   CPIJ018780  ribosomal protein S6  
  GroES-like CPIJ000840  conserved hypothetical protein  
   CPIJ007228  heat shock protein  
   CPIJ017296  conserved hypothetical protein  
  Hect, E3 ligase catalytic domain CPIJ004914  ubiquitin-protein ligase  
   CPIJ011644  ubiquitin-protein ligase  
   CPIJ012813  conserved hypothetical protein  
   CPIJ017821  hect type E3 ubiquitin ligase  
  HSP20-like chaperones CPIJ005642  heat shock protein 27  
   CPIJ005645  heat shock protein 22  
   CPIJ007348  nuclear movement protein nudC  
   CPIJ013743  integrin beta-1-binding protein 2  
   CPIJ019282  NudC domain containing 1  
   CPIJ019713  chaperone binding protein  
  Peptide methionine sulfoxide reductase CPIJ005204  peptide methionine sulfoxide reductase msrA  
   CPIJ018565  peptide methionine sulfoxide reductase  
  Prefoldin CPIJ004062  conserved hypothetical protein  
   CPIJ008888  conserved hypothetical protein  
  Tubulin chaperone cofactor A CPIJ003559  tubulin-specific chaperone A  
  UBC-like CPIJ004186  ubiquitin-conjugating enzyme morgue  
   CPIJ005149  ubiquitin-conjugating enzyme E2 i  
   CPIJ005316  RWD domain-containing protein 4A  
   CPIJ006567  ubiquitin-conjugating enzyme E2-17 kDa  
   CPIJ007408  ubiquitin-conjugating enzyme m  
   CPIJ007726  ubiquitin-conjugating enzyme E2 Q2  
   CPIJ009955  ubiquitin conjugating enzyme E2  
   CPIJ011320  Ufm1-conjugating enzyme 1  
   CPIJ013524  ubiquitin-conjugating enzyme E2 g  
209 
 
   CPIJ014766  nedd8-conjugating enzyme nce2  
 Transport ABC transporter transmembrane region CPIJ011959  conserved hypothetical protein  
   CPIJ011961  multidrug resistance protein 2  
  Aquaporin-like CPIJ016447  aquaporin transporter  
  Cap-Gly domain CPIJ003549  150 kDa dynein-associated polypeptide  
  CBS-domain CPIJ006251  AMPK-gamma subunit  
  ENTH/VHS domain CPIJ000451  conserved hypothetical protein  
   CPIJ001186  conserved hypothetical protein  
   CPIJ001538  hepatocyte growth factor-regulated tyrosine kinase substrate  
   CPIJ002094  liquid facets  
   CPIJ010606  conserved hypothetical protein  
   CPIJ012987  conserved hypothetical protein  
   CPIJ014748  conserved hypothetical protein  
   CPIJ019897  phosphatidylinositol-binding clathrin assembly protein  
  Glycolipid transfer protein, GLTP CPIJ010828  conserved hypothetical protein  
  LDL receptor-like module CPIJ004357  conserved hypothetical protein  
   CPIJ014258  conserved hypothetical protein  
   CPIJ016346  conserved hypothetical protein  
  Lipocalins CPIJ015727  apolipoprotein D  
   CPIJ015728  conserved hypothetical protein  
   CPIJ017615  apolipoprotein D  
  Mitochondrial carrier CPIJ002253  mitochondrial carnitine/acylcarnitine carrier protein  
   CPIJ006475  mitochondrial 2-oxoglutarate/malate carrier protein  
   CPIJ001256  mitochondrial uncoupling protein  
   CPIJ001257  mitochondrial uncoupling protein  
   CPIJ005941  ADP,ATP carrier protein 2  
   CPIJ007010  peroxisomal membrane protein pmp34  
   CPIJ007454  small calcium-binding mitochondrial carrier  
   CPIJ008580  mitochondrial carrier protein  
   CPIJ011555  mitochondrial carrier protein  
   CPIJ012095  mitochondrial carrier protein  
   CPIJ012803  folate carrier protein  
   CPIJ013684  Mitochondrial glutamate carrier  
   CPIJ013697  tricarboxylate transport protein, mitochondrial  
   CPIJ016473  mitochondrial solute carrier protein  
   CPIJ016474  mitochondrial solute carrier protein  
   CPIJ019834  mitochondrial carnitine/acylcarnitine carrier protein  
   CPIJ020183  folate carrier protein  
  Multidrug efflux transporter AcrB transmembrane domain CPIJ002969  conserved hypothetical protein  
210 
 
   CPIJ011712  conserved hypothetical protein  
   CPIJ019195  conserved hypothetical protein  
  NTF2-like CPIJ001995  conserved hypothetical protein  
   CPIJ005154  nuclear transport factor 2  
  Nucleoporin domain CPIJ009141  nuclear pore complex protein nup214  
  Phoshotransferase/anion transport protein CPIJ005835  sodium bicarbonate cotransporter  
  Preprotein translocase SecY subunit CPIJ002966  transport protein Sec61 subunit alpha 2  
  Sec1/munc18-like (SM) proteins CPIJ007221  vacuolar protein sorting-associated  
  Second domain of Mu2 adaptin subunit (ap50) of ap2 adaptor CPIJ003697  clathrin coat assembly protein AP50  
   CPIJ009776  AP-2 complex subunit mu  
  SNARE fusion complex CPIJ007395  conserved hypothetical protein  
   CPIJ009959  conserved hypothetical protein  
   CPIJ010472  conserved hypothetical protein  
   CPIJ011681  synaptosomal-associated protein 29  
Metabolism Amino acids m/tr SRP19 CPIJ012130  conserved hypothetical protein  
  Alanine racemase C-terminal domain-like CPIJ010687  ornithine decarboxylase  
  Arginase/deacetylase CPIJ011847  histone deacetylase  
   CPIJ019172  histone deacetylase  
  Glutaminase/Asparaginase CPIJ008684  l-asparaginase i  
  L-aspartase-like CPIJ002702  adenylosuccinate lyase  
  PLP-binding barrel CPIJ008556  ornithine decarboxylase  
   CPIJ010688  ornithine decarboxylase  
 Carbohydrate m/tr Tryptophan synthase beta subunit-like PLP-dependent enzymes CPIJ011197  threonine dehydratase/deaminase  
  (Trans)glycosidases CPIJ002066  alpha-galactosidase A  
   CPIJ003944  brain chitinase and chia  
   CPIJ004564  brain chitinase and chia  
   CPIJ008532  glycoside  hydrolase  
   CPIJ011854  CD98hc amino acid transporter protein  
   CPIJ012134  brain chitinase and chia  
   CPIJ013476  chitooligosaccharidolytic beta-N-acetylglucosaminidase  
   CPIJ014063  glycoside  hydrolase  
   CPIJ015627  alpha-N-acetyl glucosaminidase  
   CPIJ018222  alpha-amylase B  
  Aldolase CPIJ006003  delta-aminolevulinic acid dehydratase  
  Carbohydrate phosphatase CPIJ016359  myo inositol monophosphatase  
  Galactose-binding domain-like CPIJ003832  thioredoxin family Trp26  
   CPIJ008825  conserved hypothetical protein  
211 
 
   CPIJ011079  discoidin domain receptor  
   CPIJ014812  eph receptor tyrosine kinase  
  HIT-like CPIJ005586  histidine triad protein member  
  Invertebrate chitin-binding proteins CPIJ016342  conserved hypothetical protein  
   CPIJ000248  conserved hypothetical protein  
   CPIJ000681  obstractor B  
   CPIJ003955  predicted protein  
   CPIJ004334  conserved hypothetical protein  
   CPIJ004728  conserved hypothetical protein  
   CPIJ006133  conserved hypothetical protein  
   CPIJ007317  chitin binding protein  
   CPIJ007603  conserved hypothetical protein  
   CPIJ007661  conserved hypothetical protein  
   CPIJ007662  conserved hypothetical protein  
   CPIJ008466  conserved hypothetical protein  
   CPIJ008502  conserved hypothetical protein  
   CPIJ008558  conserved hypothetical protein  
   CPIJ009078  conserved hypothetical protein  
   CPIJ009407  conserved hypothetical protein  
   CPIJ009969  conserved hypothetical protein  
   CPIJ011482  conserved hypothetical protein  
   CPIJ012138  conserved hypothetical protein  
   CPIJ012316  conserved hypothetical protein  
   CPIJ012665  conserved hypothetical protein  
   CPIJ013980  conserved hypothetical protein  
   CPIJ014180  conserved hypothetical protein  
   CPIJ014194  conserved hypothetical protein  
   CPIJ014195  conserved hypothetical protein  
   CPIJ014197  conserved hypothetical protein  
   CPIJ014267  conserved hypothetical protein  
   CPIJ015173  conserved hypothetical protein  
   CPIJ015174  conserved hypothetical protein  
   CPIJ015734  conserved hypothetical protein  
   CPIJ016344  conserved hypothetical protein  
   CPIJ018321  conserved hypothetical protein  
   CPIJ018323  conserved hypothetical protein  
   CPIJ018465  conserved hypothetical protein  
   CPIJ020138  conserved hypothetical protein  
  Seven-hairpin glycosidases CPIJ006601  conserved hypothetical protein  
   CPIJ009935  mannosyl-oligosaccharide alpha-1,2-mannosidase  
212 
 
 Coenzyme m/tr Six-hairpin glycosidases CPIJ008855  maltose phosphorylase  
  Activating enzymes of the ubiquitin-like proteins CPIJ013962  sumo-1-activating enzyme E1a  
   CPIJ016556  ubiquitin-activating enzyme E1  
  Acyl-CoA dehydrogenase NM domain-like CPIJ008217  acyl-coa dehydrogenase  
   CPIJ014783  isovaleryl-CoA dehydrogenase, mitochondrial  
   CPIJ016451  crotonobetainyl-CoA dehydrogenase  
   CPIJ016453  acyl-coa dehydrogenase  
   CPIJ016454  acyl-coa dehydrogenase  
  Class II aaRS and biotin synthetases CPIJ019538  aspartyl-tRNA synthetase  
   CPIJ001182  asparaginyl-tRNA synthetase  
   CPIJ013145  prolyl-tRNA synthetase  
   CPIJ016067  phenylalanyl-tRNA synthetase beta chain  
  Glutathione synthetase ATP-binding domain-like CPIJ003283  conserved hypothetical protein  
   CPIJ009145  phosphoribosylamine-glycine ligase  
   CPIJ013436  conserved hypothetical protein  
  PCD-like CPIJ006712  conserved hypothetical protein  
  Peptide deformylase CPIJ011016  peptide deformylase, mitochondrial  
  S-adenosylmethionine decarboxylase CPIJ005587  s-adenosyl methionine decarboxylase  
  Substrate-binding domain of HMG-CoA reductase CPIJ004077  3-hydroxy-3-methylglutaryl-coenzyme A reductase  
  UROD/MetE-like CPIJ010693  uroporphyrinogen decarboxylase  
  Cytochrome b5-like heme/steroid binding domain CPIJ000318  cytochrome b5  
   CPIJ010629  membrane associated progesterone receptor  
   CPIJ013832  cytochrome b5  
   CPIJ018120  flavohemoprotein B5/b5r  
  Cytochrome c oxidase subunit h CPIJ012223  cytochrome c oxidase,-subunit VIb  
  FMN-dependent nitroreductase-like CPIJ012177  iodotyrosine dehalogenase 1  
  Molybdenum cofactor-binding domain CPIJ013919  xanthine dehydrogenase/oxidase  
   CPIJ013920  aldehyde oxidase  
   CPIJ013921  aldehyde oxidase  
   CPIJ013934  xanthine dehydrogenase/oxidase  
 Energy 6-phosphogluconate dehydrogenase C-terminal domain-like CPIJ008427  conserved hypothetical protein  
   CPIJ012165  conserved hypothetical protein  
   CPIJ013021  6-phosphogluconate dehydrogenase  
  Citrate synthase CPIJ019860  citrate synthase  
  Enolase C-terminal domain-like CPIJ013600  mandelate racemase  
  Mitochondrial cytochrome c oxidase subunit VIIa CPIJ014384  conserved hypothetical protein  
  PEP carboxykinase-like CPIJ010515  phosphoenolpyruvate carboxykinase  
  Vacuolar ATP synthase subunit C   
213 
 
 Lipid m/tr Acyl-CoA binding protein CPIJ019707  conserved hypothetical protein  
  Creatinase/prolidase N-terminal domain CPIJ016993  xaa-pro dipeptidase  
  Lipovitellin-phosvitin complex, superhelical domain CPIJ002028  conserved hypothetical protein  
  Thioesterase/thiol ester dehydrase-isomerase CPIJ009653  conserved hypothetical protein  
  YWTD domain CPIJ000808  low-density lipoprotein receptor  
   CPIJ017507  low-density lipoprotein receptor  
 Nitrogen m/tr RmlC-like cupins CPIJ003551  conserved hypothetical protein  
 Nucleotide m/tr dUTPase-like CPIJ005616  deoxyuridine 5'-triphosphate nucleotidohydrolase  
  Nucleoside hydrolase CPIJ008181  inosine-uridine preferring nucleoside hydrolase  
   CPIJ014047  inosine-uridine preferring nucleoside hydrolase  
  Nucleotidyltransferase CPIJ010886  conserved hypothetical protein  
  Nucleotidylyl transferase CPIJ010393  cysteinyl-tRNA synthetase  
   CPIJ010526  cysteinyl-tRNA synthetase  
  PRTase-like CPIJ004528  conserved hypothetical protein  
   CPIJ004967  uracil phosphoribosyltransferase  
   CPIJ012747  uridine cytidine kinase i  
  Pseudouridine synthase CPIJ002499  ribosomal pseudouridine synthase  
   CPIJ014146  conserved hypothetical protein  
  Ribonuclease H-like CPIJ002928  conserved hypothetical protein  
   CPIJ005339  ATP-binding cassette transporter  
   CPIJ008015  conserved hypothetical protein  
   CPIJ010267  3'-5' exonuclease  
  Ribulose-phoshate binding barrel CPIJ008100  conserved hypothetical protein  
  SAICAR synthase-like CPIJ001991  inositol triphosphate 3-kinase c  
   CPIJ001992  inositol triphosphate 3-kinase c  
  Tetrahydrobiopterin biosynthesis enzymes-like CPIJ000863  6-pyruvoyl tetrahydrobiopterin synthase  
   CPIJ014857  GTP cyclohydrolase i  
   CPIJ018483  GTP cyclohydrolase i  
  Acetyl-CoA synthetase-like CPIJ000424  AMP dependent coa ligase  
   CPIJ000425  short-chain-fatty-acid-CoA ligase  
   CPIJ002867  AMP dependent coa ligase  
   CPIJ007302  long-chain fatty acid transport protein 4  
   CPIJ009978  AMP dependent coa ligase  
   CPIJ009981  conserved hypothetical protein  
   CPIJ011600  long-chain-fatty-acid coa ligase  
   CPIJ015670  4-coumarate-CoA ligase 3  
   CPIJ015716  4-coumarate-CoA ligase 1  
   CPIJ017396  AMP dependent ligase  
   CPIJ018155  luciferin 4-monooxygenase  
214 
 
  Actin-like ATPase domain CPIJ004484  conserved hypothetical protein  
   CPIJ006534  conserved hypothetical protein  
   CPIJ011081  heat shock protein 70 B2  
   CPIJ011082  heat shock protein 70 B2  
   CPIJ011083  heat shock protein 70 B2  
   CPIJ019868  heat shock 70 kDa protein 4  
  Alkaline phosphatase-like CPIJ001263  membrane-bound alkaline phosphatase  
   CPIJ002095  alkaline phosphatase  
   CPIJ006774  arylsulfatase B  
   CPIJ010201  heparan n-sulfatase  
   CPIJ010661  conserved hypothetical protein  
   CPIJ011047  arylsulfatase b  
   CPIJ015241  alkaline phosphatase  
   CPIJ017042  conserved hypothetical protein  
  alpha/beta-Hydrolases CPIJ000367  lysosomal acid lipase  
   CPIJ001035  conserved hypothetical protein  
   CPIJ001352  N-myc downstream regulated  
   CPIJ002719  lipase 1  
   CPIJ002720  lysosomal acid lipase  
   CPIJ002721  lysosomal acid lipase  
   CPIJ002722  lipase 1  
   CPIJ002723  lysosomal acid lipase  
   CPIJ002726  lipase 3  
   CPIJ004066  juvenile hormone esterase  
   CPIJ004226  pancreatic triacylglycerol lipase  
   CPIJ004636  para-nitrobenzyl esterase  
   CPIJ004802  endothelial lipase  
   CPIJ006220  conserved hypothetical protein  
   CPIJ007141  esterase FE4  
   CPIJ007424  juvenile hormone esterase  
   CPIJ007825  para-nitrobenzyl esterase  
   CPIJ010991  neural stem cell-derived dendrite regulator  
   CPIJ013280  lysosomal Pro-X carboxypeptidase  
   CPIJ013720  conserved hypothetical protein  
   CPIJ013838  lipase 1  
   CPIJ013918  esterase B1  
   CPIJ014154  esterase FE4  
   CPIJ015386  hepatic triacylglycerol lipase  
   CPIJ015557  Sn1-specific diacylglycerol lipase alpha  
   CPIJ018753  juvenile hormone esterase  
215 
 
   CPIJ019227  pancreatic triacylglycerol lipase  
   CPIJ019228  pancreatic triacylglycerol lipase  
   CPIJ019996  conserved hypothetical protein  
  Amidase signature (AS) enzymes CPIJ005591  indoleacetamide hydrolase  
  Calcium-dependent phosphotriesterase CPIJ003362  odd Oz protein  
  Carbonic anhydrase CPIJ001807  carbonic anhydrase  
   CPIJ011424  carbonic anhydrase  
   CPIJ011533  carbonic anhydrase  
   CPIJ014280  carbonic anhydrase  
  Casein kinase II beta subunit CPIJ014996  casein kinase II subunit beta  
  DHH phosphoesterases CPIJ005338  PRUNE protein  
  DHS-like NAD/FAD-binding domain CPIJ002993  deoxyhypusine synthase  
  F1 ATPase inhibitor, IF1, C-terminal domain CPIJ000503  mitochondrial ATPase inhibitor  
  Folate-binding domain CPIJ014981  aminomethyltransferase, mitochondrial  
  Galactose mutarotase-like CPIJ015655  lysosomal alpha-mannosidase  
   CPIJ015656  lysosomal alpha-mannosidase  
  Glycoside hydrolase/deacetylase CPIJ006311  conserved hypothetical protein  
   CPIJ008266  conserved hypothetical protein  
   CPIJ008267  conserved hypothetical protein  
   CPIJ018088  conserved hypothetical protein  
  HAD-like CPIJ010121  copper-transporting ATPase 1  
   CPIJ008694  conserved hypothetical protein  
   CPIJ010605  conserved hypothetical protein  
   CPIJ010899  conserved hypothetical protein  
   CPIJ013914  dullard protein  
  HD-domain/PDEase-like CPIJ000309  sam/hd domain protein  
  Kinase associated domain 1, KA1 CPIJ006188  conserved hypothetical protein  
   CPIJ015835  conserved hypothetical protein  
  LysM domain CPIJ013415  nucleolar protein c7b  
  Metallo-dependent hydrolases CPIJ002583  Ampd2 protein  
   CPIJ009741  N-acetylglucosamine-6-phosphate deacetylase  
  N-acetylmuramoyl-L-alanine amidase-like CPIJ006558  peptidoglycan recognition protein la  
   CPIJ008514  peptidoglycan recognition protein-1  
  N-terminal nucleophile aminohydrolases (Ntn hydrolases) CPIJ000897  proteasome subunit alpha type 1  
   CPIJ001361  proteasome subunit beta type 3  
   CPIJ003586  proteasome subunit alpha type 3  
   CPIJ006946  proteasome subunit alpha type 2  
   CPIJ008264  proteasome subunit beta type 7  
   CPIJ009861  proteasome component PRE2  
216 
 
   CPIJ016242  proteasome subunit beta type 5,8  
   CPIJ016997  proteasome subunit beta type 5,8  
   CPIJ017386  proteasome subunit beta type 8  
   CPIJ017722  gamma glutamyl transpeptidase  
   CPIJ019606  asparagine synthetase  
  NAD kinase CPIJ009966  sphingosine kinase a, b  
  NHL repeat CPIJ003685  tripartite motif protein trim2,3  
   CPIJ003686  conserved hypothetical protein  
  Peptidyl-tRNA hydrolase domain-like CPIJ007051  immature colon carcinoma  
  PFL-like glycyl radical enzymes CPIJ005992  ribonucleoside-diphosphate reductase large subunit  
  Phosphoglycerate mutase-like CPIJ016005  acid phosphatase-1  
   CPIJ002955  multiple inositol polyphosphate phosphatase  
   CPIJ009604  phosphoglycerate mutase family member 5  
   CPIJ011248  multiple inositol polyphosphate phosphatase 1  
   CPIJ016006  conserved hypothetical protein  
  Phospholipase D/nuclease CPIJ006211  tyrosyl-dna phosphodiesterase  
   CPIJ009798  conserved hypothetical protein  
  PurM C-terminal domain-like CPIJ009144  phosphoribosylamine-glycine ligase  
  Quinoprotein alcohol dehydrogenase-like CPIJ000465  conserved hypothetical protein  
   CPIJ000963  kinesin family member 21A  
   CPIJ007852  receptor for activated protein kinase C  
   CPIJ011019  wd-repeat protein  
   CPIJ014368  conserved hypothetical protein  
   CPIJ019807  proliferation-inducing gene 21  
  Ribokinase-like CPIJ011108  conserved hypothetical protein  
   CPIJ011111  conserved hypothetical protein  
   CPIJ016881  conserved hypothetical protein  
   CPIJ020058  pyridoxal kinase  
  SGNH hydrolase CPIJ011741  platelet-activating factor acetylhydrolase IB subunit beta  
   CPIJ012575  phospholipase b  
   CPIJ012576  phospholipase b  
   CPIJ012577  phospholipase b, plb1  
   CPIJ016880  phospholipase b, plb1  
  Thiolase-like CPIJ002342  3-ketoacyl-CoA thiolase  
   CPIJ018065  trifunctional enzyme beta subunit  
  Trimeric LpxA-like enzymes CPIJ003121  dynactin subunit 5  
 Photosynthesis PRC-barrel domain CPIJ005871  conserved hypothetical protein  
 Polysaccharide m/tr DAK1/DegV-like CPIJ014451  conserved hypothetical protein  
217 
 
   CPIJ016133  dihydroxyacetone kinase  
  Ricin B-like lectins CPIJ005695  polypeptide N-acetylgalactosaminyltransferase 5  
   CPIJ014647  N-acetyl galactosaminyl transferase 7  
   CPIJ017873  16.7 kDa salivary peptide  
  RuBisCo LSMT C-terminal, substrate-binding domain CPIJ018263  conserved hypothetical protein  
  Starch-binding domain-like CPIJ011486  NOMO3 protein  
  UDP-Glycosyltransferase/glycogen phosphorylase CPIJ000038  UDP-glucuronosyltransferase 1-3  
   CPIJ004369  glucosyl transferase  
   CPIJ010412  fucosyltransferase 11  
   CPIJ013202  glycoprotein 3-alpha-L-fucosyltransferase A  
   CPIJ014333  glucosyl/glucuronosyl transferase  
 Redox 2Fe-2S ferredoxin-like CPIJ020265  aldehyde oxidase  
  Acid phosphatase/Vanadium-dependent haloperoxidase CPIJ003606  dolichyldiphosphatase 1  
  ALDH-like CPIJ013217  glutamate semialdehyde dehydrogenase  
  Aromatic aminoacid monoxygenases, catalytic and oligomerization domains CPIJ014156  conserved hypothetical protein  
  Cu,Zn superoxide dismutase-like CPIJ000146  superoxide dismutase 2  
  Cytochrome P450? CPIJ018854 CYP4C50v2 
   CPIJ001754 CYP4J6 
   CPIJ001757 CYP4H39 
   CPIJ001810 CPY4C38 
   CPIJ003361 CPY6BY2 
   CPIJ003375 CYP6BY3 
   CPIJ005899 CYP6N26P 
   CPIJ006321 *SCOP predicted cytochrome P450 
   CPIJ006322 CYP307A1 
   CPIJ008972 CYP6F5P 
   CPIJ010810 CYP325BC2 
   CPIJ016355 CYP6AK1-de1b 
   CPIJ016846 CYP6M13 
   CPIJ016847 CYP6CQ2 
   CPIJ016849 CYP6M12 
   CPIJ016850 CYP6Y4 
   CPIJ016853 CYP6N21P 
   CPIJ016854 CYP6N22 
   CPIJ016856 CYP6N18 
   CPIJ017245 CYP304B6 
   CPIJ017351 CYP4C50v1 
   CPIJ018716 CYP4C38 
   CPIJ019704 CYP6N24 
218 
 
