IN VITRO AND IN VIVO COLD SHOCK RESPONSE IN VIBRIO VULNIFICUS 
 
 
 
 
 
Except where reference is made to the work of others, the work described in this 
dissertation is my own or was done in collaboration with my advisory committee.  
This dissertation does not include proprietary or classified information 
 
 
                             
Suttinee Limthammahisorn 
 
 
 
Certificate of Approval: 
 
 
 
Yolanda J. Brady, Co-Chair    Covadonga R. Arias, Co-Chair 
Associate Professor     Associate Professor  
Fisheries and Allied Aquacultures   Fisheries and Allied Aquacultures 
 
 
 
 
 
Richard K. Wallace     David LaDon Swann 
Professor      Associate Research Professor 
Fisheries and Allied Aquacultures   Fisheries and Allied Aquacultures 
     
 
 
 
 
Yifen Wang      Joe F. Pittman 
Assistant Professor     Interim Dean 
Biosystems Engineering    Graduate School 
   
IN VITRO AND IN VIVO COLD SHOCK RESPONSE IN VIBRIO VULNIFICUS 
 
 
Suttinee Limthammahisorn 
 
 
A Dissertation 
Submitted to 
the Graduate Faculty of 
Auburn University 
in Partial Fulfillment of the 
Requirement for the 
Degree of 
Doctor of Philosophy 
 
 
 
 
Auburn, Alabama 
August 4, 2007 
 
 
iii
IN VITRO AND IN VIVO COLD SHOCK RESPONSE IN VIBRIO VULNIFICUS 
 
Suttinee Limthammahisorn 
 
Permission is granted to Auburn University to make copies of this dissertation at its 
discretion, upon request of individuals or institutions and at their expense.  
The author reserves all publication rights. 
 
 
 
 
 
 
       Signature of Author 
 
 
 
 
  
       Date of Graduation 
 
 
 
 
 
 
 
 
 
 
iv
VITA 
 
Suttinee Limthammahisorn, daughter of Pravit and Pranee Sukaphatana, was born 
on December 19, 1964, in Chonburi, Thailand.  She graduated from Assumption College 
Sriracha High School, Chonburi, Thailand in 1983.  She attended Kasetsart University, 
Thailand and graduated with a Bachelor of Science degree majoring in Fisheries in 1988.  
She obtained a Master of Science degree in Environmental Technology Management 
from Mahidol University, Thailand in 1997.  She entered Graduate school in the 
Department of Fisheries and Allied Aquacultures at Auburn University in August 2003.  
She is a senior fishery biologist in Department of Fisheries, Thailand.  She married 
Somkiat Limthammahisorn on December 31, 1990.  They have one son, Meen (Max) 
Limthammahisorn.  
 
 
 
 
 
 
 
 
 
 
v
DISSERTATION ABSTRACT 
IN VITRO AND IN VIVO COLD SHOCK RESPONSE IN VIBRIO VULNIFICUS 
 
Suttinee Limthammahisorn 
Doctor of Philosophy, August 4, 2007 
(M.Sc., Mahidol University, 1997) 
(B.Sc., Kasetsart University, 1988) 
 
 
167 Typed Pages 
Directed by Yolanda J. Brady and Covadonga R. Arias 
 
 
 Vibrio vulnificus is a serious food-borne pathogen associated with the 
consumption of raw oysters.  The Interstate Shellfish Sanitation Conference (ISSC) 
recommends refrigeration of Gulf Coast oysters after harvesting to minimize pathogen 
risks.  Cooling temperature control of harvested oysters could potentially induce cold 
shock response in V. vulnificus.  In order to determine the potential for cold shock 
mediated survival of V. vulnificus, my research investigated in vitro and in vivo cold 
shock response in V. vulnificus regarding its growth and the molecular mechanisms 
underlying this phenomenon.   
 The effect of cold shock on V. vulnificus cultures was investigated under ISSC 
guidelines by the drop plate method.  V. vulnificus cultures were incubated at 35, 25, 20, 
and 15?C for 10 h, 12 h, 14 h, and 36 h, respectively, and then abruptly shifted to 7.2?C 
and 4?C for 168 h.  The mean counts of V. vulnificus after 7 day refrigeration at 7.2?C  
 
vi
was significantly greater (P<0.05) than at 4?C in all treatments.  Cold adaptation response 
enhanced cell culturability and was observed when cells were adapted to 15?C prior to 
cold shock at 7.2?C.  When V. vulnificus was artificially inoculated into oysters, its 
growth during cold shock was investigated using colony hybridization.  After oysters 
were kept at 35?C and 25?C for 10 h and 12 h, respectively, and abruptly shifted to 4?C, 
cells exhibited a moderate decline in culturability.  Oysters kept at 15?C prior to a 4?C 
shift for 168h, showed a slight decline in V. vulnificus cell numbers.  These findings 
suggested that incubation of V. vulnificus at 15?C could induce cold adaptation and 
should be avoided during post-harvest conditions. 
 Four cold shock genes (csp
s
) encoding small cold shock proteins in V. vulnificus 
were cloned.  Analysis of in vitro and in vivo cold shock gene expression was displayed 
by reverse transcriptase polymerase chain reaction (RT-PCR).  All csp
s
 tested in this 
study can not be considered cold shock inducible genes under in vitro condition, while 
some csp
s
 showed weak induction after cold shock under in vivo experiments.  Besides, 
the oxidative related genes (oxyR and katG) were induced during in vitro study, while 
these transcripts were not detected during in vivo experiment.  The transcript levels of 
16SrRNA and rpoS were constant throughout the study.  Overall, these results 
demonstrated that gene expression of V. vulnificus was different between in vitro and     
in vivo conditions during cold shock.   
 