  FAD-dependent thiol oxidase CPIJ012226  augmenter of liver regeneration  
  FAD/NAD-linked reductases, dimerisation (C-terminal) domain CPIJ002642  apoptosis-inducing factor 1, mitochondrial  
  Ferredoxin reductase-like, C-terminal NADP-linked domain CPIJ003578  conserved hypothetical protein  
  Formate/glycerate dehydrogenase catalytic domain-like CPIJ006365  conserved hypothetical protein  
   CPIJ011531  adenosyl homocysteinase  
  Heme-dependent peroxidases CPIJ003117  dual oxidase 1  
   CPIJ016742  thyroid peroxidase  
   CPIJ018105  chorion peroxidase  
  Inosine monophosphate dehydrogenase (IMPDH) CPIJ011687  inosine-5'-monophosphate dehydrogenase  
  Metallo-hydrolase/oxidoreductase CPIJ011621  conserved hypothetical protein  
   CPIJ011625  conserved hypothetical protein  
   CPIJ019501  hydroxyacylglutathione hydrolase  
   CPIJ019503  DNA cross-link repair 1A protein  
  NAD(P)-linked oxidoreductase CPIJ003374  aldo-keto reductase  
   CPIJ003393  aldose reductase  
   CPIJ003722  aldo-keto reductase  
   CPIJ017461  aldo-keto reductase  
  PHM/PNGase F CPIJ014202  dopamine beta hydroxylase  
  Thioredoxin-like CPIJ001856  conserved hypothetical protein  
   CPIJ003089  SCO1, mitochondrial  
   CPIJ003399  peroxiredoxins, prx-1, prx-2, prx-3  
   CPIJ003709  thioredoxin, mitochondrial  
   CPIJ003981  15 kDa selenoprotein  
   CPIJ007327  disulfide-isomerase A6  
   CPIJ008802  conserved hypothetical protein  
   CPIJ009940  conserved hypothetical protein  
   CPIJ010610  NADH-ubiquinone oxidoreductase B8 subunit  
   CPIJ011296  peroxiredoxin 6  
   CPIJ012568  phospholipid hydroperoxide glutathione peroxidase 1  
   CPIJ015346  glutaredoxin, grx  
   CPIJ016175  glutaredoxin, grx  
   CPIJ017364  endoplasmic reticulum resident protein  
   CPIJ017625  conserved hypothetical protein  
 Secondary metabolism Clavaminate synthase-like CPIJ014046  conserved hypothetical protein  
   CPIJ014507  conserved hypothetical protein  
   CPIJ017090  gamma-butyrobetaine dioxygenase  
   CPIJ017091  gamma-butyrobetaine dioxygenase  
219 
 
   CPIJ018084  uty-prov protein  
  Concanavalin A-like lectins/glucanases CPIJ001299  keratinocyte lectin  
   CPIJ004321  gram-negative bacteria binding protein  
   CPIJ004683  laminin alpha-1, 2 chain  
   CPIJ004919  conserved hypothetical protein  
   CPIJ005988  conserved hypothetical protein  
   CPIJ006598  tripartite motif protein trim9  
   CPIJ012172  conserved hypothetical protein  
   CPIJ012874  kinase c-binding protein nell1  
   CPIJ013642  conserved hypothetical protein  
   CPIJ016123  conserved hypothetical protein  
  Homo-oligomeric flavin-containing Cys decarboxylases, HFCD CPIJ019818  phosphopantothenoylcysteine decarboxylase  
  Terpenoid synthases CPIJ008089  conserved hypothetical protein  
   CPIJ016309  candidate tumor suppressor protein  
   CPIJ016310  candidate tumor suppressor protein  
   CPIJ016311  decaprenyl-diphosphate synthase subunit 2  
 Transferases 4'-phosphopantetheinyl transferase CPIJ011416  aminoadipate-semialdehyde dehydrogenase  
  Acyl-CoA N-acyltransferases (Nat) CPIJ000413  conserved hypothetical protein  
   CPIJ001343  histone acetyltransferase type B catalytic subunit  
   CPIJ008392  N-acetyltransferase 5  
   CPIJ010396  conserved hypothetical protein  
   CPIJ012930  conserved hypothetical protein  
   CPIJ015282  dopamine N acetyltransferase  
   CPIJ015982  N-acetyl transferase separation anxiety  
  Class I glutamine amidotransferase-like CPIJ006930  gamma-glutamyl hydrolase  
  CoA-dependent acyltransferases CPIJ001609  choline O-acetyltransferase  
   CPIJ005612  carnitine o-acyltransferase  
  Formyltransferase CPIJ009143  phosphoribosylglycinamide formyltransferase  
  Glycerol-3-phosphate (1)-acyltransferase CPIJ004138  1-acyl-sn-glycerol-3-phosphate acyltransferase  
   CPIJ004141  1-acyl-sn-glycerol-3-phosphate acyltransferase beta  
   CPIJ013939  glycerol-3-phosphate acyltransferase  
   CPIJ015965  transmembrane protein 68  
  Homocysteine S-methyltransferase CPIJ008869  homocysteine S-methyltransferase  
  MIR domain CPIJ016258  probable ER retained protein  
  NagB/RpiA/CoA transferase-like CPIJ004258  ribose-5-phosphate isomerase  
   CPIJ005163  conserved hypothetical protein  
   CPIJ006915  translation initiation factor 2b, delta subunit  
   CPIJ008074  glucosamine-6-phosphate isomerase  
   CPIJ011933  conserved hypothetical protein  
220 
 
  Nucleotide-diphospho-sugar transferases CPIJ003171  UDP-n-acteylglucosamine pyrophosphorylase  
   CPIJ000257  conserved hypothetical protein  
   CPIJ002650  dolichol-phosphate mannosyltransferase  
   CPIJ004318  galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase I  
   CPIJ005229  N-acetyl galactosaminyl transferase 6  
   CPIJ012815  mannose-1-phosphate guanyltransferase  
   CPIJ016255  chitin synthase  
   CPIJ018702  beta-1,3-galactosyltransferase brn  
  PLP-dependent transferases CPIJ003522  cysteine desulfurase, mitochondrial  
   CPIJ010034  glutamate decarboxylase  
   CPIJ013307  aromatic-L-amino-acid decarboxylase  
  Protein prenylyltransferase CPIJ005820  geranylgeranyl transferase type-2 alpha subunit  
   CPIJ017557  smile protein  
  S-adenosyl-L-methionine-dependent methyltransferases CPIJ001152  HemK methyltransferase family member 2  
   CPIJ001336  ribosomal RNA large subunit methyltransferase J  
   CPIJ001402  histone-arginine methyltransferase CARM1  
   CPIJ001578  conserved hypothetical protein  
   CPIJ005043  conserved hypothetical protein  
   CPIJ006933  conserved hypothetical protein  
   CPIJ007234  AdoMet-dependent rRNA methyltransferase spb1  
   CPIJ008978  conserved hypothetical protein  
   CPIJ010001  tRNA methyltransferase  
   CPIJ010915  arginine n-methyltransferase  
   CPIJ013558  23S rRNA methyltransferase  
   CPIJ016651  HemK methyltransferase family member 1  
   CPIJ018143  conserved hypothetical protein  
Regulation   CPIJ009244  conserved hypothetical protein  
 DNA-binding AlbA-like CPIJ010569  conserved hypothetical protein  
  AN1-like Zinc finger CPIJ002707  zinc finger protein  
   CPIJ002783  AN1-type zinc finger protein 2B  
  ARID-like CPIJ008131  receptor for activated protein kinase C  
  ATP-dependent DNA ligase DNA-binding domain CPIJ017286  conserved hypothetical protein  
  Bromodomain CPIJ007940  conserved hypothetical protein  
   CPIJ012613  conserved hypothetical protein  
  C2H2 and C2HC zinc fingers CPIJ018818  conserved hypothetical protein  
   CPIJ000409  conserved hypothetical protein  
   CPIJ000911  zinc finger protein 383  
   CPIJ001029  serendipity locus protein delta  
   CPIJ001300  zinc finger protein 780B  
221 
 
   CPIJ001471  transcription factor hamlet  
   CPIJ001473  conserved hypothetical protein  
   CPIJ001552  conserved hypothetical protein  
   CPIJ001985  conserved hypothetical protein  
   CPIJ002705  zinc finger protein 90  
   CPIJ002824  predicted protein  
   CPIJ002932  conserved hypothetical protein  
   CPIJ003270  broad-complex core-protein  
   CPIJ003609  Sp5 transcription factor  
   CPIJ003667  zinc finger protein 141  
   CPIJ003749  tRNA delta 
   CPIJ003796  conserved hypothetical protein  
   CPIJ004257  zinc finger-containing protein  
   CPIJ004351  zinc finger protein 92  
   CPIJ004384  zinc finger protein  
   CPIJ004667  zinc finger protein  
   CPIJ004785  conserved hypothetical protein  
   CPIJ004963  conserved hypothetical protein  
   CPIJ005175  transcription factor sp8,sp9  
   CPIJ005503  zinc finger protein 36  
   CPIJ005812  zinc finger protein  
   CPIJ005813  zinc finger protein  
   CPIJ006385  conserved hypothetical protein  
   CPIJ006765  conserved hypothetical protein  
   CPIJ006854  conserved hypothetical protein  
   CPIJ006855  zinc finger protein  
   CPIJ007837  zinc finger protein  
   CPIJ007858  conserved hypothetical protein  
   CPIJ008060  conserved hypothetical protein  
   CPIJ008297  conserved hypothetical protein  
   CPIJ008361  double-stranded RNA-binding protein zn72d  
   CPIJ008549  conserved hypothetical protein  
   CPIJ008696  conserved hypothetical protein  
   CPIJ009409  conserved hypothetical protein  
   CPIJ009502  zinc finger protein  
   CPIJ009503  zinc finger protein 583  
   CPIJ009524  forkhead box protein  
   CPIJ009647  conserved hypothetical protein  
   CPIJ009780  zinc finger protein 75A  
   CPIJ009786  zinc finger protein  
222 
 
   CPIJ009787  zinc finger protein 582  
   CPIJ009989  zinc finger protein  
   CPIJ009990  zinc finger protein  
   CPIJ010551  predicted protein  
   CPIJ010652  conserved hypothetical protein  
   CPIJ010850  conserved hypothetical protein  
   CPIJ011015  conserved hypothetical protein  
   CPIJ011166  zinc finger protein  
   CPIJ011789  conserved hypothetical protein  
   CPIJ012039  conserved hypothetical protein  
   CPIJ012535  zinc finger protein  
   CPIJ012594  predicted protein  
   CPIJ012610  zinc finger protein 38  
   CPIJ013068  zinc finger protein  
   CPIJ013118  conserved hypothetical protein  
   CPIJ013246  conserved hypothetical protein  
   CPIJ013653  conserved hypothetical protein  
   CPIJ014029  conserved hypothetical protein  
   CPIJ014036  conserved hypothetical protein  
   CPIJ014135  conserved hypothetical protein  
   CPIJ014711  zinc finger protein  
   CPIJ014712  krueppel protein  
   CPIJ014714  zinc finger protein  
   CPIJ014715  zinc finger protein  
   CPIJ015000  zinc finger protein 250  
   CPIJ015265  zinc finger protein 345  
   CPIJ015267  zinc finger protein ZNF780A  
   CPIJ015425  conserved hypothetical protein  
   CPIJ015578  hypothetical protein  
   CPIJ015579  conserved hypothetical protein  
   CPIJ015582  conserved hypothetical protein  
   CPIJ016725  conserved hypothetical protein  
   CPIJ016726  conserved hypothetical protein  
   CPIJ016862  conserved hypothetical protein  
   CPIJ016943  conserved hypothetical protein  
   CPIJ016944  conserved hypothetical protein  
   CPIJ017035  zinc finger protein 141  
   CPIJ017141  conserved hypothetical protein  
   CPIJ017142  conserved hypothetical protein  
   CPIJ017259  predicted protein  
223 
 
   CPIJ017278  zinc finger protein 436  
   CPIJ017355  conserved hypothetical protein  
   CPIJ017654  conserved hypothetical protein  
   CPIJ017756  conserved hypothetical protein  
   CPIJ018074  conserved hypothetical protein  
   CPIJ018336  conserved hypothetical protein  
   CPIJ018423  zinc finger protein  
   CPIJ018448  transcription factor btd  
   CPIJ018505  zinc finger transcription factor  
   CPIJ019181  U1 small nuclear ribonucleoprotein C  
   CPIJ019417  zinc finger protein 322A  
   CPIJ019621  conserved hypothetical protein  
   CPIJ019710  conserved hypothetical protein  
   CPIJ019775  conserved hypothetical protein  
   CPIJ020207  zinc finger protein 36  
  CCCH zinc finger CPIJ018734  conserved hypothetical protein  
  CSL zinc finger CPIJ001284  conserved hypothetical protein  
  Cyclin-like CPIJ006843  transcription initiation factor TFIIB  
   CPIJ010939  conserved hypothetical protein  
   CPIJ012914  cyclin T  
   CPIJ013566  cyclin a  
   CPIJ013567  cyclin a  
  Cysteine-rich DNA binding domain, (DM domain) CPIJ004057  male-specific doublesex protein  
  DNA-binding domain CPIJ004606  phd finger domain  
  Glucocorticoid receptor-like (DNA-binding domain) CPIJ002376  elongation factor 1-alpha  
   CPIJ002547  conserved hypothetical protein  
   CPIJ002808  conserved hypothetical protein  
   CPIJ002811  conserved hypothetical protein  
   CPIJ005912  conserved hypothetical protein  
   CPIJ006674  malate dehydrogenase  
   CPIJ006684  predicted protein  
   CPIJ006830  conserved hypothetical protein  
   CPIJ007349  zinc finger protein 225  
   CPIJ007701  predicted protein  
   CPIJ008216  nuclear hormone receptor ftz-f1  
   CPIJ008348  GATA transcription factor GATAd  
   CPIJ008682  hypothetical protein  
   CPIJ009297  conserved hypothetical protein  
   CPIJ009298  conserved hypothetical protein  
   CPIJ009299  four and a half lim domains  
224 
 
   CPIJ010100  conserved hypothetical protein  
   CPIJ010408  conserved hypothetical protein  
   CPIJ010866  conserved hypothetical protein  
   CPIJ011684  conserved hypothetical protein  
   CPIJ011743  conserved hypothetical protein  
   CPIJ012188  epsilon-trimethyllysine 2-oxoglutarate dioxygenase  
   CPIJ012588  predicted protein  
   CPIJ013614  conserved hypothetical protein  
   CPIJ014027  conserved hypothetical protein  
   CPIJ014086  conserved hypothetical protein  
   CPIJ014594  predicted protein  
   CPIJ016033  GATA-binding factor-C  
   CPIJ016621  conserved hypothetical protein  
   CPIJ017547  conserved hypothetical protein  
   CPIJ018862  retinoic acid receptor beta  
  Histone-fold CPIJ001398  transcription initiation factor TFIID subunit 9  
   CPIJ008494  histone h2a  
   CPIJ010882  conserved hypothetical protein  
   CPIJ011778  transcription initiation factor TFIID subunit 12  
   CPIJ014768  histone 1  
   CPIJ017187  histone H3.3 type 2  
   CPIJ017276  suppressor of ty3  
   CPIJ018900  conserved hypothetical protein  
  HIT/MYND zinc finger-like CPIJ014434  predicted protein  
   CPIJ017587  conserved hypothetical protein  
  HLH, helix-loop-helix DNA-binding domain CPIJ002332  conserved hypothetical protein  
   CPIJ003409  enhancer of split mgamma protein  
   CPIJ007015  conserved hypothetical protein  
   CPIJ008120  conserved hypothetical protein  
   CPIJ012827  conserved hypothetical protein  
   CPIJ015080  conserved hypothetical protein  
   CPIJ015473  max binding protein  
  HMG-box CPIJ001997  conserved hypothetical protein  
   CPIJ005084  coiled-coil domain-containing protein 124  
   CPIJ006395  conserved hypothetical protein  
   CPIJ012202  capicua protein  
   CPIJ014423  conserved hypothetical protein  
   CPIJ014424  conserved hypothetical protein  
   CPIJ017659  conserved hypothetical protein  
  Homeodomain-like CPIJ001021  homeobox protein abdominal-B  
225 
 
   CPIJ002815  conserved hypothetical protein  
   CPIJ005379  metastasis-associated protein 3  
   CPIJ005827  predicted protein  
   CPIJ006382  paired box protein pax-6  
   CPIJ006390  paired box protein Pax-6  
   CPIJ008039  homeobox protein extradenticle  
   CPIJ009982  rest corepressor protein  
   CPIJ010220  segmentation polarity homeobox protein engrailed  
   CPIJ012080  conserved hypothetical protein  
   CPIJ012784  zinc finger protein 1  
   CPIJ014669  predicted protein  
   CPIJ015889  homeobox protein  
   CPIJ017153  conserved hypothetical protein  
   CPIJ017214  mesoderm induction early response protein 1  
   CPIJ019460  hypothetical protein  
  Insert subdomain of RNA polymerase alpha subunit CPIJ003123  DNA-directed RNA polymerase I 40 kDa polypeptide  
  Kix domain of CBP (creb binding protein) CPIJ005540  conserved hypothetical protein  
  lambda repressor-like DNA-binding domains CPIJ003986  multiprotein bridging factor  
   CPIJ014526  conserved hypothetical protein  
  Leucine zipper domain CPIJ003266  CCAAT/enhancer-binding protein  
   CPIJ003767  conserved hypothetical protein  
   CPIJ003805  cyclic-AMP response element binding protein  
   CPIJ012178  ovary C/EBPg transcription factor  
   CPIJ014920  par domain protein  
   CPIJ016941  conserved hypothetical protein  
  p53-like transcription factors CPIJ000431  conserved hypothetical protein  
   CPIJ000433  T-box protein H15  
   CPIJ000721  conserved hypothetical protein  
   CPIJ002764  conserved hypothetical protein  
   CPIJ007738  T-box protein H15  
   CPIJ016469  signal transducer and activator of transcription  
  Periplasmic binding protein-like I CPIJ010082  atrial natriuretic peptide receptor  
   CPIJ019599  glutamate receptor, ionotropic kainate 1, 2, 3  
   CPIJ020040  conserved hypothetical protein  
  Putative DNA-binding domain CPIJ000580  ladybird homeobox corepressor  
   CPIJ000978  transforming protein Ski  
  RPB6/omega subunit-like CPIJ018444  DNA-directed RNA polymeraseI  
  SAM/Pointed domain CPIJ000845  conserved hypothetical protein  
   CPIJ000860  conserved hypothetical protein  
   CPIJ009010  conserved hypothetical protein  
226 
 
   CPIJ017757  conserved hypothetical protein  
  SAP domain CPIJ007511  conserved hypothetical protein  
  SMAD MH1 domain CPIJ009526  nuclear factor i  
  SMAD/FHA domain CPIJ000274  conserved hypothetical protein  
   CPIJ006464  nuclear inhibitor of protein phosphatase 1  
   CPIJ006834  kinesin-like protein KIF1B  
   CPIJ009516  conserved hypothetical protein  
  SRF-like CPIJ008335  conserved hypothetical protein  
   CPIJ016459  conserved hypothetical protein  
  Tim10-like CPIJ018054  mitochondrial import inner membrane translocase subunit Tim8 A  
   CPIJ010382  mitochondrial import inner membrane translocase subunit Tim10  
   CPIJ010840  mitochondrial inner membrane protein translocase, 9kD-subunit  
   CPIJ018053  mitochondrial inner membrane protein translocase, 8kD-subunit  
   CPIJ018211  mitochondrial inner membrane protein translocase, 13kD-subunit  
  Winged helix DNA-binding domain CPIJ001680  DNA-binding protein D-ELG  
   CPIJ001711  conserved hypothetical protein  
   CPIJ003068  conserved hypothetical protein  
   CPIJ003923  conserved hypothetical protein  
   CPIJ004011  rfx transcription factor  
   CPIJ009522  conserved hypothetical protein  
   CPIJ010292  vacuolar protein sorting-associated protein 25  
   CPIJ013475  transcription initiation factor IIE subunit beta  
   CPIJ014720  ets DNA-binding protein pokkuri  
   CPIJ015971  26S proteasome non-ATPase regulatory subunit 11  
 Kinases/phosphatases (Phosphotyrosine protein) phosphatases II CPIJ018450  slingshot dual specificity phosphatase  
   CPIJ019559  phosphatase Slingshot  
   CPIJ001969  tyrosine phosphatase prl  
   CPIJ003757  tyrosine phosphatase mitochondrial 1  
   CPIJ008018  dual specificity protein phosphatase  
   CPIJ008808  conserved hypothetical protein  
   CPIJ009405  testis/ seletal muscle dual specificty phosphatase  
   CPIJ011976  tyrosine phosphatase, non-receptor type nt1  
   CPIJ013410  tyrosine-protein phosphatase Lar  
   CPIJ014898  tyrosine phosphatase n11  
227 
 
   CPIJ018298  tryrosine phosphatase  
  FAT domain of focal adhesion kinase CPIJ017572  focal adhesion kinase  
  GHMP Kinase, C-terminal domain CPIJ015185  conserved hypothetical protein  
  Myosin phosphatase inhibitor 17kDa protein, CPI-17 CPIJ004356  conserved hypothetical protein  
  Phosphotyrosine protein phosphatases I CPIJ008291  low molecular weight phosphotyrosine protein phosphatase 1  
  PP2C-like CPIJ012255  pyruvate dehydrogenase  
  Protein kinase-like (PK-like) CPIJ010275  map/microtubule affinity-regulating kinase 2,4  
   CPIJ000270  tyrosine kinase  
   CPIJ000288  serine/threonine-protein kinase 3  
   CPIJ000816  kinase protein  
   CPIJ000833  tyrosine-protein kinase btk29a  
   CPIJ000891  cell division protein kinase 8  
   CPIJ001155  cell division protein kinase 2  
   CPIJ001273  conserved hypothetical protein  
   CPIJ003568  mitosis inhibitor protein kinase  
   CPIJ003599  serine/threonine protein kinase  
   CPIJ003985  tyrosine-protein kinase Abl  
   CPIJ003996  calcium-dependent protein kinase  
   CPIJ004173  Juvenile hormone-inducible protein  
   CPIJ004685  Dual specificity tyrosine-phosphorylation-regulated kinase  
   CPIJ004687  Dual specificity tyrosine-phosphorylation-regulated kinase  
   CPIJ004799  activin receptor type I  
   CPIJ004910  serine/threonine kinase NLK  
   CPIJ005276  cGMP-protein kinase  
   CPIJ005290  conserved hypothetical protein  
   CPIJ005449  nuclear body associated kinase  
   CPIJ006283  ser/thr protein kinase-trb3  
   CPIJ006284  ser/thr protein kinase-trb3  
   CPIJ006704  serine/threonine-protein kinase D3  
   CPIJ007227  tyrosine-protein kinase  
   CPIJ007458  tyrosine-protein kinase src64b  
   CPIJ008931  dual specificity mitogen-activated protein kinase kinase hemipterous  
   CPIJ008953  mitogen-activated protein kinase kinase kinase  
   CPIJ009012  mixed lineage protein kinase  
   CPIJ009223  serine/threonine-protein kinase  
   CPIJ010322  cell division control protein  
   CPIJ011073  discoidin domain receptor  
   CPIJ011673  cell division control protein  
   CPIJ011936  S6 kinase II beta  
228 
 