 
 
 
 
vii
ACKNOWLEDGEMENTS 
 
 The author extremely grateful to Dr. David B. Rouse, Department Head of 
Fisheries and Allied Aquaculture and my major advisor Dr. Yolanda J. Brady for 
providing me an opportunity to pursue research and obtain a doctorate from this country. 
 I express my gratitude and obligation to my co-advisor, Dr. Covadonga R. Arias 
for her guidance and inspiring comments and suggestions throughout my research.  I am 
grateful for time and expertise offered by my committee members, Dr. Richard K. 
Wallace, Dr. LaDon Swann, and Dr. Yifen Wang. 
 I thank Karl J. Hayden and Briana Keaffer for their technical support in the Fish 
Health Laboratory.  I greatly appreciate the assistance and support from Scott Rikards 
and the staff of AU Shellfish Lab at Dauphin Island during the depuration of oysters.  I 
would like to thank the administration staff in the Department of Fisheries and Allied 
Aquacultures for their help and support.  The friendship and encouragement extended to 
me by the graduate students in the department is also gratefully acknowledged.  
 Most of all, I acknowledge the love of my son.  He has been the motivating force 
pushing me forward to obtain the degree.  My special thanks and deep appreciation go to 
my husband for his patience, unwavering support, encouragement and sacrifice during 
these years. 
 
 
 
viii
Style manual or journal used: Applied and Environmental Microbiology 
 
Computer software used:  Window XP, Microsoft Word 2003, Microsoft Excel 2003 
Adobe Photoshop 7.0, Vector NTI Advance 9.0 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
ix
TABLE OF CONTENTS 
LIST OF TABLES??????????????????????????.....xi 
LIST OF FIGURES??????????????????????????...xii 
I. INTRODUCTION???????????????????????.1 
II. LITERATURE REVIEW???????????????????......5  
III. COLD SHOCK EFFECT ON GROWTH RATE AND SURVIVAL  
       OF VIBRIO VULNIFICUS IN CULTURE BROTH UNDER 
            SHELLSTOCK TEMPERATURE CONTROL CONDITIONS ?????28 
  Abstract 
  Introduction 
  Materials and methods 
  Results 
  Discussion  
IV. EFFECT OF COLDSHOCKING ON SURVIVAL OF  
       VIBRIO VULNIFICUS IN SHELLSTOCK OYSTERS??????..........48 
  Abstract 
  Introduction 
  Materials and methods 
  Results 
  Discussion 
V. IN VITRO COLD SHOCK GENE EXPRESSION OF  
       VIBRIO VULNIFICUS?????????????????????.65 
  Abstract 
  Introduction 
  Materials and methods 
  Results 
  Discussion 
VI. IN VIVO COLD SHOCK GENE EXPRESSION OF  
       VIBRIO VULNIFICUS?????????????????????.94 
  Abstract 
  Introduction 
  Materials and methods 
  Results 
  Discussion  
 
x
VII. CONCLUSIONS??????????????????????...113 
CUMULATIVE BIBLIOGRAPHY??????????????????..117 
APPENDICES???????????????????????...............143 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
xi
LIST OF TABLES 
1. Computed theoretical pI and M
w
 values of cold shock proteins  
 encoded by putative cold shock genes of V. vulnificus??????????.86 
2. Primers design for cold shock genes of V. vulnificus? ?????????...87 
3. Primers used for RT-PCR of cold shock genes and stress-related    
 genes for the in vitro study?????????????????................88 
4. Primers used for RT-PCR of cold shock genes and stress-related  
 genes for the in vivo study????????????????????...108 
 
  
 
 
  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
xii
LIST OF FIGURES 
1. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 35?C????????????????????????????...41 
2. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 25?C????????????????????????????...41 
3. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 20?C????????????????????????????...42 
4. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 15?C????????????????????????????...42 
5. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 7.2?C??????????????????????????..........43 
6. Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4  
 at 4?C?????????????????????????????.43 
7. Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 35?C  
 for 10 h and cold shocked at 7.2?C for 168 h??????????????44 
8. Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 25?C  
 for 12 h and cold shocked at 7.2?C for 168 h??????????????44 
9. Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 20?C  
 for 14 h and cold shocked at 7.2?C for 168 h??????????????45 
10. Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 15?C  
 for 36 h and cold shocked at 7.2?C for 168 h??????????????45 
 
 
xiii
11.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 35?C  
 for 10 h and cold shocked at 4?C for 168 h??????????????...46 
12.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 25?C  
 for 12 h and cold shocked at 4?C for 168 h??????????????...46 
13.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 20?C  
 for 14 h and cold shocked at 4?C for 168 h??????????????...47 
14.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in MB when cells were incubated at 15?C  
 for 36 h and cold shocked at 4?C for 168 h??????????????...47 
15.       Total heterotrophic bacteria, total Vibrio, and V. vulnificus  
 (CFU/g oyster meat) during depuration of eastern oysters  
 (Crassostrea virginica)??????????????????????..62 
16.       pH of oyster meat during cold shock experiment????????????..62 
17.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in oysters when oysters were incubated  
 at 35?C for 10 h and cold shocked at 4?C for 168 h???????????..63 
18.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in oysters when oysters were incubated  
 at 25?C for 12 h and cold shocked at 4?C for 168 h???????????..63 
19.       Cold shock-survival response of V. vulnificus strain ATCC 27562,  
 C7184Tr, VV3, and VV4 in oysters when oysters were incubated  
 at 15?C for 36 h and cold shocked at 4?C for 168 h???????????..64 
20.       Vibrio vulnificus gene expression profiles: internal control: 16SrRNA,  
 and cold shock genes: csp1, csp3, csp4, and csp5 during cells were  
 cold shocked from 35?C
10 h
 to 4?C
168 h
????????????????..89 
21.       Vibrio vulnificus gene expression profiles: stress related genes: rpoS, oxyR,  
 and katG during cells were cold shocked from 35?C
10 h
 to 4?C
168 h
?????..90 
 
 
xiv
22.      Vibrio vulnificus gene expression profiles: internal control: 16SrRNA,  
 and cold shock genes: csp1 and csp3 during cells were cold shocked  
 from 35?C
10 h
 to 15?C
36 h
 and from 15?C
36 h
 to 4?C
168 h
??????????.91 
23.       Vibrio vulnificus gene expression profiles: cold shock genes: csp4 and  
 csp5 during cells were cold shocked from 35?C
10 h
 to 15?C
36 h
 and from 
  15?C
36 h
 to 4?C
168 h
??????????????????????.........92 
24.       Vibrio vulnificus gene expression profiles: stress-related genes: rpoS,  
 oxyR, and katG during cells were cold shocked from 35?C
10 h
 to 15?C
36 h
  
 and from 15?C
36 h
 to 4?C
168 h
??????????????????..........93 
25.       Vibrio vulnificus gene expression profiles: internal control: 16SrRNA,  
 and cold shock genes: csp1, csp3, csp4, and csp5 during oysters  
 were cold shocked from 35?C
10 h
 to 4?C
168 h
??????????????109 
26.       Vibrio vulnificus gene expression profiles: stress related gene: oxyR, katG,  
 and rpoS during oysters were cold shocked from 35?C
10 h
 to 4?C
168 h
????.110 
27.       Vibrio vulnificus gene expression profiles: internal control: 16SrRNA, and  
 cold shock genes: csp1, csp3, csp4, and csp5 during oysters were cold  
 shocked from 25?C
overnight
 to 15?C
36 h
 and from 15?C
36 h
 to 4?C
168 h?
????.111 
28.       Vibrio vulnificus gene expression profiles: stress-related genes: oxyR,  
 katG, and rpoS during oysters were cold shocked from 25?C
overnight
  
 to 15?C
36 h
 and from 15?C
36 h
 to 4?C
168 h
???????????????..112 
 
 1
I. INTRODUCTION 
 
2
 Vibrio vulnificus is a Gram-negative, ubiquitous, estuarine bacterium that is 
abundant in water, sediments, mollusks, crustaceans, and finfish along the U.S. Gulf 
Coast (38, 170).  Vibrio vulnificus has been blamed for the reduced prices and consumer 
demand for oysters (Crassostrea virginica), especially Gulf Coast oysters, because of 
negative publicity associated with health risks.  Oysters have served as vectors in the 
transfer of this indigenous estuarine pathogen to humans (38).  Every year millions of 
Americans consume raw oysters.  For some people, ingestion of raw or undercooked 
oysters containing this bacterium can cause serious illness and even death.  This pathogen 
may cause severe wound infection and primary septicemia (99).  Nearly all fatal primary 
septicemia cases are associated with the consumption of raw oysters.  The United States 
Food and Drug Administration (USFDA), the Centers for Disease Control and Prevention 
(CDC), the Interstate Shellfish Sanitation Conference (ISSC), and the oyster industry 
faced with a major challenge in managing public health risk of V. vulnificus.  In 2001, the 
ISSC proposed the ?Vibrio vulnificus Risk Management Plan?, and set a goal for 
reduction of illnesses caused by the consumption of commercially harvested raw or 
undercooked oysters by at least 60% by the year 2007 and 2008 (44).  The ISSC 
recommended that post-harvest treated consumable oysters must contain less than 30 
colony forming units of V. vulnificus per gram of oyster meat (45). Typically, the 
concentration of V. vulnificus at consumption is influenced by ambient air temperature 
during harvest, the time from harvest until the oysters are placed under refrigeration, the 
time it takes the oyster to cool down under refrigeration, and the length of refrigeration 
time until consumption (183). Potential infection by this bacterium could be reduced by 
limiting time from harvest to refrigeration in at-risk-harvesting areas and by using proper 
 