   CPIJ012176  ribosomal protein S6 kinase, 90kD, polypeptide  
   CPIJ012534  eukaryotic translation initiation factor 2-alpha kinase 1  
   CPIJ012560  leucine-rich repeat serine/threonine-protein kinase 1  
   CPIJ013693  serine/threonine-protein kinase rio2  
   CPIJ013835  conserved hypothetical protein  
   CPIJ013942  conserved hypothetical protein  
   CPIJ014803  Dual specificity tyrosine-phosphorylation-regulated kinase  
   CPIJ015689  serine/threonine-protein kinase rio2  
   CPIJ015690  serine/threonine-protein kinase RIO2  
   CPIJ015801  mitogen activated protein kinase kinase 2  
   CPIJ015833  map/microtubule affinity-regulating kinase 2,4  
   CPIJ015918  conserved hypothetical protein  
   CPIJ015922  Juvenile hormone-inducible protein  
   CPIJ016475  conserved hypothetical protein  
   CPIJ016644  integrin-linked protein kinase  
   CPIJ016729  serine/threonine-protein kinase vrk  
   CPIJ016868  conserved hypothetical protein  
   CPIJ018008  fibroblast growth factor receptor  
   CPIJ018201  serine/threonine protein kinase lats  
   CPIJ019408  conserved hypothetical protein  
   CPIJ019493  fibroblast growth factor receptor 1  
   CPIJ019683  conserved hypothetical protein  
 
Other 
regulatory 
function 
GCM domain CPIJ006640  conserved hypothetical protein  
  Mago nashi protein CPIJ002949  mago nashi  
  Mob1/phocein CPIJ002914  conserved hypothetical protein  
  N-terminal domain of adenylylcyclase associated protein, CAP CPIJ003125  adenylyl cyclase-associated protein  
  Ran BP2/NZF zinc finger-like CPIJ003010  conserved hypothetical protein  
   CPIJ007177  nucleoporin, Nup153  
  Sec7 domain CPIJ002812  guanyl-nucleotide exchange factor  
   CPIJ015585  arf6 guanine nucleotide exchange factor  
 Receptor activity Chemosensory protein Csp2 CPIJ019986  serine/threonine kinase  
   CPIJ002601  conserved hypothetical protein  
   CPIJ002605  serine/threonine kinase  
   CPIJ002607  conserved hypothetical protein  
   CPIJ002608  chemosensory protein  
   CPIJ002609  serine/threonine kinase  
229 
 
   CPIJ002616  serine/threonine kinase  
   CPIJ002625  chemosensory protein 1  
   CPIJ002629  sensory appendage protein  
   CPIJ017094  serine/threonine kinase  
   CPIJ019985  sensory appendage protein  
 RNA binding, m/tr Alpha-L RNA-binding motif CPIJ016140  tyrosyl-tRNA synthetase  
  dsRNA-binding domain-like CPIJ003264  40S ribosomal protein S2  
   CPIJ004832  tar RNA binding protein  
   CPIJ006845  40S ribosomal protein S2  
   CPIJ008332  40S ribosomal protein S2  
   CPIJ009774  40S ribosomal protein S2  
   CPIJ011850  double-stranded RNA-specific editase Adar  
   CPIJ013506  ATP-dependent RNA helicase  
   CPIJ014041  conserved hypothetical protein  
  Nop domain CPIJ002179  U4/U6 small nuclear ribonucleoprotein Prp31  
  Nop10-like SnoRNP CPIJ018833  H/ACA ribonucleoprotein complex subunit 3  
  PUA domain-like CPIJ006069  adenylsulfate kinase  
   CPIJ008799  ATP-dependent Lon protease  
   CPIJ012137  conserved hypothetical protein  
  RNA-binding domain, RBD CPIJ014704  splicing factor  
   CPIJ019416  splicing factor  
   CPIJ000025  negative elongation factor E  
   CPIJ000485  conserved hypothetical protein  
   CPIJ000588  polypyrimidine tract binding protein  
   CPIJ000880  RNA-binding post-transcriptional regulator csx1  
   CPIJ001612  heterogeneous nuclear ribonucleoprotein  
   CPIJ003074  conserved hypothetical protein  
   CPIJ003555  nuclear cap-binding protein subunit 2  
   CPIJ003738  heterogeneous nuclear ribonucleoprotein r  
   CPIJ003854  conserved hypothetical protein  
   CPIJ003881  G-rich sequence factor-1  
   CPIJ004538  conserved hypothetical protein  
   CPIJ004892  conserved hypothetical protein  
   CPIJ005653  developmentally regulated RNA-binding protein  
   CPIJ006107  NONA protein  
   CPIJ006979  polypyrimidine tract binding protein  
   CPIJ007047  serine/arginine rich splicing factor  
   CPIJ007295  conserved hypothetical protein  
   CPIJ007629  splicing factor  
230 
 
   CPIJ007834  RNA and export factor binding protein  
   CPIJ008248  conserved hypothetical protein  
   CPIJ008476  conserved hypothetical protein  
   CPIJ008628  predicted protein  
   CPIJ008634  52K active chromatin boundary protein  
   CPIJ008698  rbm25 protein  
   CPIJ008786  arginine/serine-rich splicing factor  
   CPIJ009773  conserved hypothetical protein  
   CPIJ012174  conserved hypothetical protein  
   CPIJ012515  conserved hypothetical protein  
   CPIJ012662  cleavage stimulation factor 64 kDa subunit  
   CPIJ012814  scaffold attachment factor b  
   CPIJ012850  splicing factor u2af large subunit  
   CPIJ013237  conserved hypothetical protein  
   CPIJ014506  fuse-binding protein-interacting repressor siahbp1  
   CPIJ015052  RNA binding motif protein 18  
   CPIJ015262  heterogeneous nuclear ribonucleoprotein 27C  
   CPIJ015350  eukaryotic translation initiation factor 3 subunit 4  
   CPIJ015549  ribosomal biogenesis protein Gar2  
   CPIJ016143  conserved hypothetical protein  
   CPIJ016329  conserved hypothetical protein  
   CPIJ016517  conserved hypothetical protein  
   CPIJ017755  conserved hypothetical protein  
   CPIJ018451  conserved hypothetical protein  
  Surp module (SWAP domain) CPIJ017179  scaffold attachment factor B  
 Signal transduction C2 domain (Calcium/lipid-binding domain, CaLB) CPIJ005008  E3 ubiquitin ligase  
   CPIJ005701  kinase C alpha-polypeptide  
   CPIJ011785  E3 ubiquitin-protein ligase nedd-4  
   CPIJ015045  conserved hypothetical protein  
   CPIJ015112  E3 ubiquitin-protein ligase nedd-4  
   CPIJ016865  conserved hypothetical protein  
  cAMP-binding domain-like CPIJ004551  conserved hypothetical protein  
   CPIJ005277  conserved hypothetical protein  
   CPIJ005279  cGMP-dependent protein kinase  
   CPIJ006213  cyclic nucleotide-gated cation channel 4  
   CPIJ015446  cyclic-nucleotide-gated cation channel  
   CPIJ015653  cGMP-dependent protein kinase  
   CPIJ015942  c-AMP dependent protein kinase typeI-beta regulatory subunit  
231 
 
   CPIJ018420  conserved hypothetical protein  
   CPIJ019876  cyclic nucleotide-gated cation channel beta 3  
  DBL homology domain (DH-domain) CPIJ001482  pak-interacting exchange factor, beta-pix/cool-1  
   CPIJ004982  rho guanine exchange factor  
   CPIJ011504  RHO guanyl-nucleotide exchange factor  
   CPIJ013987  conserved hypothetical protein  
   CPIJ015421  Rho GEF and pleckstrin domain protein  
   CPIJ017598  guanine nucleotide exchange factor  
  Family A G protein-coupled receptor-like CPIJ006268  cardioacceleratory peptide receptor  
   CPIJ006269  cardioacceleratory peptide receptor  
   CPIJ011619  leucine-rich transmembrane protein  
   CPIJ014487  beta adrenergic receptor  
   CPIJ014753  conserved hypothetical protein  
   CPIJ015979  conserved hypothetical protein  
   CPIJ016092  adenosine A2 receptor  
  Frizzled cysteine-rich domain CPIJ011799  conserved hypothetical protein  
  Growth factor receptor domain CPIJ009117  conserved hypothetical protein  
   CPIJ015183  proprotein convertase subtilisin/kexin type 4, furin  
   CPIJ017374  conserved hypothetical protein  
  GTPase activation domain, GAP CPIJ010879  conserved hypothetical protein  
   CPIJ012517  cdc42 GTPase-activating protein  
   CPIJ015825  conserved hypothetical protein  
   CPIJ019727  conserved hypothetical protein  
  Insect pheromone/odorant-binding proteins CPIJ001867  hypothetical protein  
   CPIJ001871  hypothetical protein  
   CPIJ001874  Odorant-binding protein 56a  
   CPIJ003865  conserved hypothetical protein  
   CPIJ003866  conserved hypothetical protein  
   CPIJ004634  odorant-binding protein  
   CPIJ004635  odorant-binding protein OBPjj7a  
   CPIJ007337  conserved hypothetical protein  
   CPIJ010787  conserved hypothetical protein  
   CPIJ010788  conserved hypothetical protein  
   CPIJ018881  tRNA delta 
  Insulin-like CPIJ018049  conserved hypothetical protein  
  Nicotinic receptor ligand binding domain-like CPIJ007639  acetylcholine receptor protein alpha 1, 2, 3, 4 invertebrate  
   CPIJ016909  nicotinic acetylcholine receptor, beta-2 subunit  
  Nuclear receptor ligand-binding domain CPIJ002963  ecdysone receptor  
   CPIJ004609  nuclear hormone receptor  
   CPIJ008215  nuclear hormone receptor ftz-f1  
232 
 
   CPIJ009588  conserved hypothetical protein  
   CPIJ014945  nuclear hormone receptor ftz-f1  
   CPIJ015542  nuclear receptor 3  
   CPIJ016024  retinoid x receptor  
  Nucleotide cyclase CPIJ004739  adenylate cyclase  
   CPIJ015189  adenylate cyclase  
   CPIJ017081  guanylate cyclase soluble subunit beta-1  
   CPIJ017287  adenylate cyclase type  
   CPIJ019946  adenylate cyclase type 5  
  PDZ domain-like CPIJ001710  conserved hypothetical protein  
   CPIJ003808  partitioning defective 3  
   CPIJ004495  conserved hypothetical protein  
   CPIJ005564  26S proteasome non-ATPase regulatory subunit 9  
   CPIJ006020  conserved hypothetical protein  
   CPIJ006377  conserved hypothetical protein  
   CPIJ007358  conserved hypothetical protein  
   CPIJ007684  conserved hypothetical protein  
   CPIJ010875  conserved hypothetical protein  
   CPIJ015012  conserved hypothetical protein  
   CPIJ016071  golgi reassembly-stacking protein 2  
   CPIJ018273  conserved hypothetical protein  
   CPIJ018340  ezrin-radixin-moesin-binding phosphoprotein 50  
   CPIJ019226  Glutamate receptor binding protein  
   CPIJ019766  conserved hypothetical protein  
  PH domain-like CPIJ000361  conserved hypothetical protein  
   CPIJ004690  numb protein  
   CPIJ004706  vasodilator-stimulated phosphoprotein  
   CPIJ005592  decapping protein 1  
   CPIJ005688  conserved hypothetical protein  
   CPIJ006699  wiskott-aldrich syndrome protein  
   CPIJ007927  conserved hypothetical protein  
   CPIJ009368  conserved hypothetical protein  
   CPIJ009993  conserved hypothetical protein  
   CPIJ010369  conserved hypothetical protein  
   CPIJ010878  conserved hypothetical protein  
   CPIJ011071  structure-specific recognition protein  
   CPIJ011748  conserved hypothetical protein  
   CPIJ012737  nucleoporin 50kDa  
   CPIJ013583  conserved hypothetical protein  
   CPIJ013686  signal transduction protein lnk-realted  
233 
 
   CPIJ013709  conserved hypothetical protein  
   CPIJ013938  conserved hypothetical protein  
   CPIJ018995  conserved hypothetical protein  
   CPIJ019612  myosin xv  
   CPIJ019728  conserved hypothetical protein  
   CPIJ019740  conserved hypothetical protein  
   CPIJ020011  FACT complex subunit Ssrp1  
  PX domain CPIJ001623  sorting nexin  
   CPIJ005342  sorting nexin-6  
   CPIJ006689  conserved hypothetical protein  
   CPIJ010119  sorting nexin-9  
   CPIJ013306  conserved hypothetical protein  
  PYP-like sensor domain (PAS domain) CPIJ003682  hypoxia-inducible factor  
   CPIJ013448  conserved hypothetical protein  
   CPIJ014773  arylhydrocarbon receptor nuclear translocator  
  Rap/Ran-GAP CPIJ018142  rap GTPase-activating protein  
  Ras GEF CPIJ005593  ras GTP exchange factor, son of sevenless  
   CPIJ005901  ral guanine nucleotide exchange factor 2  
   CPIJ017680  c-AMP-dependent rap1 guanine-nucleotide exchange factor  
  Regulator of G-protein signaling, RGS CPIJ004658  beta-adrenergic receptor kinase  
   CPIJ006996  conserved hypothetical protein  
   CPIJ015931  regulator of g protein signaling  
  SH2 domain CPIJ000806  growth factor receptor-bound protein  
   CPIJ003100  cytoplasmic protein NCK1  
   CPIJ003380  suppressorsof cytokine signalling  
   CPIJ010659  proto-oncogene tyrosine-protein kinase src  
   CPIJ012129  conserved hypothetical protein  
   CPIJ014900  corkscrew phosphatase  
  SH3-domain CPIJ006389  abl interactor 2  
   CPIJ002311  conserved hypothetical protein  
   CPIJ002634  membrane traffic protein  
   CPIJ003002  nebl protein  
   CPIJ006223  Plenty of SH3s  
   CPIJ010657  conserved hypothetical protein  
   CPIJ016081  endophilin a  
   CPIJ017698  conserved hypothetical protein  
   CPIJ018548  abl interactor 2  
  TRAF domain-like CPIJ001208  autoimmune regulator  
   CPIJ001213  tripartite motif-containing protein 37  
   CPIJ009247  E3 ubiquitin-protein ligase sina  
234 
 
   CPIJ010192  conserved hypothetical protein  
  Transducin (alpha subunit), insertion domain CPIJ016397  guanine nucleotide-binding protein G 
  Transducin (heterotrimeric G protein), gamma chain CPIJ005863  guanine nucleotide-binding protein gamma-1 subunit  
  Ypt/Rab-GAP domain of gyp1p CPIJ016901  conserved hypothetical protein  
   CPIJ008317  TBC1 domain family member 22B  
   CPIJ010266  GTPase-activating protein gyp2  
   CPIJ011634  gh regulated tbc protein-1  
Other Unknown function alpha/beta knot CPIJ006883  conserved hypothetical protein  
   CPIJ010464  conserved hypothetical protein  
  Anti-sigma factor antagonist SpoIIaa CPIJ006006  sulfate transporter  
   CPIJ000611  sulfate transporter 1.2  
   CPIJ005331  sulfate transporter  
   CPIJ012147  sulfate transporter  
   CPIJ017095  sulfate transporter  
  beta-sandwich domain of Sec23/24 CPIJ008805  conserved hypothetical protein  
   CPIJ009281  Sec24B protein  
   CPIJ014598  conserved hypothetical protein  
   CPIJ017651  conserved hypothetical protein  
  BtrG-like CPIJ005346  conserved hypothetical protein  
   CPIJ008797  conserved hypothetical protein  
  Crustacean CHH/MIH/GIH neurohormone CPIJ003972  ion transport peptide  
  Cysteine alpha-hairpin motif CPIJ000336  conserved hypothetical protein  
   CPIJ014050  predicted protein  
   CPIJ019817  cytochrome c oxidase assembly protein COX19  
  Cysteine-rich domain CPIJ000792  myotonin-protein kinase  
   CPIJ006705  protein kinase C  
   CPIJ006920  conserved hypothetical protein  
  Delta-sleep-inducing peptide immunoreactive peptide CPIJ006273  conserved hypothetical protein  
  E set domains CPIJ002638  KDEL motif-containing protein 2  
   CPIJ002736  conserved hypothetical protein  
   CPIJ002737  MPA2 allergen  
   CPIJ004282  hexamerin 2 beta  
   CPIJ004652  conserved hypothetical protein  
   CPIJ005750  conserved hypothetical protein  
   CPIJ008373  conserved hypothetical protein  
   CPIJ016072  SEC63 protein  
   CPIJ016988  beta-arrestin 1  
  Frataxin/Nqo15-like CPIJ014024  frataxin, mitochondrial  
  GckA/TtuD-like CPIJ004803  glycerate kinase  
235 
 
  Hairpin loop containing domain-like CPIJ005068  conserved hypothetical protein  
   CPIJ005070  conserved hypothetical protein  
   CPIJ018970  conserved hypothetical protein  
  HCP-like CPIJ001345  conserved hypothetical protein  
  Hook domain CPIJ018678  hook protein  
  Ligand-binding domain in the NO signalling and Golgi transport CPIJ010765  conserved hypothetical protein  
   CPIJ019438  conserved hypothetical protein  
  MAL13P1.257-like CPIJ013731  conserved hypothetical protein  
  PIN domain-like CPIJ018772  conserved hypothetical protein  
  PTPA-like CPIJ017735  serine/threonine-protein phosphatase 2A regulatory subunitB'  
  Pym (Within the bgcn gene intron protein, WIBG), N-terminal domain CPIJ006916  conserved hypothetical protein  
  Roadblock/LC7 domain CPIJ002048  dynein light chain  
   CPIJ011264  mitogen-activated protein-binding protein-interacting protein  
   CPIJ014786  conserved hypothetical protein  
  Subunits of heterodimeric actin filament capping protein Capz CPIJ010373  F-actin capping protein subunit beta  
   CPIJ011271  f-actin capping protein alpha  
   CPIJ011272  conserved hypothetical protein  
   CPIJ019319  F-actin capping protein subunit beta  
  YggU-like CPIJ001196  conserved hypothetical protein  
  YjeF N-terminal domain-like CPIJ011786  conserved hypothetical protein  
  YjgF-like CPIJ008399  conserved hypothetical protein  
  Zinc beta-ribbon CPIJ001855  DNA-directed RNA polymerase II 15.1 kDa polypeptide  
 Viral proteins Arp2/3 complex 16 kDa subunit ARPC5 CPIJ012795  arp2/3 complex 16 kd subunit  
  Retrovirus zinc finger-like domains CPIJ001891  conserved hypothetical protein  
  Tetrapyrrole methylase CPIJ008675  diphthine synthase  
  Eferin C-derminal domain-like CPIJ003754  conserved hypothetical protein  
  ERH-like CPIJ013494  enhancer of rudimentary protein  
  Expressed protein At2g23090/F21P24.15 CPIJ002299  conserved hypothetical protein  
?Differentially expressed genes represent those genes that differed in their expression level (FPKM) in HAmCqG8 by more than two fold when compared to the 
parental strain HAmCqG0. 
*SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation information available at the Superfamily website (version 1.75)  
**Culex quinquefasciatus genome, Johannesburg strain CpipJ1.2, June 2008; http://cquinquefasciatus.vectorbase.org/ 
?Vectorbase annotation taken from CpipJ1.2, June 2008; http://cquinquefasciatus.vectorbase.org/ with the exception of cytochrome P450 genes whose 
annotations were taken from the most current P450 annotation based on: Nelson, DR (2009) The Cytochrome P450 Homepage. Human Genomics 4, 59-65: 
http://drnelson.uthsc.edu/CytochromeP450.html 
236 
 
?NONA: Not annotated
237 
 
Appendix 3.5. List of differentially upregulated genes in HAmCqG8 which contained functionally-enriched Gene Ontology terms. 
Gene? Annotation* GO TERMS** 
  ca
taly
tic 
activ
ity
 (GO:0
00
38
24
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
 
ox
ido
red
uctase 
activ
ity
 (GO:0
01
64
91
)   
    
    
    
    
    
    
    
    
    
    
    
    
  
hem
e b
ind
ing
 (GO:0
02
00
37
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
 
tetr
ap
yrr
ole 
bin
din
g (
GO:0
04
69
06
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
   
iro
n io
n b
ind
ing
 (GO: 
00
05
50
6) 
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
  
elec
tro
n ca
rrier
 ac
tiv
ity
 (GO:0
09
50
5) 
    
    
    
    
    
    
    
    
    
    
    
    
    
  
mo
no
ox
yg
en
ase 
activ
ity
 (GO:
00
44
97
)   
    
    
    
    
    
    
    
    
    
    
    
    
  
hy
dro
lase a
ctiv
ity
 (GO:0
01
67
87
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
    
  
pep
tid
ase 
activ
ity
 (GO:0
00
82
33
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
    
   
pep
tid
ase 
activ
ity
, ac
tin
g o
n L
-am
ino
 ac
id 
pep
tid
es (
GO:0
07
00
11
)   
    
  
en
do
pe
ptid
ase 
activ
ity
 (G)
:00
04
17
5) 
    
    
    
    
    
    
    
    
    
    
    
    
    
   
ser
ine
-ty
pe 
en
do
pe
ptid
ase 
activ
ity
 (GO:0
00
42
52
)   
    
    
    
    
    
    
    
    
ser
ine
-ty
pe 
pe
ptid
ase 
activ
ity
 (GO: 
00
08
23
6) 
    
    
    
    
    
    
    
    
    
    
 
ser
ine 
hy
dro
lase a
ctiv
ity
 (GO:0
01
71
71
)   
    
    
    
    
    
    
    
    
    
    
    
    
metallo
pep
tid
ase 
activ
ity
 (GO
:00
08
23
7) 
    
    
    
    
    
    
    
    
    
    
    
    
 
ex
op
ep
tid
ase 
activ
ity
 (GO:0
00
82
38
)   
    
    
    
    
    
    
    
    
    
    
    
    
    
 
hy
dro
lase a
ctiv
ity
, ac
tin
g o
n g
lyco
syl b
on
ds 
(GO:0
00
82
38
)   
    
    
    
    
 
hy
dro
lase a
ctiv
ity
, h
yd
roly
zin
g O
-gly
co
syl c
om
po
un
ds 
(GO
:00
04
55
3) 
 
ox
yg
en
 tran
spo
rter
 ac
tiv
ity
  (G
O:0
00
53
22
)   
    
    
    
    
    
    
    
    
    
    
    
CPIJ020229 CYP4D42v2 +? + + + + + + - - - - - - - - - - - - 
CPIJ017244 CYP304B5 + + + + + + + - - - - - - - - - - - - 
CPIJ017243 CYP304B4 + + + + + + + - - - - - - - - - - - - 
CPIJ015958 CYP325BC1 + + + + + + + - - - - - - - - - - - - 
CPIJ015681 CYP4H37v2 + + + + + + + - - - - - - - - - - - - 
CPIJ014218 CYP9M10 + + + + + + + - - - - - - - - - - - - 
CPIJ012470 CYP9AL1 + + + + + + + - - - - - - - - - - - - 
CPIJ011127 CYP4H34 + + + + + + + - - - - - - - - - - - - 
CPIJ010546 CYP9J34 + + + + + + + - - - - - - - - - - - - 
CPIJ010544 CYP9J33 + + + + + + + - - - - - - - - - - - - 
CPIJ010543 CYP9J40 + + + + + + + - - - - - - - - - - - - 
238 
 