3
refrigeration temperatures.  In one effort to achieve the ISSC goal, restrictive shellstock 
temperature control measures have been recommended by FDA/ISSC and implemented 
by the industry.  This control limits the time from harvesting of oysters to refrigeration.  
The length of time depends upon the average monthly maximum water temperature at the 
time of harvest.  Once placed under temperature control, shellstock shall be maintained at 
10?C or below throughout processing, distribution and storage (45). 
 However, many bacteria, especially food-borne pathogens have been reported to 
manifest their tolerance to cold temperatures by altering their cellular protein profiles and 
continuing to grow (6, 36, 55, 75, 90).  This physiological response of living cells to 
temperature downshift is referred to as cold shock response (52).  The cooling strategy 
recommended by ISSC may potentially cause a cold shock response in V. vulnificus 
inhabitating oysters.  To date, cold shock response in V. vulnificus has not been fully 
elucidated although this pathogen greatly impacts oyster industry and public health.  The 
impact of cold shock response on the physiology of this pathogenic microorganism in 
oysters under typical industry practices from harvest to consumption, particularly in 
regard to their survival, needs to be further investigated.   
 Although a wide array of experimental data addressed the role of cold shock 
response in many bacteria, no clear indication on the molecular mechanisms underlying 
this phenomenon has been proposed in V. vulnificus so far.  Only two reports have 
investigated a V. vulnificus response mechanism to cold temperature.  In 1995, 
McGovern and Oliver (110) showed that when V. vulnificus is subjected to a moderate 
temperature downshift from 23 to 13?C, protein synthesis declines but new cold-induced 
proteins are expressed.  In 1999, Bryan et al. (17) reported that a brief cold adaptation 
 
4
period for 3 h at 15?C enhanced survival of V. vulnificus at 6?C.  They concluded that 
cold adaptive protective proteins might enhance survival and tolerance at cold 
temperature.  Moreover, cold shock has been shown to alter gene expression in bacterial 
cells in order to compensate for this cold stress.  Little is known about V. vulnificus gene 
expression in response to cold shock.  While several reports have investigated in vitro 
and in situ gene expression of V. vulnificus during temperature downshift in the ?viable 
but non-culturable? (VBNC) state (46, 160, 161), in vivo gene expression of this 
pathogen has not yet been reported in response to the cold or any other situation.  Since 
oysters can act as reservoirs for V. vulnificus, it is crucial to study the cold shock gene 
expression while this pathogen is embedded in oysters.  This scientific knowledge from 
in vitro and in vivo studies of cold shock response of V. vulnificus under USFDA/ISSC 
shellstock temperature control guidelines will assist in the development of an effective 
risk reduction strategy for V. vulnificus septicemia associated with the consumption of 
raw oysters. 
 
 
 
5
II. LITERATURE REVIEW 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
6
Overview  
 
 Raw oysters have the potential to cause human disease because they serve as 
vectors for viral, bacterial and parasitic pathogens (156).  The greatest numbers of 
seafood-associated illnesses are from the consumption of contaminated raw shellfish 
(such as mussels, oysters, clams) as a result of their filter feeding habit that concentrate 
particles present in the surrounding waters.  Two general groups of pathogenic bacteria 
may be present in coastal sea water and may be entrapped by shellfish: the first group 
consists of nonindigenous bacterial pathogens that enter the water from animals and 
humans, the latter includes indigenous bacteria in the marine environment, mainly 
members of the family Vibrionaceae (148).  Typically, bacterial pathogens associated 
with fecal contamination have represented only 4% of the shellfish associated outbreaks, 
while naturally-occurring bacteria accounted for 20% of shellfish-associated illnesses and 
99% of the deaths.  Most of these indigenous bacteria fall into the family Vibrionaceae 
which includes the genus Vibrio (101).  The Vibrio genus comprises more than 30 
species, some of them being pathogenic to human and had been associated with food-
borne related diseases (22). 
 
 
 
7
1.  Vibrio vulnificus 
 
 Vibrio vulnificus is recognized as the most invasive and rapidly lethal Vibrio and 
is the leading cause of reported seafood-related deaths in the United States (11).  It 
accounts for 95% of seafood related deaths in the U.S.  It is an opportunistic human 
pathogen that can cause gastroenteritis, septicemia, and wound infections in humans.  
Typically, V. vulnificus infections are associated with the consumption of raw oysters and 
can produce rapidly fatal septicemia in individuals (151).  In humans, V. vulnificus is 
associated with two disease patterns, primary septicemia and wound infection.  The major 
pattern of infection is a rapidly progressing septicemia.  Septicemia caused by this 
pathogen occur in individuals with chronic liver disease shortly after eating raw oyster to 
several days of infection, with a fatality rate of over 60%.  In immunocompromised hosts, 
V. vulnificus infection can cause high fever, nausea, myalgia, and abdominal cramps 24 
to 48 hours after eating contaminated food.  Because the organism can cross the intestinal 
mucosa rapidly, sepsis and cutaneous bullae can occur within 36 hours of the initial onset 
of symptoms.  Cases are most commonly reported during warm weather months (April-
November) and often are associated with eating raw oysters.  Progression of the illness 
can be very rapid from asymptomatic to death within 24 hours.  
 About 75% of patients with Vibrio septicemia have pre-existing hepatic diseases.  
Wound infections with V. vulnificus usually develop after trauma and exposure to the 
marine environment by handling seafood products and progress rapidly.  Wound 
infections most commonly present cellulites, and the fatality rate can be up to 25%.  
About one-third of patients with wound infections have some underlying disease.  
 