CPIJ010542 CYP9J38 + + + + + + + - - - - - - - - - - - - 
CPIJ010538 CYP9J46 + + + + + + + - - - - - - - - - - - - 
CPIJ010537 CYP9J45 + + + + + + + - - - - - - - - - - - - 
CPIJ010227 CYP12F13 + + + + + + + - - - - - - - - - - - - 
CPIJ010225 CYP12F14 + + + + + + + - - - - - - - - - - - - 
CPIJ009478 CYP4D42v1 + + + + + + + - - - - - - - - - - - - 
CPIJ009085 CYP6AG13 + + + + + + + - - - - - - - - - - - - 
CPIJ008566 CYP6Z15 + + + + + + + - - - - - - - - - - - - 
CPIJ007188 CYP4H30 + + + + + + + - - - - - - - - - - - - 
CPIJ006721 CYP4H37v 1 + + + + + + + - - - - - - - - - - - - 
CPIJ005959 CYP6AA7 + + + + + + + - - - - - - - - - - - - 
CPIJ005957 CYP6AA9 + + + + + + + - - - - - - - - - - - - 
CPIJ005956 CYP6BZ2 + + + + + + + - - - - - - - - - - - - 
CPIJ005955 CYP6P14 + + + + + + + - - - - - - - - - - - - 
CPIJ005953 CYP6BB3 + + + + + + + - - - - - - - - - - - - 
CPIJ005952 CYP6BB4 + + + + + + + - - - - - - - - - - - - 
CPIJ002538 CYP6AG12 + + + + + + + - - - - - - - - - - - - 
CPIJ004088 guanylyl cyclase receptor + - + + + - - - - - - - - - - - - - - 
CPIJ019428 trypsin 2  + - - - - - - + + + + + + + - - - - - 
CPIJ019007 polyserase-2  + - - - - - - + + + + + + + - - - - - 
CPIJ018037 serine protease  + - - - - - - + + + + + + + - - - - - 
CPIJ016102 transmembrane protease  + - - - - - - + + + + + + + - - - - - 
CPIJ016012 tryptase-2  + - - - - - - + + + + + + + - - - - - 
CPIJ014523 elastase-3A  + - - - - - - + + + + + + + - - - - - 
CPIJ010641 prostasin  + - - - - - - + + + + + + + - - - - - 
CPIJ006543 urokinase-type plasminogen activator  + - - - - - - + + + + + + + - - - - - 
CPIJ006542 chymotrypsin-2  + - - - - - - + + + + + + + - - - - - 
CPIJ006076 hypodermin-B  + - - - - - - + + + + + + + - - - - - 
CPIJ005272 trypsin 3A1  + - - - - - - + + + + + + + - - - - - 
CPIJ004594 conserved hypothetical protein  + - - - - - - + + + + + + + - - - - - 
CPIJ003623 coagulation factor XII  + - - - - - - + + + + + + + - - - - - 
CPIJ002156 chymotrypsin BI  + - - - - - - + + + + + + + - - - - - 
CPIJ002142 chymotrypsin BI  + - - - - - - + + + + + + + - - - - - 
CPIJ002140 chymotrypsin BI  + - - - - - - + + + + + + + - - - - - 
CPIJ002139 HzC4 chymotrypsinogen  + - - - - - - + + + + + + + - - - - - 
CPIJ002138 chymotrypsinogen  + - - - - - - + + + + + + + - - - - - 
CPIJ002137 serine protease1/2  + - - - - - - + + + + + + + - - - - - 
CPIJ002135 trypsin alpha-4  + - - - - - - + + + + + + + - - - - - 
CPIJ002133 trypsin epsilon  + - - - - - - + + + + + + + - - - - - 
CPIJ002130 kallikrein-7  + - - - - - - + + + + + + + - - - - - 
239 
 
CPIJ002128 mast cell protease 2  + - - - - - - + + + + + + + - - - - - 
CPIJ001979 conserved hypothetical protein  + - - - - - - + + + + + + + - - - - - 
CPIJ001111 proacrosin  + - - - - - - + + + + + + + - - - - - 
CPIJ000617 clip-domain serine protease  + - - - - - - + + + + + + + - - - - - 
CPIJ000616 clip-domain serine protease  + - - - - - - + + + + + + + - - - - - 
CPIJ019029 metalloproteinase  + - - - - - - + + + + + - - + - - - - 
CPIJ013319 metalloproteinase  + - - - - - - + + + + + - - + - - - - 
CPIJ010224 metalloproteinase  + - - - - - - + + + + + - - + - - - - 
CPIJ009594 nephrosin  + - - - - - - + + + + + - - + - - - - 
CPIJ007383 endothelin-converting enzyme 1  + - - - - - - + + + + + - - + - - - - 
CPIJ002945 zinc metalloproteinase dpy-31  + - - - - - - + + + + + - - + - - - - 
CPIJ002943 conserved hypothetical protein  + - - - - - - + + + + + - - + - - - - 
CPIJ002942 zinc metalloproteinase nas-12  + - - - - - - + + + + + - - + - - - - 
CPIJ002941 high choriolytic enzyme 1  + - - - - - - + + + + + - - + - - - - 
CPIJ012036 aminopeptidase N  + - - - - - - + + + - - - - + + - - - 
CPIJ010805 carboxypeptidase A1  + - - - - - - + + + - - - - + + - - - 
CPIJ009106 angiotensin-converting enzyme  + - - - - - - + + + - - - - + + - - - 
CPIJ004086 angiotensin-converting enzyme  + - - - - - - + + + - - - - + + - - - 
CPIJ001745 zinc carboxypeptidase  + - - - - - - + + + - - - - + + - - - 
CPIJ001744 zinc carboxypeptidase  + - - - - - - + + + - - - - + + - - - 
CPIJ001743 carboxypeptidase A2  + - - - - - - + + + - - - - + + - - - 
CPIJ001742 zinc carboxypeptidase  + - - - - - - + + + - - - - + + - - - 
CPIJ008876 lysosomal pro-X carboxypeptidase  + - - - - - - + + + - - + + - + - - - 
CPIJ008873 prolylcarboxypeptidase  + - - - - - - + + + - - + + - + - - - 
CPIJ001240 cathepsin B-like thiol protease  + - - - - - - + + + + - - - - - - - - 
CPIJ001239 cathepsin B  + - - - - - - + + + + - - - - - - - - 
CPIJ001050 protease m1 zinc metalloprotease  + - - - - - - + + + - - - - + - - - - 
CPIJ014110 conserved hypothetical protein  + - - - - - - + + - - - - - - - - - - 
CPIJ009738 conserved hypothetical protein  + - - - - - - + + - - - - - - - - - - 
CPIJ010716 luciferin 4-monooxygenase  + + - - - - + - - - - - - - - - - - - 
CPIJ005187 phenoloxidase subunit 1  + + - - - + - - - - - - - - - - - - - 
CPIJ019598 basic endochitinase CHB4  + - - - - - - + - - - - - - - - + + - 
CPIJ018802 endochitinase A  + - - - - - - + - - - - - - - - + + - 
CPIJ009306 neutral alpha-glucosidase ab  + - - - - - - + - - - - - - - - + + - 
CPIJ008904 alpha-glucosidase  + - - - - - - + - - - - - - - - + + - 
CPIJ008528 glycoside  hydrolase  + - - - - - - + - - - - - - - - + + - 
CPIJ006585 glycoprotein  + - - - - - - + - - - - - - - - + + - 
CPIJ006166 deltamethrin resistance-associated NYD-GBE  + - - - - - - + - - - - - - - - + + - 
CPIJ005451 lysozyme  + - - - - - - + - - - - - - - - + + - 
CPIJ004323 gram-negative bacteria binding protein  + - - - - - - + - - - - - - - - + + - 
240 
 
CPIJ004320 gram-negative bacteria-binding protein 1  + - - - - - - + - - - - - - - - + + - 
CPIJ002104 plasma alpha-L-fucosidase  + - - - - - - + - - - - - - - - + + - 
CPIJ005725 alpha-amylase A  + - - - - - - + - - - - - - - - + - - 
CPIJ005060 alpha-amylase B  + - - - - - - + - - - - - - - - + - - 
CPIJ019948 myosin vii  + - - - - - - + - - - - - - - - - - - 
CPIJ019917 triacylglycerol lipase  + - - - - - - + - - - - - - - - - - - 
CPIJ018233 carboxylesterase  + - - - - - - + - - - - - - - - - - - 
CPIJ018231 carboxylesterase  + - - - - - - + - - - - - - - - - - - 
CPIJ017110 fumarylacetoacetate hydrolase  + - - - - - - + - - - - - - - - - - - 
CPIJ016336 esterase B1  + - - - - - - + - - - - - - - - - - - 
CPIJ015649 DNA-binding protein smubp-2  + - - - - - - + - - - - - - - - - - - 
CPIJ013085 sarcalumenin  + - - - - - - + - - - - - - - - - - - 
CPIJ007824 esterase B1  + - - - - - - + - - - - - - - - - - - 
CPIJ007461 epoxide hydrolase  + - - - - - - + - - - - - - - - - - - 
CPIJ007035 lipase  + - - - - - - + - - - - - - - - - - - 
CPIJ006560 peptidoglycan recognition protein-lc  + - - - - - - + - - - - - - - - - - - 
CPIJ004695 dynein-1-beta heavy chain  + - - - - - - + - - - - - - - - - - - 
CPIJ004222 pancreatic triacylglycerol lipase  + - - - - - - + - - - - - - - - - - - 
CPIJ002103 conserved hypothetical protein  + - - - - - - + - - - - - - - - - - - 
CPIJ002067 vacuolar ATP synthase subunit C  + - - - - - - + - - - - - - - - - - - 
CPIJ001520 multidrug resistance-associated protein 1  + - - - - - - + - - - - - - - - - - - 
CPIJ000853 myosin heavy chain  + - - - - - - + - - - - - - - - - - - 
CPIJ000852 myosin-Id  + - - - - - - + - - - - - - - - - - - 
CPIJ003495 fatty acid synthase S-acetyltransferase  + + - - - - - + - - - - - - - - - - - 
CPIJ014287 ferritin heavy chain  + + - - + - - - - - - - - - - - - - - 
CPIJ005308 conserved hypothetical protein  - - + + + - - - - - - - - - - - - - - 
CPIJ004595 cytochrome b5  - - + + + - - - - - - - - - - - - - - 
CPIJ004125 succinate dehydrogenase  - - + + + - - - - - - - - - - - - - - 
CPIJ018869 NADH dehydrogenase iron-sulfur protein 7, mitoch.  + + - - - - - - - - - - - - - - - - - 
CPIJ016440 dihydroceramide delta (4)-desaturase + + - - - - - - - - - - - - - - - - - 
CPIJ016322 alkyldihydroxyacetonephosphate synthase  + + - - - - - - - - - - - - - - - - - 
CPIJ016321 alkyldihydroxyacetonephosphate synthase  + + - - - - - - - - - - - - - - - - - 
CPIJ013647 alkyldihydroxyacetonephosphate synthase  + + - - - - - - - - - - - - - - - - - 
CPIJ009438 aldehyde dehydrogenase  + + - - - - - - - - - - - - - - - - - 
CPIJ007620 choline dehydrogenase  + + - - - - - - - - - - - - - - - - - 
CPIJ005656 oxidoreductase  + + - - - - - - - - - - - - - - - - - 
CPIJ004600 oxidoreductase  + + - - - - - - - - - - - - - - - - - 
CPIJ004379 steroid dehydrogenase  + + - - - - - - - - - - - - - - - - - 
CPIJ003802 NADP-dependent leukotriene B4 12-hydroxydehydrog.  + + - - - - - - - - - - - - - - - - - 
CPIJ003059 acyl-CoA oxidase  + + - - - - - - - - - - - - - - - - - 
241 
 
CPIJ001318 d-lactate dehydrognease 2  + + - - - - - - - - - - - - - - - - - 
CPIJ018631 glutathione-s-transferase theta, gst  + - - - - - - - - - - - - - - - - - - 
CPIJ015996 ecdysteroid UDP-glucosyltransferase  + - - - - - - - - - - - - - - - - - - 
CPIJ015088 4-coumarate-CoA ligase 1  + - - - - - - - - - - - - - - - - - - 
CPIJ014577 phosphoglycerate mutase 2  + - - - - - - - - - - - - - - - - - - 
CPIJ012763 3-phosphoinositide-dependent protein kinase 1  + - - - - - - - - - - - - - - - - - - 
CPIJ011827 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ009929 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ009094 ornithine decarboxylase 1  + - - - - - - - - - - - - - - - - - - 
CPIJ008853 maltose phosphorylase  + - - - - - - - - - - - - - - - - - - 
CPIJ008110 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ007538 arginine kinase  + - - - - - - - - - - - - - - - - - - 
CPIJ006619 cystathionine gamma-lyase  + - - - - - - - - - - - - - - - - - - 
CPIJ006508 UDP-glucuronosyltransferase 2B4  + - - - - - - - - - - - - - - - - - - 
CPIJ006459 long-chain-fatty-acid-CoA ligase  + - - - - - - - - - - - - - - - - - - 
CPIJ006339 receptor of activated protein kinase C 1  + - - - - - - - - - - - - - - - - - - 
CPIJ006160 glutathione s-transferase  + - - - - - - - - - - - - - - - - - - 
CPIJ004867 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ003692 glucosyl/glucuronosyl transferase  + - - - - - - - - - - - - - - - - - - 
CPIJ002663 glutathione S-transferase 1-1  + - - - - - - - - - - - - - - - - -  
CPIJ001427 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ001091 lactosylceramide 4-alpha-galactosyltransferase  + - - - - - - - - - - - - - - - - - - 
CPIJ000791 conserved hypothetical protein  + - - - - - - - - - - - - - - - - - - 
CPIJ018825 larval serum protein 1 beta chain  - - - - - - - - - - - - - - - - - - + 
CPIJ018824 larval serum protein 1 beta chain  - - - - - - - - - - - - - - - - - - + 
CPIJ009032 larval serum protein 2  - - - - - - - - - - - - - - - - - - + 
CPIJ007783 arylphorin subunit alpha  - - - - - - - - - - - - - - - - - - + 
CPIJ006538 larval serum protein 1 beta chain  - - - - - - - - - - - - - - - - - - + 
CPIJ006537 larval serum protein 1 beta chain  - - - - - - - - - - - - - - - - - - + 
CPIJ001820 larval serum protein 2  - - - - - - - - - - - - - - - - - - + 
CPIJ000056 larval serum protein 1 beta chain  - - - - - - - - - - - - - - - - - - + 
?Genes within the functionally enriched GO terms for the differentially upregulated gene set in HAmCqG8 when tested by gProfiler  
*Culex quinquefasciatus genome, Johannesburg strain CpipJ1.2, June 2008; http://cquinquefasciatus.vectorbase.org/ Annotations for cytochrome P450 genes 
were taken from the most current annotation based on: Nelson, DR (2009) The Cytochrome P450 Homepage. Human Genomics 4, 59-65: 
http://drnelson.uthsc.edu/CytochromeP450.html 
**Gene Ontology consortium (version 1.2084; release date: 12:07:2011) 
? A ?+? sign indicates GO terms within column that are assigned to the gene in the list, while a ?-? sign indicates that GO terms within the column are not. 
242 
 
Appendix 4.1. List and sequences of the qRT-PCR primers used. 
Gene* Sense primer (5' to 3') Antisense primer (5' to 3') 
18S rRNA CGCGGTAATTCCAGCTCCACTA GCATCAAGCGCCACCATATAGG 
CPIJ002139 TAATCTGTCGTGTCAATTGTCGTA GGAAGCTATGTATTCCGATGAGAT 
CPIJ001240 AGGACGTGAATATCGTTCTGAAAT GTTCTGATAGATCTCGGCTTTCAT 
CPIJ002156 CACTGCGTCGTTGATGCTAC CCACATCATTTCGCACAATC 
CPIJ016012 GGGAGTTATGTTGAGGACTTGAAA GAAGGGTGGCACAGTTATTTATTC 
CPIJ002142 TGAAATCCTTAGTAGTGCTTGCAG TGACCAGAGAGAAGGATGTTGATA 
CPIJ009594 GAAGTATCAGACAACCGCATTCTA TTTCAAGTTGTTCATCACTGGTCT 
CPIJ018233 GTCTGCTTGGGTTCTTCAGC CGTCACATTGTTCGGATCAC 
CPIJ001820 GTTGAATTCTACAAGCACGGTATG CGTAGTAGAAAACGTGGAACAGAG 
CPIJ000056 GAGCTACCTGCCATACTACACCTT GAAGAAGTCAAAGTACGTGAGCAG 
CPIJ009033 ATCGACTTCAGCTATTTCTTCACC GTCGGTAGTGTTTAGTACGACGTG 
CPIJ009032 AGTTGAGATCAAGGAGTTTTCCAG GGGAGTTCTTGTAGTTGAAGGGTA 
CPIJ007783 ACTACCAATTCAAGGATCACCTTC AGTATGTGACCAACTTGTCAATGG 
*Culex quinquefasciatus genome, Johannesburg strain CpipJ1.3 
http://cquinquefasciatus.vectorbase.org/ 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
243 
 
  
244 
 
Appendix 4.2: Genes up-regulated in the pyrethroid-resistant HAmCqG8 strain of Culex 
quinquefasciatus following permethrin challenge. 
SCOP functional annotation? Vectorbase annotation? FPKM? Fold change (24h) 
 
General 
 
Detailed 
 
Superfamily 
 
Accession 
 
Gene 
  
Untreated 
 
Acetone 
Permethrin  
LC50 LC70 
Extra-
cellular 
processes 
Cell 
adhesion 
C-type lectin-
like 
CPIJ019507 salivary C-type lectin  52.8 1.7 3.9 4.2* 
   CPIJ016716 conserved hypothetical protein 23.8 3.4* 2.7 8.2* 
  Immunoglobulin CPIJ015022 stretchin-mlck  0.5 2.5 3.7 6.5* 
  RNI-like CPIJ001238 conserved hypothetical protein 1.9 3.7* 4.1* 4.0* 
   CPIJ018057 conserved hypothetical protein 0.6 3.5 4.1* 4.2 
 Toxins/defe
nse 
Superantigen 
toxins 
CPIJ003460 M12 mutant protein precursor, 
putative  
0.3 4.2 4.2 6.4* 
General General ARM repeat CPIJ005388 conserved hypothetical protein 1 4.2* 3.5 4.4* 
   CPIJ801656 armadillo repeat-containing 
protein 4 
1 3.7* 3.9* 3.6 
  EF-hand CPIJ002594 NADPH oxidase  1.4 2 4.4* 3 
   CPIJ008636 conserved hypothetical protein 1.2 3.3* 3.3 3.1 
   CPIJ001307 predicted protein 0.9 4.9 9.5* 5.4 
  GLA-domain CPIJ802301 conserved hypothetical protein 29.6 5.8* 3.7 14.3* 
  Kelch motif CPIJ011586 actin binding protein, putative  5 1.6 1.8 3.8* 
   CPIJ003681 ring canal kelch protein 0.7 3.6* 4.3* 3.2 
  L domain-like CPIJ802473 conserved hypothetical protein 3.4 2.1 7.1* 7.3* 
   CPIJ002160 conserved hypothetical protein 1.6 1.9 4.6* 4.5* 
   CPIJ802491 conserved hypothetical protein 1.3 1.8 7.0* 7.4* 
   CPIJ802477 leucine rich protein 1.3 1.3 4.4* 4.1* 
  Spermadhesin, 
CUB domain 
CPIJ015617 conserved hypothetical protein 1.1 1.8 4.4* 2.5 
  WD40 repeat-
like 
CPIJ000996 axonemal dynein intermediate 
chain polypeptide  
0.7 3.1 4.2* 3.2 
 Protein 
interaction 
Ankyrin repeat CPIJ801726 conserved hypothetical protein 18.9 3.2* 4.1 3.4 
  POZ domain CPIJ008757 conserved hypothetical protein 0.2 10.0* 6.1* 23.0* 
 Small 
molecule 
binding 
FAD/NAD(P)-
binding domain 
CPIJ001367 glucose dehydrogenase  3.7 1.9 4.9* 3.6 
   CPIJ017482 choline dehydrogenase 2.7 1.8 3.9* 3.2* 
   CPIJ017491 glucose dehydrogenase  2 1.5 5.1* 3.2 
   CPIJ013724 dimethylaniline monooxygenase  1.7 1.3 2.4 4.3* 
   CPIJ007619 glucose dehydrogenase  1.4 2.3 4.9* 3.2 
   CPIJ017490 glucose dehydrogenase  0 1.3*? 1.7*? 2.3*? 
  GST C-terminal 
domain-like 
CPIJ002679 glutathione S-transferase theta-2 8.7 1.9 15.6 15.0* 
  NAD(P)-
binding 
Rossmann-fold 
domains 
CPIJ017620 hypothetical protein 97.2 3.5* 5.5 8.2* 
   CPIJ009105 hypothetical protein 27 2.5 7.6* 5.1* 
   CPIJ007450 conserved hypothetical protein 2.2 2.8* 2.7* 5.7* 
   CPIJ004391 fatty acyl-CoA reductase 1 25.6 4.4* 6 10.3* 
   CPIJ011767 short-chain dehydrogenase  22.5 4.2 3.5 11.8* 
   CPIJ003056 hydroxysteroid dehydrogenase  10.6 2.0* 1.6* 4.5* 
   CPIJ019942 conserved hypothetical protein 9.1 4.1 5.0* 10.5* 
   CPIJ019941 conserved hypothetical protein 7.1 2.2 3.2* 6.9 
   CPIJ014121 short-chain dehydrogenase  3.5 1.4 4.0* 2.5 
   CPIJ007244 fatty acyl-CoA reductase 1 2.4 2.3 4.8 5.1* 
   CPIJ007245 fatty acyl-CoA reductase 1 1.3 3.2 7.2* 7.2* 
   CPIJ004392 fatty acyl-CoA reductase 2 1.1 4.0* 7.4* 8.0* 
245 
 
  P-loop 
containing 
nucleoside 
triphosphate 
hydrolases 
CPIJ009593 conserved hypothetical protein 1.3 4.1* 4.1* 4.6* 
   CPIJ000848 myosin-2 heavy chain 0.9 2.5 3.8* 4.6* 
   CPIJ012205 dynein-1-beta heavy chain 0.4 2.6 3.6* 3 
   CPIJ007215 ciliary dynein heavy chain 5 0.3 2.8 4.1* 3.1 
   CPIJ012527 ciliary dynein heavy chain 5 0.3 3.2* 3.9* 3.9* 
   CPIJ002912 ciliary dynein heavy chain 11 0.3 3.1* 3.5 3.1 
   CPIJ001823 conserved hypothetical protein 0.3 3.2* 3.2 3.3 
   CPIJ013371 conserved hypothetical protein 0.2 3.7* 4.6* 3.9 
   CPIJ004695 dynein-1-beta heavy chain 0.2 3.2* 4.3* 4.7* 
   CPIJ017862 sulfotransferase 0.1 4.3 1.3 11.9* 
   CPIJ005250 conserved hypothetical protein 0.1 6.6* 8.7* 5.8 
   CPIJ011001 sulfotransferase 0.1 22.7 4.8 43.1* 
   CPIJ009296 conserved hypothetical protein 0.5 4 5.5* 6.5* 
  Thiamin 
diphosphate-
binding fold 
(THDP-binding) 
CPIJ011488 conserved hypothetical protein 0.1 11.8 41.0* 40.2* 
Informatio
n 
Chromatin 
structure 
Histone H3 K4-
specific 
methyltransferas
e SET7/9 N-
terminal domain 
CPIJ009321 conserved hypothetical protein 1.6 1.9 5.1* 4.5* 
   CPIJ801398 conserved hypothetical protein 1 4.4* 3.9 4.3 
 DNA 
replication/
repair 
FYVE/PHD 
zinc finger 
CPIJ011620 conserved hypothetical protein 1.7 4.0* 4.0* 4.0* 
  Nucleic acid-
binding proteins 
CPIJ000529 conserved hypothetical protein 0.1 3 1.9 10.9* 
  RING/U-box CPIJ007874 predicted protein 0 0.6? 0.6? 1.2*? 
   CPIJ015248 conserved hypothetical protein 0.2 7.6 9.2* 6.6 
 Translation Ribosome 
inactivating 
proteins (RIP) 
CPIJ009211 conserved hypothetical protein 0.3 7.1* 7.2* 15.4* 
Intra-
cellular 
processes 
Cell cycle, 
Apoptosis 
Inhibitor of 
apoptosis (IAP) 
repeat 
CPIJ006918 conserved hypothetical protein 38.8 2.1 5.5* 5.9* 
 Cell 
motility 
Outer arm 
dynein light 
chain 1 
CPIJ802497 conserved hypothetical protein 0.1 7.9 18.6* 21.0* 
  Phase 1 flagellin CPIJ009539 hypothetical protein 22.5 2.2 4.8* 4.0* 
  Tropomyosin CPIJ001907 conserved hypothetical protein 2.4 1.9 3.5 3.8* 
   CPIJ802332 conserved hypothetical protein 0.6 3.8 3.6 4.7* 
  Tubulin C-
terminal 
domain-like 
CPIJ001353 tubulin alpha chain 4.5 5.4* 5.6* 5.3* 
  Tubulin 
nucleotide-
binding domain-
like 
CPIJ018045 tubulin alpha-1 chain 1.2 5.3* 5.4* 4.8* 
   CPIJ012634 tubulin beta-3 chain 0.3 5.7* 6.7* 5.4* 
 Ion m/tr Cupredoxins CPIJ010466 laccase-like multicopper oxidase 
1  
2.4 1.8 3.6* 3.2 
  Ferritin-like CPIJ000900 conserved hypothetical protein 16.1 2.6 5.7* 3.8 
  MFS general 
substrate 
transporter 
CPIJ002794 hypothetical protein 4.8 3.3 7.1* 6.4* 
   CPIJ015621 cis,cis-muconate transport 
protein MucK, putative  
3.3 2.2 1.3 5.4* 
246 
 