8
However, infections that occur through wounds are not limited to immunocompromised 
individuals.  The etiological role of V. vulnificus in gastroenteritis has not been proven.  
An indole-negative biogroup of this Vibrio, which is pathogenic to eels, has also been 
associated with human infections (99). 
 
Characteristics of Vibrio vulnificus 
 
Vibrio vulnificus is a Gram-negative, oxidase-positive, obligately halophilic, 
motile, curved bacillus with a single polar flagellum.  It belongs to the family 
Vibrionaceae, and is distinguished from other members of the Vibrio genus by its ability 
to ferment lactose.  Vibrio vulnificus can grow in NaCl with concentration as high as 5% 
and does not require Mg
+2
 or K
+
 for its growth.  Consequently, it can easily be cultured in 
a variety of media.  Vibrio vulnificus was first isolated in 1964 by the U.S. Centers for 
Disease control (CDC), although at that time it was mis-identified as a virulent strain of 
V. parahaemolyticus (165).  It was finally recognized as a distinct species in 1976 after 
researchers realized that many clinical cases of foodborne septicemias and wound 
infections were caused by a pathogen with unique characteristics from other Vibrio 
species.  The name ? vibrio? meaning ?to quiver?, and the word ?vulnificus? is derived 
from Latin word ?vulnus? meaning ?wound? and was given its official taxonomic status 
in 1980 (116).  
Vibrio vulnificus has been classified based on biotypes, lipopolysaccharide (LPS) 
antigens, capsule, and most recently genetic sequences.  There are three biotypes of       
V. vulnificus according to their different biochemical and biological properties.  Biotype 1 
 
9
is ubiquitous in estuarine environments, is an opportunistic human pathogen, produces 
indole and ornithine decarboxylase, and exhibits several immunologically distinct 
lipopolysaccharide (LPS) types (66, 100).  Biotype 2 is primarily related with eels but can 
be pathogenic to humans, is characterized by a homogeneous lipopolysaccharide (LPS), 
and is negative for indole production and ornithine decarboxylase (3, 10).  A third group, 
biotype 3, was recently identified and causes wound infections and bacteremia in humans 
handling St. Peter?s fish (Tilapia spp.) in Israel (12). 
 
Geographical range distribution and environmental conditions 
 
 The presence of V. vulnificus is not associated with pollution.  It is normally 
found in estuarine environments, flourishes in warm temperatures. It is part of the 
bacterial flora of the marine environment, and is distributed worldwide (175).          
Vibrio vulnificus has been isolated from waters of widely varying temperatures and 
salinities (187).  Several studies along the Gulf of Mexico and the east and west coasts of 
the United States have shown strong relationships between salinity, water temperature, 
and the isolation of V. vulnificus (38, 125, 133, 134, 169).  Prevalence of V. vulnificus in 
the marine ecosystem is correlated with seasonality since water temperature plays a 
significant role in controlling the densities of this bacterium.  Vibrio vulnificus has been 
recovered from waters with a range of temperatures from 9?C to 31?C, but has seldom 
been recovered from cold waters and has frequently been found in high concentrations in 
shellfish and surface water during the summer, April to September, when water 
temperatures were above 25?C.  In fact, V. vulnificus optimal temperature growth is 
 
10
35?C, and like all human pathogens can also grow at 37?C.  However, this bacterium has 
never been responsible for human infections in that area where summer temperatures are 
optimal for its growth (117).  Under suboptimal temperatures the number of V. vulnificus 
increases during 6 days incubation at 13?C to 22?C, but V .vulnificus survives poorly at 
less than 8.5?C (85).  Pfeffer et al. (145) reported that water temperature accounted for 
most of the variability in the concentration of V .vulnificus, and that low water 
temperatures (<10?C) have a negative effect for its isolation.  There have been several 
theories to explain the seasonality observed in V. vulnificus isolation.  One possible 
reason that might explain why V. vulnificus is difficult to culture during cold-water 
months is that this bacterium can enter a viable but nonculturable state known as VBNC.  
It has been proven that V. vulnificus enters a VBNC state at temperatures below 10?C 
under low nutrient conditions (126).  
 Typically, U.S. Gulf Coast oysters harbor about 10
3
 to 10
4
 V. vulnificus cells g
-1
 
during the warmer months from April through October but typically less than 10 cells g
-1
 
during colder months (32, 171).  Illnesses caused by V. vulnificus have been reported 
every year, primarily along the Gulf of Mexico in the U.S. during the summer months.  
In general, the relationship between salinity and V. vulnificus presence is not as evident as 
between temperature and prevalence.  It has been isolated from waters with a wide range 
of salinities from 1 to 34 parts per thousand (ppt) although estuarine waters with salinities 
between 6 and 16 ppt are considered optimal for V. vulnificus populations.  Salinities 
greater than 25 ppt have been shown to adversely affect survival of this bacterium under 
laboratory conditions.  However, V. vulnificus has been isolated from Mediterranean 
waters and shellfish with salinities around 35 ppt.  
 