   CPIJ002172 oligopeptide transporter 2.5 2.1 4.7* 4.2* 
   CPIJ008813 sodium-dependent phosphate 
transporter  
1.1 3.5* 2.9 3.4 
   CPIJ018461 mfs transporter 0.6 4.3 2.9 11.0* 
   CPIJ002957 sugar transporter  0.4 3.2 1.7 7.5* 
   CPIJ019487 organic cation transporter, 
putative 
0.3 3.4 2.6 10.3* 
   CPIJ002956 sugar transporter  0.3 3.4 3.8 6.7* 
  Periplasmic 
binding protein-
like II 
CPIJ008094 conserved hypothetical protein 3.9 1.6 4.1* 3.3 
  SET domain CPIJ019392 conserved hypothetical protein 0.1 11.0* 5 40.9* 
 Phospholipi
d m/tr 
CRAL/TRIO 
domain 
CPIJ801421 CRAL/TRIO domain-containing 
protein 
7.6 1.8 3.9* 5.9* 
   CPIJ014225 CRAL/TRIO domain-containing 
protein  
8.3 3.4* 3.3 8.3* 
   CPIJ013676 cellular retinaldehyde binding 
protein, putative 
4.1 1.5 4.0* 4.2* 
   CPIJ013463 conserved hypothetical protein 1.8 1.6 4.1* 2.7 
 Proteases Cysteine 
proteinases 
CPIJ001240 cathepsin B precursor 28.2 -1.6 2.5* 2.2* 
  LuxS/MPP-like 
metallohydrolas
e 
CPIJ013977 conserved hypothetical protein 3 2.0* 3.8 2.7 
  Metalloprotease
s ("zincins"), 
catalytic domain 
CPIJ009594 nephrosin 14.1 -1.1 22.2* 15.6* 
   CPIJ001808 conserved hypothetical protein 2.3 1.5 3.7* 3.2 
   CPIJ012680 ADAM 12 precursor 0.5 2.5 3.2 5.1* 
   CPIJ009594 Astacin precursor 14.1 -1.1 22.2* 15.6* 
  Pyrrolidone 
carboxyl 
peptidase 
(pyroglutamate 
aminopeptidase) 
CPIJ009328 conserved hypothetical protein 1.9 3.7 7.5* 8.4 
  Serine protease 
inhibitors 
CPIJ012287 hypothetical protein 52.1 -5.9 3.8* 2.1 
  Serpins CPIJ010576 endopin-1 precursor 2.9 1.2 2.5 4.1* 
  Subtilisin-like CPIJ014726 conserved hypothetical protein 0.5 2.4 5.6* 3.2 
  Trypsin-like 
serine proteases 
CPIJ010091 hypothetical protein 43.5 3.3* 3.2* 3.5* 
   CPIJ801497 serine protease 1.5 2.1 2.8 4.6* 
   CPIJ006544 chymotrypsinogen 2 precursor 43.6 2.5 7.4* 6.0* 
   CPIJ011901 polyserase-2 precursor 13.3 1.5 3 4.0* 
   CPIJ018800 ovochymase-2 precursor 8.3 1.4 3.7 4.0* 
   CPIJ003994 serine collagenase 1 precursor, 
putative  
8.2 2.3 3.4 5.3* 
   CPIJ010615 proclotting enzyme precursor 2.9 1.8 4.8* 3.9* 
   CPIJ009891 serine protease  1.8 1.4 3.9* 2.7 
   CPIJ017797 neurohypophysial hormones 0.7 2 5.2* 4.5* 
   CPIJ004092 oviductin  0.6 5.6* 8.1* 14.5* 
   CPIJ015103 trypsin-5 precursor 0.6 2.3 3.2 5.9* 
   CPIJ019781 trypsin 1 precursor 0.1 90.2* 25.3* 222.0* 
   CPIJ003325 anionic trypsin-2 precursor 0 1.6*? 0.0? 3.2*? 
   CPIJ006869 mast cell protease 3 precursor 0 0.1? 0.3? 1.0*? 
   CPIJ004984 serine proteases 1/2 precursor 0 1.6*? 0.0? 5.5*? 
   CPIJ018529 trypsin 1 precursor 0 0.7? 0.4? 1.3*? 
   CPIJ002140 collagenase precursor 124 1 2.6* 3.2* 
   CPIJ016012 collagenase precursor 85.6 1.3 1.5* 1.1 
  Zn-dependent 
exopeptidases 
CPIJ000990 cytosol aminopeptidase 12.7 3.9* 4.5* 4.4* 
   CPIJ003539 cytosol aminopeptidase 12.1 3.6* 3.4 4 
247 
 
   CPIJ009640 cytosol aminopeptidase 3.4 3.2* 3.5 3.4 
   CPIJ011999 zinc carboxypeptidase A 1 
precursor 
0.1 6.2 2.5 13.7* 
 Protein 
modificatio
n 
HSP20-like 
chaperones 
CPIJ005642 heat shock protein 27 1.9 1.3 -2.1 6.3* 
   CPIJ005646 alphaA-crystallin, putative  1.1 3.4 -4.7 11.4* 
 Transport Integral outer 
membrane 
protein TolC, 
efflux pump 
component 
CPIJ013907 conserved hypothetical protein 1.2 2.4 4.6* 3.6 
   CPIJ018992 conserved hypothetical protein 0.8 2.7 5.4* 3.6 
  Lipocalins CPIJ015730 apolipoprotein D, putative  13.5 -1.1 5.8* 5.4* 
   CPIJ015727 apolipoprotein D, putative  0.9 -1.3 2.9 5.4* 
  Mitochondrial 
carrier 
CPIJ005941 ADP,ATP carrier protein 2 1.4 2.3 1.8 4.4* 
  SNARE fusion 
complex 
CPIJ009052 myosin motor, putative  1.8 3.1* 3.4 3.6 
  t-snare proteins CPIJ014869 conserved hypothetical protein 1.8 3.6* 3.9 3.7 
Metabolis
m 
Amino 
acids m/tr 
Glutamine 
synthetase/guani
do kinase 
CPIJ002029 arginine kinase 5.4 3.9* 4.3* 3.9* 
 Carbohydra
te m/tr 
(Trans)glycosida
ses 
CPIJ013084 brain chitinase and chia  3.4 1.8 1.9 3.8* 
   CPIJ008532 glycoside  hydrolases  1.1 3.5* 1.6 12.4* 
   CPIJ019693 alpha-glucosidase precursor 0.5 -1.3 2.3 5.1* 
  Invertebrate 
chitin-binding 
proteins 
CPIJ000248 conserved hypothetical protein 16.4 1.8 4.3* 2.3 
   CPIJ006133 conserved hypothetical protein 16.2 2.1 2.7 4.2* 
   CPIJ003962 conserved hypothetical protein 6.7 1.6 4.3* 3.4 
   CPIJ009451 conserved hypothetical protein 6.3 6.5* 10.5* 13.3* 
  Xylose 
isomerase-like 
CPIJ005176 protein G12 precursor 0 1.3? 0.0? 2.1*? 
 Coenzyme 
m/tr 
Acyl-CoA 
dehydrogenase 
NM domain-like 
CPIJ016452 acyl-coa dehydrogenase 3.7 4.2* 1.8 2.4 
   CPIJ016453 acyl-coa dehydrogenase 0.3 20.0* 7.7* 13.5* 
  Cell wall 
binding repeat 
CPIJ006797 conserved hypothetical protein 7.4 1.7 3.9* 2.8 
  Glutathione 
synthetase ATP-
binding domain-
like 
CPIJ006090 conserved hypothetical protein 0.7 3.9* 4.2* 3.8 
  Precorrin-8X 
methylmutase 
CbiC/CobH 
CPIJ019685 conserved hypothetical protein 0 0.5*? 0.5*? 1.0*? 
 E- transfer Cytochrome c CPIJ010388 cytochrome c-2 7.5 3.6* 3.7 4.1* 
   CPIJ000571 conserved hypothetical protein 3.4 4.7 4.3* 4.2* 
 Energy Mitochondrial 
cytochrome c 
oxidase subunit 
VIIa 
CPIJ014384 conserved hypothetical protein 4.4 2.5* 4.4* 4.4* 
  Mitochondrial 
cytochrome c 
oxidase subunit 
VIIIb (aka IX) 
CPIJ008751 conserved hypothetical protein 0.2 18.2* 9.7* 55.9* 
 Lipid m/tr Apolipoprotein 
A-I 
CPIJ802074 conserved hypothetical protein 35 1.4 6.7* 6.5* 
   CPIJ801556 conserved hypothetical protein 0.1 37.0* -2.1 81.5* 
 Nucleotide Nucleoside CPIJ012972 conserved hypothetical protein 11 1.7 5.2* 3.2 
248 
 
m/tr hydrolase 
 Other 
enzymes 
Acetyl-CoA 
synthetase-like 
CPIJ015716 4-coumarate-CoA ligase 1 0.1 20.0* 8.6 51.4* 
   CPIJ003423 AMP dependent ligase  4.1 4.1* 4.8* 10.8* 
  Actin-like 
ATPase domain 
CPIJ014564 heat shock protein 70 B2 1.3 4.0* 4.6* 3.9* 
  alpha/beta-
Hydrolases 
CPIJ019227 pancreatic triacylglycerol lipase 
precursor 
4.7 1.1 3.2 4.5* 
   CPIJ005348 lipase 3 precursor 11.7 1.1 4.0* 5.5* 
   CPIJ002073 juvenile hormone esterase  9 1.3 4.1* 3.8 
   CPIJ013679 alpha-esterase, putative 1.8 2.3 3.8* 2.5 
   CPIJ016686 esterase FE4 precursor 1.5 -1.6 7.4* 5.0* 
   CPIJ006547 hepatic triacylglycerol lipase 
precursor 
0.4 1.1 8.5* 5.8* 
   CPIJ002720 lysosomal acid lipase, putative  0.2 5.4 8.6* 11.5* 
  Galactose 
mutarotase-like 
CPIJ802328 conserved hypothetical protein 0.7 4.5* 4.4* 3.2 
  Glycoside 
hydrolase/deacet
ylase 
CPIJ018088 conserved hypothetical protein 4.1 2.4 4.2* 4.4* 
  Lysozyme-like CPIJ009668 conserved hypothetical protein 0.7 9.4* 1.4 3.3 
   CPIJ014435 hypothetical protein 20.5 3.7* 6.2* 7.1* 
  SGNH 
hydrolase 
CPIJ012577 phospholipase b, plb1  1.2 2.4 4.8* 4.1 
   CPIJ012575 phospholipase b, putative 0.4 2.3 5.9* 5.6* 
  N-terminal 
nucleophile 
aminohydrolase
s (Ntn 
hydrolases) 
CPIJ019795 conserved hypothetical protein 0.1 5.9* 7.4* 6.2* 
 Polysaccha
ride m/tr 
UDP-
Glycosyltransfer
ase/glycogen 
phosphorylase 
CPIJ000038 UDP-glucuronosyltransferase 1-3 
precursor 
0.9 -1.3 5.0* 4.9 
   CPIJ000040 UDP-glucuronosyltransferase 
2B1 
0.1 2 13.3* 11.7* 
   CPIJ009316 hypothetical protein 37.2 3.1* 6.3 7.5* 
   CPIJ802191 glucosyl transferase 6.5 -1.5 3.7* 3.4 
 Redox Aminoacid 
dehydrogenase-
like, N-terminal 
domain 
CPIJ011318 conserved hypothetical protein 0.3 2.0* 7.0* 7.6* 
  Aromatic 
aminoacid 
monoxygenases, 
catalytic and 
oligomerization 
domains 
CPIJ014156 conserved hypothetical protein 33.9 2.8 3.7 6.3* 
  Cytochrome 
P450 
CPIJ017198 CYP325BF1-de1b? 0.8 2.7 8.1* 4.2* 
   CPIJ015953 CYP325BF1v2? 0.5 2.3 5.0* 3.6 
   CPIJ019704 CYP6N11? 2.1 -1.0* 6.8* 10.0* 
   CPIJ800210 CYP6BY2? 8.4 -1.3 13.9* 14.7* 
   CPIJ800176 CYP6M14? 8.1 -1.2 4.0* 3.4 
   CPIJ800256 CYP4H34? 6.9 1 4.8* 4.4 
   CPIJ800180 CYP6N19? 3.3 -1.1 10.9* 12.4* 
   CPIJ800178 CYP6M16? 2.6 -1.8 3.7* 4.2* 
   CPIJ800175 CYP6M13? 1 -2.5 6.2* 5.6* 
   CPIJ800177 CYP6M15? 0.3 0 8.9 10.2* 
  Formate/glycera
te 
dehydrogenase 
CPIJ002343 conserved hypothetical protein 0.8 1.8 4.2* 3.2* 
249 
 
catalytic 
domain-like 
  LDH C-terminal 
domain-like 
CPIJ004727 conserved hypothetical protein 0.5 4 4.2* 4.5 
  NAD(P)-linked 
oxidoreductase 
CPIJ000901 conserved hypothetical protein 7.6 2.1 5.0* 3.5* 
   CPIJ009681 translocator protein 1.8 4.5 4.1* 4.7* 
  Thioredoxin-
like 
CPIJ010478 conserved hypothetical protein 1.1 3.4 3.8* 4.2 
 Secondary 
metabolism 
Concanavalin A-
like 
lectins/glucanas
es 
CPIJ001299 keratinocyte lectin, putative  1.4 1.4 5.1* 4 
   CPIJ016495 thrombospondin-4, putative 0.2 1.4 4.2 5.7* 
  Dimeric 
alpha+beta 
barrel 
CPIJ002813 conserved hypothetical protein 3.4 1.5 5.4* 2.7 
  PR-1-like CPIJ000211 cysteine-rich secretory protein-2, 
putative  
1.7 2.2 6.8* 9.5* 
 Transferase
s 
PLP-dependent 
transferases 
CPIJ010034 glutamate decarboxylase  1.7 6.0* 3.2 17.7* 
No 
annotation 
No 
annotation 
No annotation CPIJ007504 bumetanide-sensitive sodium-
(potassium)-chloride 
cotransporter 
2.9 2.1 5.4* 4.0* 
   CPIJ004245 cationic amino acid transporter 1.8 2.2 6.7* 4.5* 
   CPIJ010699 cecropin 25 1.5 1.7 4.6* 
   CPIJ005108 cecropin 12.5 2.5 7.7* 8.0* 
   CPIJ004293 cuticle protein, putative 10 1.9 5.1* 4.7* 
   CPIJ003491 cuticle protein, putative  11 5.1* -1.5 10.9* 
   CPIJ017925 cuticle protein, putative  7.7 1.8 1.8 4.0* 
   CPIJ001839 cuticle protein, putative  6.5 2.6 7.3* 4.4* 
   CPIJ000106 elongase, puatative 4.3 1.4 3.8* 2.4 
   CPIJ013663 elongase, putative  9.3 2.2 2.1 3.7* 
   CPIJ003687 elongation of very long chain 
fatty acids protein 4 
0.3 2.5 8.9* 7.9* 
   CPIJ006964 high affinity nuclear juvenile 
hormone binding protein, 
putative  
3.2 2.3 5.0* 4.0* 
   CPIJ016318 larval cuticle protein 8.7 2.5 1.8 4.4 5.0* 
   CPIJ004289 larval cuticle protein A3A 9.5 1.8 6.6* 6.5* 
   CPIJ002801 larval/pupal cuticle protein H1C 
precursor 
36.7 1.9 5.8* 4 
   CPIJ005349 lysosomal acid lipase, putative  5 1.2 4.0* 6.3* 
   CPIJ004704 myosin motor, putative  0.3 4.5* 3.4 3.4 
   CPIJ007819 NADH:ubiquinone 
dehydrogenase, putative  
4.7 3.9 4.8* 6.4* 
   CPIJ008136 osiris 11 3.7 3.3* 5.0* 7.3* 
   CPIJ009829 osiris 18 15.5 1.4 4.1* 2.4 
   CPIJ004911 osiris 21, putative 0.5 3 2 6.4* 
   CPIJ008140 Osiris, putative  7.3 1.9 2.6 4.9* 
   CPIJ011100 Osiris, putative  1.5 1.9 4.8* 3.6 
   CPIJ001618 protofilament ribbon protein 2.5 3.1* 3.3 3.6 
   CPIJ006318 proton-coupled amino acid 
transporter 1 
2.8 3.0* 2.9 6.0* 
   CPIJ009324 pupal cuticle protein 78E, 
putative  
7.2 2.3 5.7* 5.7* 
   CPIJ018582 pupal cuticle protein, putative  11.9 1.7 4.4* 3.5 
   CPIJ008231 pupal cuticle protein, putative  10.8 1.7 4.6* 3.2 
   CPIJ010700 putative 4.2 kda basic salivary 
peptide 
2.5 2.3 2.4 10.3* 
   CPIJ008286 serine protease, putative  6 1.6 4.3* 2.8 
   CPIJ012056 sodium-dependent serotonin 2.9 2 4.1* 3 
250 
 
transporter 
   CPIJ801536 sodium/potassium-dependent 
ATPase beta-2 subunit 
0.8 14.2* 32.5* 24.9* 
   CPIJ012066 sodium/shloride dependent amino 
acid transporter, putative 
1.9 2.4 44.6* 42.7* 
   CPIJ801722 sodium/solute symporter 2 -1.1 6.0* 5.1* 
   CPIJ801721 sodium/solute symporter 0.5 2.4 7.5* 3.7 
   CPIJ015023 stretchin-mlck 0.2 2.5 5 12.2* 
   CPIJ013788 structural contituent of cuticle, 
putative 
90.5 2 5.1* 4.2 
   CPIJ012065 tryptophan transporter  0.8 2.9 17.5* 21.2* 
   CPIJ802272 conserved hypothetical protein 46.8 3.5* 4.1* 3.8 
   CPIJ018910 conserved hypothetical protein 36.2 3.5* 3 9.3* 
   CPIJ007289 conserved hypothetical protein 22.1 1.8 5.1* 3.4 
   CPIJ014232 conserved hypothetical protein 19.8 4.4* 2.2 11.2* 
   CPIJ017629 conserved hypothetical protein 19.5 3.0* 3.5 3.3 
   CPIJ004475 conserved hypothetical protein 19.1 1.9 4.1* 3.7* 
   CPIJ012507 conserved hypothetical protein 16.1 2.9* 4.0* 5.4* 
   CPIJ008525 conserved hypothetical protein 14.2 4.3* 4.9* 5.1* 
   CPIJ017913 conserved hypothetical protein 13.4 3.0* 3.6 3.4 
   CPIJ802297 conserved hypothetical protein 12.5 2.1 2.2 5.1* 
   CPIJ009334 conserved hypothetical protein 12.3 1.2 4.0* 2.5 
   CPIJ006965 conserved hypothetical protein 10.1 2 3.8* 5.5* 
   CPIJ002836 conserved hypothetical protein 8.8 1.1 3.5 4.3* 
   CPIJ010705 conserved hypothetical protein 6.6 1.4 3.8* 3.2 
   CPIJ010748 conserved hypothetical protein 6 1.7 4.1* 3.5 
   CPIJ801448 conserved hypothetical protein 5.7 1.5 3.8* 2.6 
   CPIJ006959 conserved hypothetical protein 5.5 2.4 5.4* 4.0* 
   CPIJ009100 conserved hypothetical protein 5.3 2.3 4.9* 4.3* 
   CPIJ004790 conserved hypothetical protein 5 2.1 4.3* 3.6 
   CPIJ008211 conserved hypothetical protein 4.6 2.9 -2.8 5.5* 
   CPIJ007448 conserved hypothetical protein 4.1 8.2* 5.9* 19.5* 
   CPIJ000450 conserved hypothetical protein 4 1.8 3.8* 3.3 
   CPIJ016842 conserved hypothetical protein 3.7 1.6 4.1* 3.2 
   CPIJ011498 conserved hypothetical protein 3.7 1.4 4.0* 3.8* 
   CPIJ010184 conserved hypothetical protein 3.3 3.4* 4.7* 4 
   CPIJ007813 conserved hypothetical protein 3 3.2* 4.8* 3.4 
   CPIJ020250 conserved hypothetical protein 2.7 4.9* 4.2* 5.8* 
   CPIJ006892 conserved hypothetical protein 2.3 3.1 8.0* 4.9* 
   CPIJ002597 conserved hypothetical protein 2.1 2 3.9* 3.1 
   CPIJ013908 conserved hypothetical protein 1.9 2.5 4.2* 3.7 
   CPIJ010176 conserved hypothetical protein 1.8 2.1 4.2* 4.5* 
   CPIJ007344 conserved hypothetical protein 1.7 1.6 4.0* 3.1 
   CPIJ006083 conserved hypothetical protein 1.7 2.7 4.6* 3.9 
   CPIJ008664 conserved hypothetical protein 1.4 5.6* 13.6* 10.2* 
   CPIJ016283 conserved hypothetical protein 1 2.1 1.6 6.6* 
   CPIJ014725 conserved hypothetical protein 0.9 -1 6.1* 2.3 
   CPIJ011914 conserved hypothetical protein 0.9 4.2* 3.2 4.4 
   CPIJ018462 conserved hypothetical protein 0.8 6.1* 5.2 16.8* 
   CPIJ008775 conserved hypothetical protein 0.7 5.0* 2.4 2.8 
   CPIJ016278 conserved hypothetical protein 0.6 6.1* 5.0* 6.1* 
   CPIJ011487 conserved hypothetical protein 0.6 5.9 10.9* 10.7* 
   CPIJ018794 conserved hypothetical protein 0.6 2.3 3.5 6.3* 
   CPIJ005199 conserved hypothetical protein 0.4 2.6 6.2* 3.4 
   CPIJ006046 conserved hypothetical protein 0.4 74.4* 4.8 259.6* 
   CPIJ018443 conserved hypothetical protein 0.3 4.5* 4.5 5.2* 
   CPIJ007442 conserved hypothetical protein 0.3 3.3 9.9* 5.9 
   CPIJ008147 conserved hypothetical protein 0.2 5.7 5 12.4* 
   CPIJ017621 conserved hypothetical protein 0.2 6.6 9.2* 7.8 
   CPIJ002735 conserved hypothetical protein 0 2.5*? 2.2*? 2.9*? 
   CPIJ006215 conserved hypothetical protein 0 2.0? 0.8? 7.3*? 
   CPIJ014238 conserved hypothetical protein 0 0.2? 0.5? 1.3*? 
251 
 
   CPIJ014355 conserved hypothetical protein 0 1.3? 0.8? 3.5*? 
   CPIJ802086 hypothetical protein 77.4 2.3 6.5* 4.6 
   CPIJ010703 hypothetical protein 50.4 2.3 7.0* 5.0* 
   CPIJ009104 hypothetical protein 43.4 1.9 6.3* 4.2* 
   CPIJ012015 hypothetical protein 43 2.8* 2.6 2.8 
   CPIJ009101 hypothetical protein 38.3 2.1 4.9* 4.7 
   CPIJ011254 hypothetical protein 31.6 2.1 6.0* 5.2* 
   CPIJ004688 hypothetical protein 23.2 3.9* 5.2* 4.8* 
   CPIJ014436 hypothetical protein 21.4 2.1 5.4* 2.9 
   CPIJ019329 hypothetical protein 14.6 -5.6 8.2* 9.4* 
   CPIJ000531 hypothetical protein 12.9 1.4 2.4 4.2* 
   CPIJ013119 hypothetical protein 9.2 3.0* 4.2* 7.1* 
   CPIJ010444 hypothetical protein 2.9 3.4 7.0* 6.2* 
   CPIJ018459 hypothetical protein 2.1 2.6 1.3 6.9* 
   CPIJ005376 hypothetical protein 1 2.6 4.5 6.8* 
   CPIJ019239 hypothetical protein 0.7 6.9 42.1* 11.5 
   CPIJ015171 hypothetical protein 0 1.0? 2.2*? 0.9? 
Other Unknown 
function 
Cysteine-rich 
domain 
CPIJ007580 conserved hypothetical protein 0.4 3.1 4.8* 4.6 
  E set domains CPIJ020106 translocator protein 0.9 6.5* 6.8* 8.2* 
   CPIJ002737 MPA2 allergen 11.4 2 1.7 3.9* 
   CPIJ013180 conserved hypothetical protein 5.5 -1.1 1.1 7.9* 
  Fibrinogen 
coiled-coil and 
central regions 
CPIJ014143 conserved hypothetical protein 0.3 4.8* 5.6* 4.7 
  SpoIIaa-like CPIJ005331 sulfate transporter, putative 1 2.5 1.8 5.2* 
Regulation DNA-
binding 
beta-beta-alpha 
zinc fingers 
CPIJ007837 zinc finger protein  8.2 -1 3.4 4.1* 
   CPIJ016287 conserved hypothetical protein 1.7 3.2* 2.2 2.6 
   CPIJ018516 conserved hypothetical protein 0.3 8.9* 7.3 10.6* 
  Glucocorticoid 
receptor-like 
(DNA-binding 
domain) 
CPIJ008216 nuclear hormone receptor ftz-f1 3.1 2.8 4.6* 4.2* 
  Homeodomain-
like 
CPIJ012997 Eip93F 1.8 3.1* 4.6* 4.8* 
  Leucine zipper 
domain 
CPIJ019348 sarcolemmal associated protein, 
putative  
0.1 3.4 8.1* 6.1 
   CPIJ004502 conserved hypothetical protein 0.1 10.2* 11.4* 12.8* 
  RPB6/omega 
subunit-like 
CPIJ005881 conserved hypothetical protein 0.2 9.0* 8.2* 7.1* 
 Kinases/ph
osphatases 
Protein kinase-
like (PK-like) 
CPIJ801694 testis-specific serine/threonine-
protein kinase 1 
1.5 4.0* 4.9* 4.1* 
   CPIJ005558 conserved hypothetical protein 1.8 -1.9 6.9* 6.5* 
   CPIJ013214 rage-1  0.3 5.9* 4 4.8 
   CPIJ007354 testis-specific serine/threonine-
protein kinase 6 
0.2 4.6 6.5* 5.9 
   CPIJ017094 protein serine/threonine kinase, 
putative  
16 1.7 4.2* 3.4 
 Receptor 
activity 
Cytoplasmic 
domain of a 
serine 
chemotaxis 
receptor 
CPIJ009621 conserved hypothetical protein 1 3.1* 4.0* 3.5 
   CPIJ006799 conserved hypothetical protein 0.3 5.6* 1.6 15.7* 
 Signal 
transductio
n 
cAMP-binding 
domain-like 
CPIJ008823 conserved hypothetical protein 0.3 3.5 5.0* 4.7 
   CPIJ006213 cyclic nucleotide-gated cation 
channel 4 
0.1 3.9 6.1* 6.1* 
  Insect 
pheromone/odor
CPIJ012719 odorant binding protein OBP20 1.9 2.2 4.6* 3 
252 
 
ant-binding 
proteins 
   CPIJ001874 Odorant-binding protein 56a, 
putative  
0.9 31.6* 3 62.1* 
   CPIJ009568 odorant binding protein OBP8 0.3 -1 37.2* 24.0* 
   CPIJ801715 Odorant-binding protein 56a 0.2 36.5* 2.9 63.1* 
  Nicotinic 
receptor ligand 
binding domain-
like 
CPIJ016909 nicotinic acetylcholine receptor, 
beta-2 subunit, putative  
2.9 1.3 3.4 5.3* 
  Nuclear receptor 
ligand-binding 
domain 
CPIJ014945 nuclear hormone receptor ftz-f1 8.2 2.6 5.1* 4.0* 
   CPIJ008215 nuclear hormone receptor ftz-f1 4.5 2 4.4* 3.1 
  PDZ domain-
like 
CPIJ001710 conserved hypothetical protein 0.3 4.4 3.6 11.0* 
  PYP-like sensor 
domain (PAS 
domain) 
CPIJ007193 period circadian protein 0.4 3.6* 2.8 2.8 
  Regulator of G-
protein 
signaling, RGS 
CPIJ004658 beta-adrenergic receptor kinase  0.5 5.1 7.1* 5.3 
  Ypt/Rab-GAP 
domain of 
gyp1p 
CPIJ001736 conserved hypothetical protein 0.7 3.7* 3.1 3.9 
?SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation 
information available at the Superfamily website (version 1.75) 
supfam.cs.bris.ac.uk/SUPERFAMILY/index.html  
?Culex quinquefasciatus genome, Johannesburg strain CpipJ1.3; 
http://cquinquefasciatus.vectorbase.org/ 
? Annotations for cytochrome P450 genes were taken from the most current annotation based on: 
Nelson, DR (2009) The Cytochrome P450 Homepage. Human Genomics 4, 59-65: 
http://drnelson.uthsc.edu/CytochromeP450.html 
?Fragments Per Kilo base of gene for every Million reads mapped (FPKM) 
*Significantly up-regulated compared to the untreated control with a false discovery rate of 0.05. 
?Fold expression relative to the untreated sample not calculable, the values represent the actual 
FPKM values for the genes. 
**m/tr= metabolism/transport 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
253 
 
  
254 
 
Appendix 4.3. Genes down-regulated in the pyrethroid-resistant HAmCqG8 strain of Culex 
quinquefasciatus following permethrin challenge. 
SCOP functional annotation? Vectorbase annotation? FPKM? Fold change (24h) 
 
General 
 
Detailed 
 
Superfamily 
 
Accession 
 
Gene 
  
Untreated 
 
Acetone 
Permethrin 
LC50 LC70 
Extra-cellular 
processes 
Blood 
clotting 
Fibrinogen C-
terminal domain-
like 
CPIJ013290 conserved hypothetical protein 4.7 -2.9 -4.3* -3.2* 
   CPIJ018159 fibrinogen and fibronectin  11.1 -3.3* -15.1* -12.0* 
   CPIJ013538 ficolin-1 precursor 32.4 -39.7* -95.8* -48.6* 
   CPIJ017657 salivary secreted angiopoietin, 
putative 
13.4 -5.1* -4.2* -2.1 
 Cell adhesion alpha-
catenin/vinculin 
CPIJ018558 conserved hypothetical protein 1 -5.8* -1.9 -1.2 
  C-type lectin-like CPIJ000449 galactose-specific C-type lectin, 
putative  
19.4 -1.6 -3.0* -3.7* 
   CPIJ012307 galactose-specific C-type lectin, 
putative  
62.5 -4.1* -1.5 -1.6 
   CPIJ016688 galactose-specific C-type lectin, 
putative  
5 -8.1* -1.3 -1.5 
  FnI-like domain CPIJ000931 conserved hypothetical protein 8.5 -2.2 -3.7* -3.3* 
  RNI-like CPIJ004947 leucine-rich repeat-containing 
protein 1 
33.4 -3.8* -4.2* -3.8* 
 Immune 
response 
Staphylokinase/stre
ptokinase 
CPIJ801956 croquemort 179.1 -1.3 -3.3 -3.7* 
General General EF-hand CPIJ005975 conserved hypothetical protein 482.8 -2.9 -4.1* -5.1* 
  WD40 repeat-like CPIJ000959 conserved hypothetical protein 39.8 -4.7* -2 -2.5* 
   CPIJ004852 conserved hypothetical protein 3.2 1.3 -2.2 -2.9* 
 Small 
molecule 
binding 
FAD-binding 
domain 
CPIJ802221 24-dehydrocholesterol reductase 197.8 -3.4* -2.9 -3 
  FAD/NAD(P)-
binding domain 
CPIJ010903 conserved hypothetical protein 101.7 -3.3* -2.5* -2.3 
   CPIJ008048 peroxisomal N1-acetyl-
spermine/spermidine oxidase 
5.3 -2.6 -3.4* -2.8* 
  GST C-terminal 
domain-like 
CPIJ018632 glutathione-s-transferase theta, gst  457.8 -6.3* -5.0* -4.3* 
  NAD(P)-binding 
Rossmann-fold 
domains 
CPIJ000372 L-xylulose reductase 29.9 -3.8* -5.1* -4.5* 
   CPIJ005655 oxidoreductase  55.4 -3.1* -5.1* -4.2* 
   CPIJ005656 oxidoreductase  164.6 -5.6* -6.1* -4.9* 
  Nucleotide-binding 
domain 
CPIJ007272 d-amino acid oxidase  31.4 -2.6 -5.1* -3.9* 
  P-loop containing 
nucleoside 
triphosphate 
hydrolases 
CPIJ008284 canalicular multispecific organic 
anion transporter 1 
1.8 -2.1 -3.0* -3.8* 
   CPIJ012368 lipoprotein-releasing system ATP-
binding protein lolD 
3.2 -5.4* -2.1 -2.7* 
  Thiamin 
diphosphate-
binding fold 
(THDP-binding) 
CPIJ011465 C-4 methylsterol oxidase 4.6 -1.3 -3.3* -3.5* 
Information Chromatin 
structure 
Histone H3 K4-
specific 
methyltransferase 
SET7/9 N-terminal 
domain 
CPIJ007018 conserved hypothetical protein 11.7 -1.2 -2.8 -3.1* 
 DNA 
replication/re
pair 
RING/U-box CPIJ011986 nuclear transcription factor, x-box 
binding 1 
2 -2.6 -1.8 -3.3* 
255 
 
 Translation Ribosomal protein 
S5 domain 2-like 
CPIJ005090 conserved hypothetical protein 10.7 -1.8 -2.1 -2.7* 
Intra-cellular 
processes 
Cell cycle, 
Apoptosis 
CAD & PB1 
domains 
CPIJ011935 conserved hypothetical protein 5.5 -14.0* -29.0* -29.5* 
 Ion m/tr MFS general 
substrate 
transporter 
CPIJ017878 permease, putative  60.2 -6.3* -4.0* -2.8 
   CPIJ007428 Sialin, Sodium/sialic acid 
cotransporter, putative  
35.8 -1.8 -2.1 -2.6* 
   CPIJ012069 sucrose transport protein  5.9 -3.3* -5.0* -4.2* 
   CPIJ012070 sucrose transport protein  9.7 -6.7* -2.6* -2.4* 
   CPIJ008941 sugar transporter  8.7 -3.1* -3.2* -3.7* 
   CPIJ012676 sugar transporter  18 -3.6* -3.4* -3.1* 
   CPIJ017566 synaptic vesicle protein  7 -5.3* -5.0* -7.4* 
   CPIJ003138 UNC93A protein, putative  40 -1.9 -2.9* -2.4 
 Phospholipid 
m/tr 
CRAL/TRIO 
domain 
CPIJ014226 cellular retinaldehyde-binding 
protein 
394.7 -1.3 -5.1* -5.5* 
   CPIJ014224 conserved hypothetical protein 15.7 -4.0* -3.1* -3.9* 
   CPIJ014228 conserved hypothetical protein 253.2 -2.5 -3.3* -2.8* 
   CPIJ015060 conserved hypothetical protein 24.6 -3.6* -2.2 -2.5* 
 Proteases Creatinase/aminope
ptidase 
CPIJ015407 xaa-Pro aminopeptidase 1 46.6 -1.5 -2.4 -2.9* 
  Cysteine 
proteinases 
CPIJ001239 cathepsin B precursor 91.8 -3.3* 1.9 1.5 
  Kazal-type serine 
protease inhibitors 
CPIJ000733 conserved hypothetical protein 287.5 -3.2* -2 -1.6 
  Metallo-dependent 
phosphatases 
CPIJ800110 conserved hypothetical protein 21.6 -1.7 -6.9* -7.3* 
  Metalloproteases 
("zincins"), 
catalytic domain 
CPIJ004060 aminopeptidase N precursor 28.5 -1.1 -18.5* -24.9* 
   CPIJ012036 aminopeptidase N precursor 15 -2.1 -3.2* -3.4* 
   CPIJ002943 conserved hypothetical protein 126.3 -1.2 -2.3 -3.0* 
   CPIJ013316 zinc metalloproteinase  2.8 -7.8* 1.7 -1 
   CPIJ801477 protease m1 zinc metalloprotease 57.5 -1.7 -5.9* -6.7* 
   CPIJ801485 protease m1 zinc metalloprotease 51.5 -1.2 -4.8* -4.9* 
  Serine protease 
inhibitors 
CPIJ012287 hypothetical protein 52.1 -5.9* 3.8 2.1 
  Serpins CPIJ000214 serpin B10 5.6 -3.7* -2.6* -2.3 
  Trypsin-like serine 
proteases 
CPIJ002126 chymotrypsin-1 70.9 -2.9* -17.3* -16.4* 
   CPIJ002138 chymotrypsinogen, putative 93.1 -4.7* -9.0* -7.3* 
   CPIJ011617 chymotrypsinogen, putative 382.8 -2 -3.6 -3.7* 
   CPIJ006076 hypodermin-B precursor 8.2 -4.4* -2.6* -2.1 
   CPIJ002128 mast cell protease 2 precursor 65.6 -1.1 -4.2* -4.0* 
   CPIJ010641 prostasin precursor 37.9 -2.4 -2.5* -2.5* 
   CPIJ017798 serine protease 4.6 -3.6* -2.5 -1.5 
   CPIJ002136 serine proteases 1/2 precursor 179.6 -1.5 -5.4* -5.8* 
   CPIJ002137 serine proteases 1/2 precursor 47.1 1.1 -2.9* -3.1* 
   CPIJ007385 serine-type enodpeptidase, putative  32.6 -4.6* -10.8* -12.5* 
   CPIJ011383 serine-type enodpeptidase, putative  1263.6 -2.7 -12.5* -16.5* 
   CPIJ013616 trypsin 5 precursor 18.7 -16.2* -3.9* -5.6* 
   CPIJ002133 trypsin epsilon precursor 22 -2.2 -4.4* -4.8* 
   CPIJ006077 trypsin theta precursor 380.9 -1.8 -4.6* -5.1* 
   CPIJ006079 tryptase gamma precursor 1353.8 -1.3 -7.8* -7.3* 
   CPIJ801807 brachyurin 278.3 -1.9 -7.2* -6.7* 
   CPIJ002142 collagenase precursor 2981.5 -1.4 -3.2* -3.6* 
   CPIJ002156 chymotrypsin BI precursor 145.1 -2.0* 1.4 1.2 
  Zn-dependent 
exopeptidases 
CPIJ010805 carboxypeptidase A1 precursor 141.2 -1.6 -4.7* -4.5* 
   CPIJ010801 carboxypeptidase B precursor 11.6 1.4 -6.2* -5.7* 
   CPIJ009738 conserved hypothetical protein 44.6 -1.5 -3.1* -3.3* 
   CPIJ010806 conserved hypothetical protein 100.4 -1.1 -11.6* -5.3* 
   CPIJ014108 conserved hypothetical protein 19.3 -1.7 -2.9* -3.4* 
   CPIJ801685 carboxypeptidase A2 54.8 -2.9* -4.7* -5.7* 
   CPIJ801679 zinc carboxypeptidase 100.5 -1.6 -4.7* -5.6* 
256 
 
   CPIJ801680 zinc carboxypeptidase 41.6 -1.7 -3.6* -3.2* 
 Protein 
modification 
GroES-like CPIJ013379 sorbitol dehydrogenase 73.6 -4.2* -2.1 -1.8 
  HSP20-like 
chaperones 
CPIJ005645 heat shock protein 22 4 -1.3 -9.2* 3 
  Peptide methionine 
sulfoxide reductase 
CPIJ018565 peptide methionine sulfoxide 
reductase 
9 -3.8* 2.1 2.4 
 Transport Ammonium 
transporter 
CPIJ013531 ammonium transporter, putative 24.4 -3.4* 1.3 -1.7 
  Lipocalins CPIJ801584 apolipoprotein D 7.8 -4.3* 1 1.3 
  Mitochondrial 
carrier 
CPIJ019873 mitochondrial brown fat uncoupling 
protein  
42.1 -3.1* -3.8* -3.3* 
   CPIJ013697 tricarboxylate transport protein, 
mitochondrial precursor 
47.6 -3.1* -2.2 -2.3 
Metabolism Amino acids 
m/tr 
Arginase/deacetylas
e 
CPIJ015718 arginase 30.2 -3.0* -3.3* -3.9* 
  PLP-binding barrel CPIJ008556 ornithine decarboxylase 4.1 -8.3* -2.1 -1.5 
   CPIJ009093 ornithine decarboxylase 6.9 -1.9 -2 -2.5* 
   CPIJ009094 ornithine decarboxylase 1 13.7 -1.6 -3.4* -3.1* 
  Tryptophan 
synthase beta 
subunit-like PLP-
dependent enzymes 
CPIJ012752 cysteine synthase  48.5 -4.2* -8.3* -5.5* 
 Carbohydrate 
m/tr 
(Trans)glycosidases CPIJ801597 alpha-amylase 1 387.1 1.1 -22.1* -23.6* 
   CPIJ801761 alpha-amylase A 346.3 -1.8 -5.8* -5.4* 
   CPIJ008663 conserved hypothetical protein 219.4 -2 -4.8* -5.7* 
   CPIJ007459 hypothetical protein 23.7 -2.5 -2.7* -1.3 
   CPIJ005062 alpha-amylase 249.1 -1.4 -3.2 -4.8* 
   CPIJ013169 alpha-glucosidase precursor 13.7 -1.2 -2.6* -2.5* 
   CPIJ003338 beta-galactosidase  62.4 -1.5 -3.2* -3.3* 
   CPIJ013477 beta-hexosaminidase  1.6 1.5 -3.0* -2.1 
   CPIJ008529 lactase-phlorizin hydrolase 
precursor 
54 -1.9 -4.2* -4.2* 
   CPIJ008530 lactase-phlorizin hydrolase 
precursor 
242.1 -2.9 -16.7* -17.1* 
   CPIJ008531 lactase-phlorizin hydrolase 
precursor 
138.1 -2.5 -5.0* -5.3* 
   CPIJ005725 alpha-amylase A precursor 48.7 -1.5 -4.2* -3.4* 
   CPIJ009306 neutral alpha-glucosidase ab 
precursor 
7.6 -1.9 -5.4* -7.1* 
  Invertebrate chitin-
binding proteins 
CPIJ004731 conserved hypothetical protein 11.9 -5.3* -2 -2.3 
   CPIJ011623 conserved hypothetical protein 74.9 -3.1* -2.4 -3.1* 
   CPIJ012138 conserved hypothetical protein 546.8 -1.6 -4.3* -5.0* 
   CPIJ014181 conserved hypothetical protein 235.5 -2 -3.1 -3.5* 
   CPIJ014194 conserved hypothetical protein 114.7 -5.1* -1.6 -1.9 
   CPIJ015734 conserved hypothetical protein 23.9 -5.3* -1.2 -1.4 
   CPIJ016342 conserved hypothetical protein 58.7 -4.7* -1.2 -1.6 
   CPIJ003955 predicted protein 211.7 -2.4 -7.9* -4.7* 
   CPIJ004733 predicted protein 50.4 -1.5 -3.7* -4.6* 
   CPIJ018945 predicted protein 13.4 -1.5 -2.9* -4.7* 
 Coenzyme 
m/tr 
Cell wall binding 
repeat 
CPIJ016313 endocuticle structural glycoprotein 
SgAbd-2 
5.3 0.0* -39.8* 0.0* 
  SCP-like CPIJ015122 sterol carrier protein-2, putative  2729.5 -3 -4.2* -3.6 
  Single hybrid motif CPIJ016638 glycine cleavage system h protein  112.8 -3.3* -2 -1.9 
 E- transfer CO dehydrogenase 
molybdoprotein N-
domain-like 
CPIJ000151 sodium/solute symporter  20.5 -1.3 -2.5* -1.4 
 Energy Citrate synthase CPIJ010291 citrate synthase, mitochondrial 
precursor 
8.6 -2.5 -3.1* -2.4* 
  PEP carboxykinase-
like 
CPIJ010515 phosphoenolpyruvate carboxykinase 87.3 -9.5* -4.2* -2.7 
   CPIJ010518 phosphoenolpyruvate carboxykinase 154.2 -6.2* -4.0* -3.2 
 Lipid m/tr Acyl-CoA binding 
protein 
CPIJ011388 diazepam binding inhibitor, putative  718.5 -5.5* -4.5* -4.6* 
257 
 
  Tp47 lipoprotein, 
N-terminal domain 
CPIJ016325 conserved hypothetical protein 359.9 -2.8* -3.0* -2.8* 
 Nitrogen m/tr RmlC-like cupins CPIJ020056 cysteine dioxygenase  54.1 -1.5 -2.4* -2 
 Nucleotide 
m/tr 
Adenine nucleotide 
alpha hydrolases-
like 
CPIJ007938 asparagine synthetase B 11.3 -4.4* -1.8 -1.9 
  SAICAR synthase-
like 
CPIJ801627 purine biosynthesis protein 6, pur6 104.8 -3.2* -3.8* -2 
 Other 
enzymes 
Acetyl-CoA 
synthetase-like 
CPIJ016639 acetyl-coa synthetase  48.5 -2.9* -1.4 -1.2 
   CPIJ012907 luciferin 4-monooxygenase 17.3 -3.3* 1.3 1.4 
  Actin-like ATPase 
domain 
CPIJ012574 actin 36.4 -1.3 -3.8* -3.6* 
   CPIJ006534 conserved hypothetical protein 19.7 -4.2* -1.5 -1.8 
   CPIJ011081 heat shock protein 70 B2 1.1 1.7 -5.8* 3.3 
   CPIJ011082 heat shock protein 70 B2 4.2 -1.3 -7.4* 1.8 
   CPIJ011083 heat shock protein 70 B2 3.4 -1.6 -7.8* 1.5 
  Alkaline 
phosphatase-like 
CPIJ001264 alkaline phosphatase 33.2 -2.4 -3.7* -5.3* 
   CPIJ001265 alkaline phosphatase 75.5 -1.3 -5.4* -6.5* 
   CPIJ001262 alkaline phosphatase  99.4 -1.6 -4.0* -5.3* 
   CPIJ015241 alkaline phosphatase  8.1 -3.9* -2.9* -2.6* 
   CPIJ018121 membrane-bound alkaline 
phosphatase precursor 
107.2 -2.2 -11.9* -15.4* 
  alpha/beta-
Hydrolases 
CPIJ018233 esterase FE4 precursor 3085 -2.1* -7.9* -8.0* 
   CPIJ001372 bphl protein 30.6 -2.7* -2.6* -2.8* 
   CPIJ018231 carboxylesterase  36.1 -2.2 -12.7* -14.3* 
   CPIJ018232 cholinesterase 259.7 1.2 -4.2* -4.1 
   CPIJ007461 epoxide hydrolase  21.9 -4.5* -3.0* -2 
   CPIJ004637 glutactin precursor 41.1 -9.2* -4.3* -4.0* 
   CPIJ001121 kynurenine formamidase 29.7 -3.4* -2.6* -3.0* 
   CPIJ004227 lipase 631.6 -1.9 -19.4* -16.1* 
   CPIJ004228 lipase 1160 -2 -8.5* -9.5* 
   CPIJ004230 lipase 170.5 -1.8 -8.7* -7.0* 
   CPIJ002726 lipase 3 precursor 116.5 -2.3 -8.7* -13.3* 
   CPIJ008876 lysosomal pro-X carboxypeptidase, 
putative  
439.2 -2.3 -10.8* -11.9* 
   CPIJ004224 pancreatic triacylglycerol lipase 347.8 -1.6 -4.7* -5.0* 
   CPIJ004226 pancreatic triacylglycerol lipase 22.7 -2 -7.2* -5.6* 
   CPIJ019228 pancreatic triacylglycerol lipase 7.2 -3.2* 1.4 1.6 
   CPIJ004225 pancreatic triacylglycerol lipase 
precursor 
482.6 -1.8 -6.8* -7.9* 
   CPIJ005462 pancreatic triacylglycerol lipase 
precursor 
19.5 -1.6 -2.4* -3.0* 
   CPIJ008873 prolylcarboxypeptidase, putative  19.4 1.4 -3.1* -3.2* 
   CPIJ008874 prolylcarboxypeptidase, putative  252.8 -1.4 -4.3* -4.5* 
   CPIJ008877 prolylcarboxypeptidase, putative  17.1 -22.6* -4.7* -6.0* 
   CPIJ008878 prolylcarboxypeptidase, putative  13.3 -139.5* -14.4* -22.0* 
   CPIJ002911 retinoid-inducible serine 
carboxypeptidase precursor 
48.1 -2 -6.7* -8.1* 
   CPIJ018060 thymus-specific serine protease 
precursor 
53.7 -1.3 -4.3* -5.7* 
   CPIJ018061 thymus-specific serine protease 
precursor 
6.6 -1.3 -7.7* -5.0* 
   CPIJ801474 conserved hypothetical protein 260 -2.6 -10.7* -11.4* 
   CPIJ801475 conserved hypothetical protein 30.5 -1.5 -30.8* -50.7* 
   CPIJ802425 dipeptidyl peptidase 4 70 -2.1 -3.3* -3.7* 
  Calcium-dependent 
phosphotriesterase 
CPIJ007528 anterior fat body protein  116.4 -4.1* -1.9 -1.9 
   CPIJ007230 regucalcin 72 -8.2* -5.6* -5.1* 
  Carbon-nitrogen 
hydrolase 
CPIJ003840 aliphatic nitrilase, putative  59.4 -1.5 -2.2 -2.7* 
  Carbonic anhydrase CPIJ014281 carbonic anhydrase precursor 34.9 -1.4 -2.6* -2.6* 
  Cytidine 
deaminase-like 
CPIJ801876 cytidine deaminase 13.3 -3.9* -2.2 -3.0* 
258 
 