11
Isolation and identification methods for Vibrio vulnificus  
 
 Several isolation and identification techniques have been developed to distinguish 
V. vulnificus from other vibrios.  Thiosulfate citrate bile salts sucrose (TCBS) agar was 
originally used for isolation of pathogenic vibrios and became widely used for the 
isolation of Vibrio spp. from environmental samples.  This medium differentiates           
V. cholerae from V. parahaemolyticus and V. vulnificus on the basis of sucrose 
fermentation (85, 153).  Sodium dodoecyl sulfate-polymyxin B-sucrose agar (SPS) was 
used to separate V. vulnificus from V. parahaemolyticus, which are both negative for 
sucrose fermentation and had similar morphology on TCBS (92).  Many selective and 
differential media have been developed for V. vulnificus isolation including V. vulnificus 
(VV) agar (15), cellobiose-polymyxin B colistin (CPC) agar (107), modified CPC 
(mCPC) agar (171), V. vulnificus enumeration (VVE) agar (112), V. vulnificus agar 
(VVA) (188), cellobiose-colistin (CC) agar (65), V. vulnificus medium (VVM) (20), 
modified VVM (VVMc) agar (21).  Confirmation assays for V. vulnificus include 
biochemical or physiological tests, immunological assays, DNA probes, and PCR 
analysis (60).  For V. vulnificus enumeration in oysters, USFDA recommended two 
approaches.  One uses a most probable number (MPN) enrichment step coupled with 
biochemical or molecular confirmation.  The second performs a direct isolation on 
selective media followed by colony hybridization with a DNA probe (VVAP) (82).  The 
VVAP probe method has been widely used for molecular confirmation of V. vulnificus 
(21, 65).  A quantitative PCR or real-time PCR assay is now available for V. vulnificus 
detection (18, 138).  However, this method does not discriminate live from dead cells.  
 
12
Reverse transcription PCR is an alternative method that can be used to detect RNA from 
viable but nonculturable (VBNC) cells of V. vulnificus since only live cells yield a 
positive result (46). 
 
Methods by reducing Vibrio vulnificus in oysters  
 
 In order to reduce the number of unwanted V. vulnificus cells to acceptable levels 
for human consumption, several studies have been investigating methods that will 
eliminate this pathogen.  One of the most common methods in controlling pathogen 
proliferation in oysters is cold temperatures (30, 31, 129, 170).  However these studies 
have shown that cold storage cannot eliminate this bacterium to safe levels for 
consumption.  Thoroughly cooking the oysters then storing them under either hot (60?C 
or higher) or cold (4?C or lower) conditions completely eliminates the bacteria, but this 
methodology is unfit for the half-shell market (64).  Ionized or gamma irradiation (69, 
73) is effective at eliminating Vibrio but this process requires an expensive facility and is 
not yet federally approved.  The use of additives such as organic acids (Generally 
Recognized as Safe, GRAS) (166, 167), butylated hydroxyanisole (BHA), or diacetyl 
(11), although effective in reducing Vibrio contamination, produce unacceptable flavor 
changes.  The use of hot sauce (168) was not successful in reducing numbers of this 
bacterium.  Depuration has been proved to be effective in removing indicator bacteria but 
it is ineffective in reducing the numbers of this pathogen.  In addition, some bacteria may 
persist and even multiply during depuration (86, 170).  Exposing oysters to high-salinity 
(30 to 34 ppt) environments seemed an effective method to eliminate V. vulnificus in 
 
13
oysters; however, this method requires a period of time of more than one month (117).  
Rapid chilling by ice immersion at 7.2?C (149) has been shown to reduce V. vulnificus, 
but not to recommended limits.  Recently, electrolyzed oxidizing water (150) was found 
to be effective in eliminating this bacteria in oysters, but this method directly increased 
the mortality of oysters. 
To date, most efforts to reduce Vibrio contamination in live oysters have not been 
successful.  Post-harvest treatments have been recommended in order to reduce              
V. vulnificus numbers in oysters.  Currently, several effective post-harvest treatments 
have been used commercially and approved by the Food and Drug Administration.  These 
methods include high hydrostatic pressure (9), low-temperature pasteurization (5), and 
individual quick freezing (63).  These treatments; however, required the use of 
specialized equipment, which increases the cost of the post harvest process.   
 