  HAD-like CPIJ008977 pyridoxal phosphate phosphatase 1.6 -6.9* -17.8* -3.6* 
  Isochorismatase-
like hydrolases 
CPIJ008109 conserved hypothetical protein 13.3 -1.4 -3.1* -3.1* 
  Metallo-dependent 
hydrolases 
CPIJ003807 allantoinase  85 -5.4* -4.7* -7.8* 
  N-acetylmuramoyl-
L-alanine amidase-
like 
CPIJ016771 peptidoglycan recognition protein 
precursor 
4339.8 -1.6 -15.0* -13.6* 
  N-terminal 
nucleophile 
aminohydrolases 
(Ntn hydrolases) 
CPIJ802450 gamma glutamyl transpeptidase 7.7 -1.4 -7.2* -7.2* 
  Thiolase-like CPIJ005595 fatty acid synthase S-
acetyltransferase 
80.5 -4.4* -3 -3 
  YVTN repeat-
like/Quinoprotein 
amine 
dehydrogenase 
CPIJ009045 conserved hypothetical protein 24 -22.6* -3.1* -4.3* 
 Photosynthesi
s 
Light-harvesting 
complex subunits 
CPIJ005531 conserved hypothetical protein 12.9 -3.4* -2.5* -2.9* 
 Polysaccharid
e m/tr 
Ricin B-like lectins CPIJ013165 16 kDa salivary peptide, putative  11.5 -2 -4.1* -2.2 
 Redox Acid 
phosphatase/Vanadi
um-dependent 
haloperoxidase 
CPIJ013993 amino acid transporter  1.1 -1.1 -1.6 -7.0* 
  ALDH-like CPIJ009438 aldehyde dehydrogenase  84.7 -2.6 -3.1* -2.8 
  Aromatic 
aminoacid 
monoxygenases, 
catalytic and 
oligomerization 
domains 
CPIJ002149 phenylalanine hydroxylase  34.8 -2.8* -2.2 -1.6 
  Cytochrome P450 CPIJ800155 CYP15B1 1.4 -1.9 -1.4 -3.2* 
   CPIJ800249 CYP4D42 16.6 -1.5 -2.8* -2.7* 
   CPIJ800254 CYP4H30 21.4 -1.7 -6.5* -6.8* 
   CPIJ800257 CYP4H35 15.8 -2.5 -2.4* -2.4* 
   CPIJ800260 CYP4H38 20.3 -1.7 -3.2* -3.8* 
   CPIJ800227 CYP9J38 5.8 1.1 -1.9 -2.4* 
   CPIJ016284 CYP4J4 1.8 -1.6 -3.3* -2.7 
  Di-copper centre-
containing domain 
CPIJ007783 arylphorin subunit alpha precursor 3799.6 -7.6* -7.3 -6.8 
   CPIJ006537 larval serum protein 1 beta chain 
precursor 
68.1 -5.9* -9.0* -9.1* 
   CPIJ006538 larval serum protein 1 beta chain 
precursor 
96.3 -6.2* -6.8* -6.0* 
   CPIJ018824 larval serum protein 1 beta chain 
precursor 
203 -6.0* -6.1* -6.2* 
   CPIJ000056 hexamerin 1.1 precursor 1590 -4.9* -5.4* -4.3* 
   CPIJ007783 hexamerin 1.1 precursor 3800 -7.6* -7.3* -6.8* 
   CPIJ009032 hexamerin 1.1 precursor 357 -3.7* -3.6* -2.8* 
   CPIJ009033 hexamerin 1.1 precursor 15465.4 -1.9* -1.5 -1.6 
   CPIJ001820 Larval serum protein 2 precursor 6341.4 -5.7* -5.4* -6.0* 
  Thioredoxin-like CPIJ018629 glutathione-s-transferase theta, gst  96.5 -3.0* -1.7 -1.8 
   CPIJ008450 peroxiredoxin-6 183.5 -4.0* -3.1* -3.4* 
 Secondary 
metabolism 
Concanavalin A-
like 
lectins/glucanases 
CPIJ001786 collagen alpha chain 6.8 -2.1 -3.7* -4.0* 
   CPIJ006421 conserved hypothetical protein 16.2 -2 -2.4 -2.5* 
   CPIJ004229 gram negative bacteria binding 
protein 2 
1.3 -2.7 -12.6* -25.6 
   CPIJ004321 gram-negative bacteria binding 
protein  
199.5 1.3 -4.0* -4.6* 
   CPIJ004323 gram-negative bacteria binding 
protein  
141.5 -1.4 -3.2* -3.2* 
   CPIJ004325 gram-negative bacteria binding 11.1 -2 -2.9* -4.7* 
259 
 
protein  
   CPIJ004320 gram-negative bacteria-binding 
protein 1 precursor 
134.9 -2.9 -38.1* -24.8* 
 Transferases Acyl-CoA N-
acyltransferases 
(Nat) 
CPIJ015296 retinol-binding protein 5.7 -3.6 -3.6 -5.7* 
  Glycerol-3-
phosphate (1)-
acyltransferase 
CPIJ802146 1-acyl-sn-glycerol-3-phosphate 
acyltransferase 
25.1 -2.5 -3.2* -3.0* 
  PLP-dependent 
transferases 
CPIJ006619 cystathionine gamma-lyase 56.9 -1.6 -4.5* -4.0* 
   CPIJ004400 ornithine aminotransferase, 
mitochondrial precursor 
110.7 -4.9* -5.8* -6.5* 
   CPIJ008287 phosphoserine aminotransferase 31.3 -3.5* -2.3 -1.6 
No 
annotation 
No 
annotation 
No annotation CPIJ017146 2-acylglycerol O-acyltransferase 2-
A 
63.9 -1.6 -2.6 -2.8* 
   CPIJ013992 amino acid transporter, putative 5.1 -1.6 -3.1* -2.3 
   CPIJ802440 cuticle protein CP14.6 232.4 -5.6* -5.4* -5.8* 
   CPIJ003483 cuticle protein, putative  61.1 -3.6* -4.5* -3.6* 
   CPIJ003484 cuticle protein, putative  59.5 -3.9* -3.8* -3.3* 
   CPIJ003485 cuticle protein, putative  42.3 -1.9 -4.7* -3.1* 
   CPIJ007171 proton-coupled amino acid 
transporter 1 
7.6 -1.9 -3.4* -2.8* 
   CPIJ801724 sodium/solute symporter 18.1 -3.4* -2.7* -2.8* 
   CPIJ003879 lipid storage droplets surface-
binding protein 1 
60.2 -3.0* -1.2 1.1 
   CPIJ000534 hypothetical protein 17.2 -2.8 -4.1* -1.9 
   CPIJ000535 hypothetical protein 28.6 -2.7 -3.3* -2.3 
   CPIJ007722 hypothetical protein 534.9 1.1 -3.3* -2.6 
   CPIJ011256 hypothetical protein 74.8 -1.7 -2.5* -1.5 
   CPIJ019329 hypothetical protein 14.6 -5.6* 8.2 9.4 
   CPIJ005479 hypothetical protein 22.2 -18.7* -2.4 -3.8* 
   CPIJ008508 predicted protein 2.2 -3.7 -7.0* -2.7 
   CPIJ009902 predicted protein 16.7 -2.3 -12.7* -12.9* 
   CPIJ017828 predicted protein 841.3 -8.2* -5.7 -3.6 
   CPIJ017829 predicted protein 78.8 -3.4* -4.4* -4.1* 
   CPIJ801843 conserved hypothetical protein 230 -3.0* -3.6* -2.2 
   CPIJ801846 conserved hypothetical protein 380.2 -2.4 -3.2* -1.6 
   CPIJ801847 conserved hypothetical protein 137.5 -7.3* -10.4* -2.5* 
   CPIJ002115 conserved hypothetical protein 7 -3.5* -1.2 -1.4 
   CPIJ002309 conserved hypothetical protein 66.7 -3.8* -3.2* -2.5* 
   CPIJ003026 conserved hypothetical protein 6 -5.0* -4.0* -6.4* 
   CPIJ003129 conserved hypothetical protein 10.8 -3.3* -1.6 -1.5 
   CPIJ008107 conserved hypothetical protein 4.3 1 -2.5* -1.7 
   CPIJ008353 conserved hypothetical protein 55.9 -1.8 -2.2 -2.5* 
   CPIJ008379 conserved hypothetical protein 466.9 -1.7 -4.3* -2.6 
   CPIJ009330 conserved hypothetical protein 12.6 -6.8* -8.6* -8.3* 
   CPIJ010904 conserved hypothetical protein 128.4 -2.9* -2.1 -2.5 
   CPIJ011137 conserved hypothetical protein 3.9 -3.4 -3.2* -1.5 
   CPIJ011505 conserved hypothetical protein 39.6 -4.1* -2.1 -1.6 
   CPIJ017076 conserved hypothetical protein 21.6 -1.9 -3.8* -7.8* 
   CPIJ017687 conserved hypothetical protein 21.8 -3.4* -2 -1.1 
Other Unknown 
function 
E set domains CPIJ018825 larval serum protein 1 beta chain 
precursor 
154.6 -6.0* -6.6* -5.5* 
   CPIJ002744 conserved hypothetical protein 670.9 -1.3 -7.8* -8.6* 
   CPIJ018326 conserved hypothetical protein 1192.8 -8.2* -1.7 -2.1 
   CPIJ004282 hexamerin 2 beta  44.8 -2.1 -4.3* -5.9* 
 Viral proteins Head and neck 
region of the 
ectodomain of 
NDV fusion 
glycoprotein 
CPIJ802080 conserved hypothetical protein 3 -1.8 -2.7 -3.2* 
Regulation DNA-binding "Winged helix" 
DNA-binding 
domain 
CPIJ801885 conserved hypothetical protein 9.1 -1.7 -2.6* -2.8* 
  ParB/Sulfiredoxin CPIJ009003 conserved hypothetical protein 44.2 -2 -2.4* -2.7* 
260 
 
  ROP protein CPIJ009715 conserved hypothetical protein 1050.3 -2 -18.7* -21.7* 
 Kinases/phos
phatases 
Protein kinase-like 
(PK-like) 
CPIJ018315 NIMA-family kinase NERCC1 2.5 -2.5 -4.1* -5.9* 
   CPIJ010321 conserved hypothetical protein 4.9 -3.6* -3.0* -2.9* 
   CPIJ007628 Juvenile hormone-inducible protein, 
putative  
28.1 -2.6 -2.5* -2.2 
   CPIJ010315 Juvenile hormone-inducible protein, 
putative  
16.5 -2.3 -8.2* -8.4* 
 Receptor 
activity 
Chemosensory 
protein Csp2 
CPIJ801979 serine/threonine kinase 6.5 -33.4* -4.3* -5.0* 
   CPIJ801985 serine/threonine kinase 5.2 -4.3 -7.9* -6.4* 
  SRCR-like CPIJ006993 protein-lysine 6-oxidase, putative  6.6 -2.7 -2.7* -2.4* 
 Signal 
transduction 
Growth factor 
receptor domain 
CPIJ005087 cell wall cysteine-rich protein 8.1 -4.2* -2.7* -2.6* 
  Insect 
pheromone/odorant
-binding proteins 
CPIJ010787 odorant binding protein OBP51 71.2 -3.6* -1.5 -1.5 
   CPIJ004635 odorant-binding protein OBPjj7a 115.4 -3.4* -2.3 -1.7 
   CPIJ012786 predicted protein 13.3 -4.4* -4.9* -3.4* 
   CPIJ801711 hypothetical protein 426.8 -7.3* -5.8* -4.7* 
   CPIJ801713 hypothetical protein 22.5 -9.4* -12.6* -9.0* 
   CPIJ801712 predicted protein 430.7 -4.9* -4.4* -2.9* 
   CPIJ801709 predicted protein 8.8 -5.8* -9.6* -3.3* 
  PH domain-like CPIJ801535 sodium/potassium-dependent 
ATPase beta-2 subunit 
16.8 -9.4* -2.1 -3.8* 
?SCOP general and detailed functions using the predicted Cx. quinquefasciatus annotation information available at 
the Superfamily website (version 1.75) supfam.cs.bris.ac.uk/SUPERFAMILY/index.html  
?Culex quinquefasciatus genome, Johannesburg strain CpipJ1.3; http://cquinquefasciatus.vectorbase.org/ 
?Annotations for cytochrome P450 genes were taken from the most current annotation based on: Nelson, DR (2009) 
The Cytochrome P450 Homepage. Human Genomics 4, 59-65: http://drnelson.uthsc.edu/CytochromeP450.html 
?Fragments Per Kilo base of gene for every Million reads mapped (FPKM) 
*Significantly down-regulated compared to the untreated control with a false discovery rate of 0.05. 
**m/tr= metabolism/transport 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
261 
 
 
  
262 
 
Appendix 6.1. List of primers used for the qRT-PCR determination of genes. 
Vectorbase? Forward primer (5'-3') Reverse primer (5'-3') 
CPIJ000841 CTTGATCTGGGCGTGAACA TTTTCCATGGGCTCCAAAG 
CPIJ001357 TCGGGATCGTCATCTTCTTC GACCGATCGGCAGTGTACG 
CPIJ002046 AATTCCGAACCGTCGTCAC GTAGGTCGCGGCATAGCTC 
CPIJ003456 GCACATCCCCGAAGTGTC CCAGCTGGGCGTAAATGA 
CPIJ003525 GGCGTAACGTGGATGTTTCT ATAAACTTGAACGCCGTTGG 
CPIJ003531 ACGAATCGTACGACCTGGAC CTTCTGGCCAAGCTTCAAAC 
CPIJ003879 CAGCTGGCAGTGTTGCTG TCCAAGTGGACGGCCTTA 
CPIJ003915 GACGAGCACGTTACGCTCA ACGGACCACCAGAGTCACC 
CPIJ004290 AAGGCCGTCGATGACTACG AATCCGTTGACGGGATCAG 
CPIJ004640 TTCCAGGTGTCCCTCATCC TCAGCGCGTTGTAGTTTGG 
CPIJ004660 GAACCGATTCACCGTCCTG ATCCACCGCAGAAGTGTCC 
CPIJ005273 GAACCGGCTGACGAGAGTC GCGTCCTTTCCTCCTTCCT 
CPIJ005473 CCTGCCGGACAAAGACTAAG TCGGGGGTTGTTAGTACCAG 
CPIJ005952 TACGAGCTGGCCCTTAATCCGTTT AGACTTTCCGCAGGTGGGTACTTT 
CPIJ006502 GTTCCACCACATCCCAACTC CGGCTCAAACAGATCAGACA 
CPIJ007079 ATCCATCATCTCGCCCAAG TTCAGCTCCAGCAGGGAGT 
CPIJ007193 ACGACGCCCAGTATTACGC ATACTTGCGCAGCATCACG 
CPIJ007471 TGGATCTGCTGCGTCTGA AGCGCCAGTTTGAGTTGC 
CPIJ008286 GACCGGGAAGTCAGATCCA TGCGTTCCAGATGAAGGTG 
CPIJ008515 GATCCTCAGCGATCGAAGC CAGCAGCTCGTTGCACACT 
CPIJ010190 AACGCTTCTGCCAGTGTC AAAACCACATGCCAGCATTC 
CPIJ011837 TTATTCCGTTCAGTGGAGGCACGA TTCAGCAGTGCTTCAAACCGGAAG 
CPIJ012470 TGAACGTCCTTAGGGATGGCGAAA TTGCTAGTCGCGGAAACGAACTGA 
CPIJ012707 CCGACATGGGACCTGTGTA CTGCATCGCAGCACATTC 
CPIJ012708 TCCTGCGTTGCTCCAAAT GTACCCCGCATTGCAGTC 
CPIJ012716 TGCCATCATTTCCCTAGCC AGAAGCACTGCACGAAGCA 
CPIJ012719 CTGACCATCGAGCAGCAGA CGACGGTCTTTTCCTGGAC 
CPIJ012721 CCAAGTGTTTCGTGCGTTG CCGGTTCCGATAGAAGCAC 
CPIJ013321 GCAAACTCTGCTGGGCTATC CGTGTCCAGGTGCTTGTAGA 
CPIJ013633 CCAGGTCTCGTTCCTGCAT CAGGTAGGGCTTCCACCAG 
CPIJ015385 GCCAATCCGTGCTTCAAC AGGTTGCACGGACACCAC 
CPIJ015960 AGTGCATTCGGAGGTCCTTCATGT AGACTTGTCACCAGCTTATCGGCA 
CPIJ016702 CAGCAGCAGCAAAAAGTGC GTGTTCGCACTGGAGACGA 
CPIJ019052 GCCTTGATTTCCGGGACTT CGCCCAGATCTTTGTGCTT 
CPIJ019581 CAACTACGAGTGGGGCAAGT ACTCAAGACGGCAATGATGA 
CPIJ020018 TGTCCAAGTTTCGGTTCGAGGCTA AGGTGATGGCATCCGTTGAGGTAT 
rRNA CGCGGTAATTCCAGCTCCACTA GCATCAAGCGCCACCATATAGG 
?Cx. quinquefasciatus genome Johannesberg strain v1.2, www.vectorbase.org 
 
 
 
 
 
 
 
 
  
263 
 
Appendix 6.2. Complete list of up- and down-regulated genes for sugar-fed only females for the 
HAmCqG8 strain of Culex quinquefasciatus for the initial 72h post-eclosion. 
Time 
interval 
SCOP? general 
function 
Gene Vectorbase anotation? FPKM* 
(time 1) 
FPKM 
(time 2) 
Fold 
change 
2 to 12h General CPIJ002675 glutathione S-transferase 1  1.0 21.8 22.5 
 Information CPIJ009133 salivary endonuclease  3.2 94.6 29.4 
 Intra-cellular 
processes 
CPIJ001773 synaptic vesicle protein  0.2 6.3 29.0 
  CPIJ001774 synaptic vesicle protein  0.3 5.1 17.7 
  CPIJ001775 synaptic vesicle protein  0.7 21.9 31.0 
  CPIJ008945 sugar transporter  2.5 25.7 10.3 
  CPIJ008946 sugar transporter  3.0 34.3 11.3 
  CPIJ017478 conserved hypothetical protein  3.4 28.0 8.3 
  CPIJ019591 solute carrier family 2  10.8 125.7 11.6 
  CPIJ001239 cathepsin B  2.0 96.0 49.2 
  CPIJ001240 cathepsin B-like thiol protease  0.4 7.9 21.3 
  CPIJ002595 zinc carboxypeptidase  1.3 12.5 9.4 
  CPIJ004640 trypsin 5G1  5.7 354.0 61.8 
  CPIJ004984 serine protease1/2  1.1 29.8 26.0 
  CPIJ005273 trypsin 2  2.7 76.8 27.9 
  CPIJ006502 late trypsin  3.1 324.9 104.5 
  CPIJ007025 FXa-directed anticoagulant  1.7 43.0 24.7 
  CPIJ008388 aminopeptidase N  0.5 20.9 40.9 
  CPIJ010521 serine protease inhibitor dipetalogastin  0.5 7.4 13.6 
  CPIJ011998 zinc carboxypeptidase A 1  2.5 23.8 9.6 
  CPIJ012161 sphingomyelin phosphodiesterase  1.0 42.5 42.6 
  CPIJ014781 cysteine-rich protease inhibitor  0.5 26.2 55.8 
  CPIJ016348 serine protease1/2  2.5 243.5 97.7 
  CPIJ016937 coagulation factor X  1.3 37.5 29.6 
  CPIJ017414 trypsin 4  0.3 19.6 68.3 
  CPIJ017964 trypsin 7  0.3 13.0 51.6 
  CPIJ017965 trypsin 7  0.5 10.0 19.5 
  CPIJ018871 salivary apyrase; 5' nucleotidase  0.6 15.0 24.2 
  CPIJ019168 salivary apyrase  1.3 12.0 9.6 
  CPIJ020192 trypsin-like salivary secreted protein  0.4 14.6 36.0 
 Metabolism CPIJ017521 alpha-amylase I  5.7 180.2 31.6 
  CPIJ011388 diazepam binding inhibitor  63.4 626.6 9.9 
  CPIJ001082 cat eye syndrome critical region 
protein 1  
3.0 36.6 12.3 
  CPIJ005463 salivary lipase  1.0 13.3 12.8 
  CPIJ006549 lipase member I  0.1 4.4 72.7 
  CPIJ008977 pyridoxal phosphate phosphatase  12.5 247.6 19.7 
  CPIJ012882 argininosuccinate synthase  1.4 20.0 14.2 
  CPIJ016050 hepatic triacylglycerol lipase  0.2 7.9 32.9 
  CPIJ017178 myoinositol oxygenase  14.5 155.4 10.7 
  CPIJ018802 endochitinase A  0.3 4.7 16.1 
  CPIJ000040 UDP-glucuronosyltransferase 2B1  2.1 51.6 24.1 
  CPIJ015713 conserved hypothetical protein  8.8 84.8 9.6 
  CPIJ019044 15.3 kDa basic salivary protein  1.5 67.3 46.2 
  CPIJ000294 cytochrome P450 4C1  3.2 25.6 8.0 
  CPIJ005952 cytochrome P450  11.9 339.4 28.4 
  CPIJ009032 larval serum protein 2  1.9 22.7 12.2 
  CPIJ010225 cytochrome P450 12b1, mitochondrial  1.7 15.0 9.0 
264 
 
  CPIJ010227 cytochrome P450 12b1, mitochondrial  2.8 32.0 11.5 
  CPIJ010546 cytochrome P450 9c1  0.1 7.7 106.0 
  CPIJ011837 cytochrome P450  5.1 58.3 11.4 
  CPIJ011996 10-formyltetrahydrofolate 
dehydrogenase  
3.4 62.5 18.3 
  CPIJ012470 cytochrome P450 9b2  5.6 60.9 10.9 
  CPIJ019586 cytochrome P450 6d3  2.2 19.2 8.7 
  CPIJ019587 cytochrome P450 6d3  6.3 57.8 9.1 
  CPIJ020018 cytochrome P450 6d3  7.1 70.8 10.0 
  CPIJ000021 salivary protein  5.9 135.2 23.0 
  CPIJ004030 venom allergen  0.6 8.2 13.5 
  CPIJ015956 glycine N-methyltransferase  2.2 31.1 13.9 
 No Annotation CPIJ000835 chymotrypsin-2  5.6 111.7 20.0 
  CPIJ001276 defensin-A  18.5 154.3 8.4 
  CPIJ001685 conserved hypothetical protein  0.8 15.2 19.0 
  CPIJ001686 conserved hypothetical protein  0.3 11.6 39.1 
  CPIJ002046 salivary protein  1.8 84.0 46.6 
  CPIJ002089 salivary protein  7.8 183.4 23.6 
  CPIJ002476 hypothetical protein  2.9 50.5 17.6 
  CPIJ002532 sodium-dependent multivitamin 
transporter  
4.1 35.7 8.6 
  CPIJ003019 conserved hypothetical protein  1.4 21.9 15.3 
  CPIJ003054 conserved hypothetical protein  0.1 8.0 58.9 
  CPIJ003129 conserved hypothetical protein  1.6 14.0 8.5 
  CPIJ003456 uricase  5.1 91.6 18.1 
  CPIJ003468 hypothetical protein  151.1 3496.9 23.1 
  CPIJ003615 salivary protein  21.6 368.5 17.1 
  CPIJ003879 lipid storage droplets surface-binding 
protein 1  
22.9 239.8 10.5 
  CPIJ004054 hypothetical protein  0.2 5.9 23.9 
  CPIJ004641 trypsin  0.5 135.2 286.0 
  CPIJ005906 conserved hypothetical protein  2.3 41.6 17.9 
  CPIJ005910 7.8 kDa basic salivary peptide  22.7 191.1 8.4 
  CPIJ006908 carboxylesterase-6  9.3 102.1 11.0 
  CPIJ007079 trypsin-1  70.9 928.5 13.1 
  CPIJ007333 amylase  2.9 65.2 22.4 
  CPIJ007452 8.9 kDa basic salivary peptide  12.0 311.6 26.0 
  CPIJ007471 oskar  2.1 44.9 21.7 
  CPIJ007646 conserved hypothetical protein  0.4 200.4 458.4 
  CPIJ007741 conserved hypothetical protein  5.3 42.9 8.1 
  CPIJ007742 30.5 kDa secreted protein 30.5k-1  3.5 40.0 11.5 
  CPIJ007838 chymotrypsin-2  3.4 36.4 10.8 
  CPIJ008014 oxidase/peroxidase  3.1 101.8 33.1 
  CPIJ008032 conserved hypothetical protein  0.8 7.6 9.9 
  CPIJ008464 hypothetical protein  0.3 69.0 235.6 
  CPIJ008471 hypothetical protein  6.8 269.7 39.5 
  CPIJ008479 9.7 kDa salivary peptide  6.4 146.7 22.9 
  CPIJ010046 threonine-rich salivary mucin  27.5 394.3 14.3 
  CPIJ010333 conserved hypothetical protein  1.5 26.0 17.6 
  CPIJ010337 hypothetical protein  2.9 1053.0 365.9 
  CPIJ010338 conserved hypothetical protein  4.6 684.0 149.2 
  CPIJ010339 conserved hypothetical protein  1.0 173.3 182.4 
  CPIJ010699 cecropin A  12.3 190.6 15.5 
  CPIJ010772 16 kDa salivary peptide  0.2 43.1 259.7 
  CPIJ010773 16.8 kDa salivary peptide  0.2 29.5 183.0 
  CPIJ010792 16.7 kDa salivary peptide  0.3 10.6 33.7 
265 
 
  CPIJ011013 apyrase  2.8 24.5 8.8 
  CPIJ011505 conserved hypothetical protein  19.7 193.9 9.9 
  CPIJ012056 sodium-dependent serotonin 
transporter  
2.5 56.8 22.4 
  CPIJ012254 conserved hypothetical protein  1.3 36.5 29.1 
  CPIJ012707 wnt inhibitory factor 1  3.6 108.3 30.4 
  CPIJ012708 wnt inhibitory factor 1  2.2 111.2 51.0 
  CPIJ012783 7.7 kDa salivary cysteine-rich peptide  2.0 34.5 17.6 
  CPIJ012900 als  1.4 20.5 14.8 
  CPIJ013450 hypothetical protein  0.2 5.0 20.9 
  CPIJ013702 17.2 kDa salivary peptide  8.7 136.2 15.6 
  CPIJ013705 conserved hypothetical protein  13.1 127.3 9.7 
  CPIJ013706 conserved hypothetical protein  11.0 129.7 11.8 
  CPIJ014402 hypothetical protein  0.2 13.1 75.5 
  CPIJ014545 short form D7clu32 salivary protein  1.0 13.3 13.7 
  CPIJ014861 conserved hypothetical protein  4.8 47.8 9.9 
  CPIJ015385 vitellogenin  0.3 54.3 158.5 
  CPIJ015502 16.8 kDa salivary protein  0.7 41.0 60.1 
  CPIJ015613 galactose-specific C-type lectin  2.4 124.0 51.8 
  CPIJ015614 galactose-specific C-type lectin  3.0 208.0 68.8 
  CPIJ015615 salivary C-type lectin  2.1 33.4 16.2 
  CPIJ015774 34 kDa salivary secreted protein 34k-2  0.3 4.8 16.8 
  CPIJ016318 larval cuticle protein 8.7  102.4 3783.8 37.0 
  CPIJ016702 calbindin-32  10.9 223.0 20.5 
  CPIJ016792 hypothetical protein  1.0 16.4 17.0 
  CPIJ016936 Trypsin  1.3 47.5 36.7 
  CPIJ016972 salivary secreted protein 62k-3  1.0 14.2 14.8 
  CPIJ017043 hypothetical protein  4.9 104.4 21.2 
  CPIJ017044 hypothetical protein  1.9 91.3 47.5 
  CPIJ017687 conserved hypothetical protein  4.6 81.3 17.8 
  CPIJ017960 hypothetical protein  4.6 117.3 25.2 
  CPIJ018205 chymotrypsin-2  2.2 23.0 10.3 
  CPIJ018773 hypothetical protein  8348.3 68893.7 8.3 
  CPIJ018872 salivary mucin  0.5 18.6 37.9 
  CPIJ019040 15.8 kDa salivary peptide  12.9 313.1 24.4 
  CPIJ019051 16.7 kDa salivary peptide  0.6 63.0 104.6 
  CPIJ019052 13.1 kDa salivary protein  0.3 70.6 216.7 
  CPIJ019055 17.5 kDa salivary peptide  0.4 60.8 137.1 
  CPIJ019252 salivary mucin  0.3 32.7 96.0 
  CPIJ019253 apyrase  0.2 9.3 42.8 
  CPIJ019268 calbindin-32  14.8 237.5 16.0 
  CPIJ019284 hypothetical protein  6.6 116.4 17.6 
  CPIJ019552 calbindin-32  9.1 198.1 21.8 
  CPIJ019905 hypothetical protein  10.5 886.2 84.7 
  CPIJ019944 hypothetical protein  9.5 132.9 14.0 
  CPIJ019945 hypothetical protein  6.9 101.9 14.7 
 Regulation CPIJ010170 conserved hypothetical protein  0.3 4.9 17.6 
  CPIJ010171 conserved hypothetical protein  0.1 1.3 15.5 
  CPIJ013451 zinc finger protein  0.2 6.2 26.8 
  CPIJ001084 low molecular weight protein-tyrosine-
phosphatase  
2.4 35.9 14.9 
  CPIJ010312 conserved hypothetical protein  20.2 224.9 11.1 
  CPIJ009440 cytoplasmic polyadenylation element 
binding protein  
0.1 4.7 32.5 
  CPIJ004145 predicted protein  1.5 18.8 12.8 
  CPIJ007193 period circadian protein  9.1 89.2 9.9 
266 
 
  CPIJ010788 conserved hypothetical protein  12.1 98.2 8.1 
  CPIJ014546 salivary short D7 protein 4  1.0 22.9 22.3 
  CPIJ014550 long form D7Bclu1 salivary protein  1.1 19.8 17.6 
  CPIJ014553 salivary long D7 protein 3  5.0 57.3 11.5 
  CPIJ015944 predicted protein  0.3 8.4 30.8 
 Extra-cellular 
processes 
CPIJ017322 conserved hypothetical protein  46.3 5.0 -9.2 
 General CPIJ011014 peptidylglycine alpha-amidating 
monooxygenase COOH-terminal 
interactor protein-1  
18.9 2.3 -8.3 
  CPIJ000841 dimeric dihydrodiol dehydrogenase  420.9 10.6 -39.7 
  CPIJ005895 conserved hypothetical protein  15.4 1.6 -9.4 
  CPIJ013724 dimethylaniline monooxygenase  117.3 0.6 -186.6 
  CPIJ017482 choline dehydrogenase  76.8 3.4 -22.7 
  CPIJ017483 glucose dehydrogenase  27.2 0.3 -96.4 
  CPIJ017487 glucose dehydrogenase  1.7 0.1 -23.8 
 Intra-cellular 
processes 
CPIJ008515 cellular retinaldehyde binding protein  190.2 17.4 -10.9 
  CPIJ008722 conserved hypothetical protein  90.2 9.4 -9.6 
  CPIJ003915 chymotrypsin 1  166.1 0.5 -348.2 
  CPIJ004215 conserved hypothetical protein  16.5 1.2 -13.6 
  CPIJ004659 trypsin 7  5.0 0.1 -57.6 
  CPIJ004660 trypsin 1  339.9 17.5 -19.4 
  CPIJ012643 conserved hypothetical protein  57.1 1.4 -39.5 
  CPIJ017794 220 kDa silk protein  13.8 1.4 -9.5 
  CPIJ019781 trypsin 1  20.4 0.4 -47.1 
  CPIJ011555 mitochondrial carrier protein  105.9 11.4 -9.3 
 Metabolism CPIJ002066 alpha-galactosidase A  23.8 1.6 -15.0 
  CPIJ010945 acidic mammalian chitinase  43.0 3.4 -12.7 
  CPIJ002725 lipase 1  58.4 0.9 -67.8 
  CPIJ004802 endothelial lipase  3.1 0.2 -15.9 
  CPIJ013029 esterase FE4  1.9 0.1 -16.2 
  CPIJ011840 cytochrome P450  33.6 0.9 -35.9 
  CPIJ011841 cytochrome P450  34.7 1.9 -17.8 
  CPIJ015954 cytochrome P450  14.8 1.6 -9.4 
  CPIJ015960 cytochrome P450 4A6  152.1 14.1 -10.8 
  CPIJ015961 cytochrome P450  37.0 2.5 -15.1 
  CPIJ017484 glucose dehydrogenase  26.2 0.4 -67.3 
 No Annotation CPIJ000499 hypothetical protein  10.5 0.3 -30.6 
  CPIJ001222 conserved hypothetical protein  252.2 2.0 -126.7 
  CPIJ001839 cuticle protein  54.4 1.0 -56.9 
  CPIJ002800 larval/pupal cuticle protein H1C  16.4 0.5 -31.9 
  CPIJ002801 larval/pupal cuticle protein H1C  9.3 0.5 -17.6 
  CPIJ003026 conserved hypothetical protein  13.6 0.2 -87.2 
  CPIJ004287 conserved hypothetical protein  22.5 2.6 -8.6 
  CPIJ004288 cuticle protein  8.8 0.7 -13.2 
  CPIJ004290 cuticle protein  249.6 7.6 -32.8 
  CPIJ004293 cuticle protein  88.7 2.8 -31.4 
  CPIJ004475 conserved hypothetical protein  210.1 5.1 -41.3 
  CPIJ005176 G12  11.3 0.3 -33.1 
  CPIJ006327 metalloproteinase  29.1 0.4 -65.9 
  CPIJ007055 SEC14  77.9 6.1 -12.9 
  CPIJ007056 conserved hypothetical protein  71.0 4.8 -14.8 
  CPIJ007448 conserved hypothetical protein  12.7 0.4 -28.8 
  CPIJ008211 conserved hypothetical protein  270.1 0.8 -323.1 
  CPIJ008231 pupal cuticle protein  123.2 4.3 -28.9 
267 
 
  CPIJ008286 serine protease  813.0 16.9 -48.2 
  CPIJ008659 metalloproteinase  15.8 0.2 -95.0 
  CPIJ008974 cuticle protein  28.6 0.9 -32.7 
  CPIJ009098 conserved hypothetical protein  1444.0 24.9 -58.1 
  CPIJ009099 conserved hypothetical protein  1853.0 57.2 -32.4 
  CPIJ009207 conserved hypothetical protein  19.9 0.3 -74.2 
  CPIJ009585 hypothetical protein  143.3 0.5 -265.3 
  CPIJ011001 sulfotransferase  5.0 0.3 -19.1 
  CPIJ012507 conserved hypothetical protein  104.1 2.0 -51.9 
  CPIJ013663 elongase  179.3 9.9 -18.1 
  CPIJ013764 cuticle protein 7  12.7 0.9 -14.9 
  CPIJ013765 cuticle protein 18.6  44.4 2.0 -22.5 
  CPIJ013931 conserved hypothetical protein  5.3 0.3 -16.0 
  CPIJ014435 hypothetical protein  89.0 0.7 -120.9 
  CPIJ014778 conserved hypothetical protein  39.4 3.0 -13.1 
  CPIJ015291 hypothetical protein  8.3 0.1 -66.9 
  CPIJ016716 conserved hypothetical protein  59.8 4.9 -12.2 
  CPIJ017020 hypothetical protein  30.9 0.1 -268.6 
  CPIJ017620 hypothetical protein  2100.1 8.7 -240.2 
  CPIJ017806 conserved hypothetical protein  31.1 2.2 -14.3 
  CPIJ017862 sulfotransferase  6.3 0.5 -12.8 
  CPIJ018582 pupal cuticle protein  140.8 5.0 -27.9 
  CPIJ018910 conserved hypothetical protein  64.9 5.7 -11.3 
  CPIJ019396 hypothetical protein  267.8 23.7 -11.3 
 Regulation CPIJ012716 odorant-binding protein  134.0 2.8 -48.2 
  CPIJ012719 general odorant-binding protein 56d  679.5 47.9 -14.2 
  CPIJ012721 odorant-binding protein  59.0 1.0 -57.7 
  CPIJ018956 general odorant-binding protein 56d  523.0 42.4 -12.3 
       
12 v 24h Extra-cellular 
processes 
CPIJ018858 fibrinogen and fibronectin  4.1 70.7 17.2 
  CPIJ002173 conserved hypothetical protein  6.2 60.0 9.6 
  CPIJ014105 galactose-specific C-type lectin  1.7 24.1 13.8 
 Information CPIJ017289 conserved hypothetical protein  0.0 3.5 N/C* 
 Intra-cellular 
processes 
CPIJ000214 serpin B10  9.2 122.6 13.3 
  CPIJ005273 trypsin 2  76.8 7233.8 94.2 
  CPIJ011998 zinc carboxypeptidase A 1  23.8 321.9 13.5 
  CPIJ014254 chymotrypsin BI  0.4 11.6 29.0 
  CPIJ015161 chymotrypsin 1  0.1 24.6 172.0 
  CPIJ015162 serine-type enodpeptidase  0.1 9.7 86.6 
  CPIJ017414 trypsin 4  19.6 368.2 18.8 
  CPIJ017964 trypsin 7  13.0 110.5 8.5 
 Metabolism CPIJ017575 low-density lipoprotein receptor  12.7 120.0 9.4 
  CPIJ002715 lipase 3  0.4 9.8 23.4 
  CPIJ001886 cytochrome P450 4C1  0.0 2.9 66.5 
  CPIJ006840 CD109 antigen  0.4 4.7 10.9 
 No Annotation CPIJ000529 conserved hypothetical protein  0.1 3.5 60.6 
  CPIJ000835 chymotrypsin-2  111.7 4177.6 37.4 
  CPIJ001237 conserved hypothetical protein  3.2 32.4 10.0 
  CPIJ004491 sodium/potassium/calcium exchanger 3  1.9 16.9 9.0 
  CPIJ005637 conserved hypothetical protein  0.0 0.1 0.0 
  CPIJ006087 sodium/solute symporter  1.3 15.1 11.9 
  CPIJ008023 olfactory receptor  0.1 3.9 35.5 
  CPIJ012164 conserved hypothetical protein  0.1 16.4 177.5 
  CPIJ014969 caldecrin  2.4 33.1 13.7 
268 
 
  CPIJ015718 arginase  2.1 18.6 9.0 
 Regulation CPIJ015936 hypothetical protein  0.7 6.9 10.4 
 Extra-cellular 
processes 
CPIJ011368 f-box/lrr protein  69.9 2.1 -32.9 
 Intra-cellular 
processes 
CPIJ000521 sodium-dependent phosphate 
transporter  
4.2 0.3 -12.5 
  CPIJ010466 laccase-like multicopper oxidase 1  6.8 0.6 -12.3 
  CPIJ016802 laccase-like multicopper oxidase 1  9.7 0.9 -10.4 
  CPIJ011997 zinc carboxypeptidase A 1  68.8 1.2 -56.8 
  CPIJ012680 ADAM 12  23.8 2.1 -11.2 
  CPIJ016937 coagulation factor X  37.5 3.8 -9.9 
 Metabolism CPIJ000679 conserved hypothetical protein  142.5 14.0 -10.1 
  CPIJ000680 conserved hypothetical protein  384.3 19.9 -19.3 
  CPIJ007603 conserved hypothetical protein  325.4 25.3 -12.8 
  CPIJ010945 acidic mammalian chitinase  3.4 0.3 -10.6 
  CPIJ012316 conserved hypothetical protein  30.6 3.6 -8.6 
  CPIJ005936 carbonic anhydrase II  9.9 0.2 -43.7 
  CPIJ006311 conserved hypothetical protein  56.7 6.3 -9.0 
  CPIJ011837 cytochrome P450  58.3 3.4 -17.0 
 No Annotation CPIJ000641 salivary asparagine-rich mucin  134.3 1.7 -79.1 
  CPIJ001605 pro-resilin  37.8 1.6 -23.2 
  CPIJ002016 conserved hypothetical protein  19.2 2.2 -8.9 
  CPIJ003019 conserved hypothetical protein  21.9 0.8 -27.8 
  CPIJ003030 adult cuticle protein  13.2 0.2 -57.7 
  CPIJ003473 cuticle protein  337.4 16.8 -20.1 
  CPIJ003474 cuticle protein  1824.0 129.9 -14.0 
  CPIJ005336 conserved hypothetical protein  23.8 1.7 -14.0 
  CPIJ006195 hypothetical protein  16.2 0.5 -33.3 
  CPIJ006794 conserved hypothetical protein  141.5 15.8 -9.0 
  CPIJ006796 conserved hypothetical protein  124.6 13.6 -9.2 
  CPIJ006797 conserved hypothetical protein  196.3 20.1 -9.8 
  CPIJ008231 pupal cuticle protein  4.3 0.3 -13.7 
  CPIJ008489 conserved hypothetical protein  65.9 6.4 -10.3 
  CPIJ009100 conserved hypothetical protein  586.3 21.4 -27.4 
  CPIJ009334 conserved hypothetical protein  113.3 2.3 -48.9 
  CPIJ010338 conserved hypothetical protein  684.0 55.7 -12.3 
  CPIJ010705 conserved hypothetical protein  32.8 2.2 -14.9 
  CPIJ012090 actin  373.3 24.4 -15.3 
  CPIJ012641 pupal cuticle protein  18.6 0.5 -34.8 
  CPIJ012973 conserved hypothetical protein  5.6 0.4 -15.1 
  CPIJ013278 conserved hypothetical protein  31.8 0.6 -52.8 
  CPIJ013783 pupal cuticle protein  31.9 1.7 -19.3 
  CPIJ013785 conserved hypothetical protein  828.9 2.6 -321.8 
  CPIJ015249 hypothetical protein  12.0 1.4 -8.4 
  CPIJ015250 hypothetical protein  61.0 5.3 -11.5 
  CPIJ016655 conserved hypothetical protein  733.3 45.9 -16.0 
  CPIJ016702 calbindin-32  223.0 22.7 -9.8 
  CPIJ016842 conserved hypothetical protein  16.4 1.2 -13.6 
  CPIJ017736 conserved hypothetical protein  184.0 16.8 -11.0 
  CPIJ017876 cuticle protein  306.8 13.5 -22.7 
  CPIJ019699 structural contituent of cuticle  145.7 11.3 -12.9 
  CPIJ019849 conserved hypothetical protein  13.9 1.5 -9.5 
  CPIJ019982 conserved hypothetical protein  10.7 0.9 -11.5 
 Regulation CPIJ000274 conserved hypothetical protein  28.1 1.8 -15.3 
  CPIJ011799 conserved hypothetical protein  15.7 1.7 -9.2 
       
269 
 
24 v 36h Extra-cellular 
processes 
CPIJ000931 conserved hypothetical protein  12.6 1.3 -9.7 
  CPIJ011371 f-box/lrr protein  23.1 1.8 -12.8 
 Information CPIJ017289 conserved hypothetical protein  3.5 0.0 0.0 
 Intra-cellular 
processes 
CPIJ000214 serpin B10  122.6 4.4 -27.9 
 No Annotation CPIJ003470 hypothetical protein  2549.0 37.8 -67.5 
  CPIJ003473 cuticle protein  16.8 0.5 -31.9 
  CPIJ003474 cuticle protein  129.9 2.4 -53.9 
  CPIJ003476 cuticle protein  1099.5 17.3 -63.7 
  CPIJ003477 cuticle protein  1043.6 16.9 -61.7 
  CPIJ009100 conserved hypothetical protein  21.4 1.7 -13.0 
  CPIJ009101 hypothetical protein  80.5 6.0 -13.4 
  CPIJ009111 conserved hypothetical protein  50.0 5.2 -9.6 
  CPIJ012090 actin  24.4 2.5 -9.8 
  CPIJ017874 hypothetical protein  490.3 9.7 -50.5 
  CPIJ017875 hypothetical protein  1222.8 30.2 -40.5 
  CPIJ018642 pupal cuticle protein  80.3 8.5 -9.4 
  CPIJ018939 oxidoreductase  0.1 0.0 0.0 
       
36 v 48h Metabolism CPIJ006495 conserved hypothetical protein  2.3 21.0 9.2 
 Intra-cellular 
processes 
CPIJ000990 cytosol aminopeptidase  6.6 0.1 -79.3 
  CPIJ002595 zinc carboxypeptidase  19.0 0.1 -170.8 
  CPIJ003539 cytosol aminopeptidase  6.2 0.0 -146.0 
 Metabolism CPIJ004028 venom allergen 3  14.2 0.4 -36.0 
 No Annotation CPIJ007077 trypsin-4  9.5 0.4 -26.2 
  CPIJ010092 ficolin-3  15.2 0.3 -44.5 
  CPIJ010778 conserved hypothetical protein  6.1 0.6 -10.5 
  CPIJ011171 LWamide neuropeptides  47.7 0.3 -178.1 
  CPIJ011620 conserved hypothetical protein  1.4 0.0 -63.2 
  CPIJ016384 conserved hypothetical protein  12.2 0.2 -56.0 
 Regulation CPIJ015944 predicted protein  18.2 0.3 -57.2 
       
48 v 60h Intra-cellular 
processes 
CPIJ000990 cytosol aminopeptidase  0.1 2.3 27.2 
  CPIJ002595 zinc carboxypeptidase  0.1 18.2 163.7 
  CPIJ003539 cytosol aminopeptidase  0.0 3.0 70.3 
 Metabolism CPIJ014185 conserved hypothetical protein  1.0 14.8 15.0 
  CPIJ004028 venom allergen 3  0.4 12.6 31.9 
 No Annotation CPIJ007077 trypsin-4  0.4 9.6 26.5 
  CPIJ010092 ficolin-3 0.3 9.0 26.5 
  CPIJ011171 LWamide neuropeptides  0.3 38.8 144.9 
  CPIJ016384 conserved hypothetical protein  0.2 15.0 68.8 
 Regulation CPIJ015944 predicted protein  0.3 7.7 24.1 
       
60 v 72h Intra-cellular 
processes 
CPIJ002595 zinc carboxypeptidase  18.2 2.2 -8.4 
 Metabolism CPIJ009796 lipoprotein lipase  5.0 0.4 -12.0 
 No Annotation CPIJ001231 conserved hypothetical protein 10.7 0.2 -53.7 
  CPIJ015506 hypothetical protein  60.2 3.0 -19.9 
  CPIJ016394 nuclear pore complex protein Nup93  0.4 0.0 -23.7 
?Structural Classification of Proteins (SCOP) database for the Culex quinquefasciatus database (v1.73). 
http://supfam.cs.bris.ac.uk/SUPERFAMILY/ 
?Vectorbase annotation for the Johannesburg strain of Cx. quniquefasciatus JHBv1.2. http://www.vectorbase.org/ 
*[Paired end] Fragments Per Kilo bases of gene length per Million RNA-Seq reads mapped. Time 1 and 2 represent 
270 
 
the earlier and later time points in the comparison, respectively. 
**N/C= Not calculable