2. The United States Oyster industry   
 
Oyster industry profile 
 
Two major species of oysters are produced in the U.S.: Crassostrea virginica 
(Atlantic oyster or Eastern oyster) and the non-native Crassostrea gigas (Pacific oyster).  
The amount of eastern oysters accounts for roughly 75 percent of total U.S. harvests.  The 
U.S. annual yields of eastern oysters were 10,112 metric tons in year 2005 (121).  Oysters 
are typically produced in three different ways: natural, managed and cultivated.  Natural 
oysters grow and reproduce without human intervention and are available for harvest by 
 
14
anyone with the appropriate licenses and permits.  In contrast, managed natural oysters 
are supervised by harvesters who scrape the oyster bed periodically to reduce clustering.  
In the case of cultivated oysters, immature oysters are transported to man-made beds 
where they are allowed to mature.  In the Northwest and Northeast of the U.S., a 
significant amount of shellstock oysters are produced on cultivated beds, whereas in the 
Gulf waters historically, they have been primarily harvested from wild reefs (119). 
All oyster dealers in the U.S. must be certified under the National Shellfish 
Sanitation Program (NSSP) in order to market oyster products in interstate commerce.  
Processing plants that ship oysters are certified as interstate or intrastate shippers.  
Interstate certified shippers may ship oysters across state lines, whereas intrastate 
certified shippers may ship oysters only within their state borders.  Interstate shippers are 
inspected and certified by individual states, which later provide the list to the USFDA.  
The USFDA uses this information to publish the Interstate Certified Shellfish Shippers 
List.  Intrastate shippers are also inspected and certified by individual states, but those 
states manage their own lists.  State agencies involved in certification include the 
departments of health, marine resources, agriculture, national resources, and wildlife and 
fisheries (119).  The FDA carefully monitors oysters from their growing waters through 
processing plants, and finally to retail outlets.  The NSSP maintains a Manual of 
Operations, which is routinely revised by the Interstate Shellfish Sanitation Conference 
(ISSC), a voluntary group composed of members from FDA, state health regulatory 
agencies and industry (105). 
Generally, there are four main sectors in the oyster industry; harvesters, 
wholesalers, processors, and retailers.  Oyster harvesting includes wild and cultivated 
 
15
oysters.  Harvested oysters are generally delivered to wholesalers and processors, and in 
some cases, they are directly delivered to restaurants or other retail outlets.  They are 
generally sold in dozens, by the bushel bag, or in bushel-fraction boxes (105).  Processors 
normally sell their products as fresh, raw, shucked, processed halfshell, smoked, cooked, 
canned, and breaded oysters.  Oysters generally reach consumers as live in the shell, 
fresh, frozen, or as canned products.  Shucked oyster meats are graded and sold according 
to size in 8 ounce (226 g) and 12 ounce (342 g) cup, or in pint (0.55L), quart (1.1 L), or 
gallon (3.78 L) containers (144).  Oyster harvesting is done by handpicking, tonging, and 
dredging from oyster boats.  Oysters are harvested throughout the year; but the meat yield 
differs between seasons (104). 
United States per capita oyster consumption was 0.11 kg in the year 2003.  
Consumers judge the quality of the raw half-shell oysters based on organoleptic 
characteristics including appearance (size, shape, color), odor, flavor (sweetness and 
saltiness), and texture (firmness).  Consumers prefer cup-shaped oysters where the meat 
fills the shell.  Color is less important to consumers, but unpleasant odors are regarded as 
an indication of spoilage.  The public prefers fresh oysters that are mild and salty in 
flavor, have no off-flavor, and are tender (not mushy) in texture (26, 105).  Individuals 
generally consume cooked oysters at home and both raw and cooked oysters in 
restaurants.  Demand for in-shell oysters is assumed to be high during the summer travel 
and vacation season; whereas demand for shucked oysters peaks during the winter 
holiday season (4). 
The U.S. imported approximately 10.48 million kilograms of farmed and wild 
oysters during 2004.  The value of imports during that period was $ 47 million.  South 
 
16
Korea is the major exporter of oysters to the U.S., accounting for 53.6% of total U.S. 
oyster imports in 2006.  The U.S. imports oysters in live, fresh, frozen, dried, salted, 
brine, canned smoked and canned forms.  On the other hand, in 2004, the U.S. exported 
approximately 3.4 million kilograms of oysters overseas.  France was the major importer 
of oysters accounting for 24  percent of total U.S. exports (105, 122).  
 
Current regulation strategies for post-harvest oysters  
 
In the U.S., the Interstate Shellfish Sanitation Conference (ISSC), a voluntary, 
cooperative association of states, U.S. Food and Drug Administration (FDA), National 
Marine Fisheries Service (NMFS), Environmental Protection Agency (EPA), and 
shellfish industry, adopted guidance to be incorporated in the National Shellfish 
Sanitation Program (NSSP) that requires states, which produce shellfish reported to 
harbor V. vulnificus, to develop ?Vibrio vulnificus Risk Management Plans?.  The goal of 
this strategy is to reduce the rate of etiologically confirmed shellfish-borne V. vulnificus 
septicemia illnesses from the consumption of commercially harvested raw or 
undercooked oysters by at least 60 percent at the end of year 2008 (44).  The core 
reporting states include Florida, Texas, Louisiana, and California (the biggest oyster 
importer).  Additionally, in order to minimize the risk from this pathogen, ISSC adopted 
a ? NSSP Guide for the Control of Molluscan Shellfish 2005?.  Under the section of 
?Control of shellfish harvesting? the time from harvesting to refrigeration is limited.  The 
length of time depends upon the average monthly maximum water temperature 
(AMMWT) at the time of harvest.  These controls set the maximum time interval from 
 
17
harvest to refrigeration at 36 h when AMMWT in the harvest area is less than 18?C, 14 h 
when AMMWT is 18?C to 23?C, 12 h when AMMWT is 23?C to 28?C, and 10 h when 
AMMWT exceeds 28?C.  Once placed under temperature control, shellstock shall be 
continuously maintained at 10?C or below until final sale to the consumer. This guideline 
suggests that consumable oysters should not contain more than 30 MPN of V. vulnificus 
per gram of oyster meat (45).   
Currently, the USFDA and ISSC have approved the use of post-harvest treatments 
which was implemented by 2006 (Interstate Shellfish Sanitation Commission Model 
Ordinance 03-121) (60). 
 
3. Cold shock response in bacteria 
 
The cold shock response is a physiological response of living cells to temperature 
downshift.  In terms of thermal stress, cold shock stress (temperature down shift) is 
poorly understood compared with heat shock.  Most of the cold shock response studies 
have been performed with Escherichia coli and Bacillus subtilis as model system (51).  
Microbial response to low temperature involves changes in cellular physiology 
that have been documented as survival strategy in other species.  Several cold shock 
proteins have been identified not only in E. coli but also in many other bacteria, including 
mesophilic, psychrophilic, and psychrotrophic bacteria such as Bacillus subtilis (55), 
Enterococcus faecalis (139), and Lactococcus lactis (90, 140), Lactococcus lactis subs. 
lactis, Lactobacillus helveticus, Streptococcus thermophilus, Pediococcus pentosaceus 
(89), Pseudomonas fragi (61, 113, 114), Arthrobacter globiformis (7, 8), Bacillus 
 
18
psychrophilus (184), Listeria monocytogenes (6, 147), Pseudomonas putida (59), 
Salmonella typhimurium (35), Salmonella enteritidis (75), Aeromonas hydrophila (71), 
Vibrio vulnificus (110), Vibrio cholerae (36), Sinorhizobium meliloti (123, 124), 
Rhizobium (28), and Aquaspirillum articum (152).   
Because temperature has wide-ranging effects on growth and survival, bacteria 
have developed responses that allow them to adapt to change in temperature.  The 
evolution of cold shock genes is one those adaptive mechanisms.  Many species of 
bacteria have been shown to alter gene expression in response to a shift to low 
temperatures (6, 7, 55, 80, 109, 140).  Since cold has a rate-depressing effect on almost 
all aspects of physiological performance, an increase in mRNA transcripts may not 
necessarily correspond to increased levels of the translated protein.  Increases in mRNA 
may simply reflect changes in mRNA turnover parameters with cooling.  These changes 
should not be associated with cold-shock gene induction. 
In general, bacterial cells must cope with several recognized problems that arise 
following cold shock: a) membrane fluidity is too low, b) superhelical density of the 
DNA is too high for opening out the double helix, c) enzyme activities decrease 
profoundly, but probably to different extents, therefore protein levels must be adjusted,  
d) protein folding may be too low or inefficient, e) ribosomes must be adapted to function 
property at low temperatures, and f) secondary structures in RNA might affect initiation 
of translation (54, 78, 140).  A decrease in membrane fluidity can be overcome by 
increasing an unsaturated fatty acid and di-unsaturated phospholipids in membrane.  Cold 
shock proteins are transiently induced to overcome the translational block (72).  
Lowering the temperature, especially down to 1-8?C, brings up alterations in translational 
 
19
processes, including the dissociation of polysomes and the accumulation of whole 
ribosomes and their subunits.  It should be noted that cold shock suppresses protein 
synthesis just at the stage of initiation of RNA translation.  Once the synthesis of a 
polypeptide chain has started, its elongation will continue irrespective of the cold shock 
conditions (54, 78). 
 Cold shock proteins have been classified based on level of increased expression 
after a temperature downshift.  Class I Csps, which are at low level of expression at 37?C, 
increased synthesis in more than 10-fold in response to cold shock, whereas class II Csps 
are present at 37?C and increase modestly upon cold shock.  However, the majority of 
class I and II Csps that have been described are chaperones involved in enabling 
ribosomes to translate mRNAs at low temperatures (173).  
Cold shock synthesis of Csps seems to be regulated mainly at the                    
post-transcriptional level.  Individual mRNA for each Csp seems to play a main role in 
cold shock response.  It is believed that the cold shock response serves as an adaptive 
mechanism, and it has been suggested that proteins of the CspA family, together with 
other Csps, play a role in protecting cells from damage due to the cold.  Most of the free 
living bacteria possess at least one cold shock-inducible CspA homologue, which likely 
functions as an RNA chaperone (77).  
In E. coli, when culture temperature of exponentially growing cells is shifted from 
37 to 10?C, a lag phase is observed before growth is reinitiated (80).  Similar to the heat 
shock response, to compensate for this stress, E. coli reacts to temperature downshifts by 
inducing a specific pattern of gene expression called ?cold shock response?, which 
includes induction of a set of proteins defined as cold shock proteins (78, 80).  These cold 
 
20
shock proteins are typically classified into two groups based on their expression patterns 
(173).  Class I cold shock proteins are expressed at an extremely low level at 37?C, but 
are dramatically induced upon cold shock.  Class I includes CspA, CspB, CspG, CspI, 
CsdA, RbfA, NusA, and PNP.  Class II cold shock proteins are expressed at a certain 
level at 37?C, and are induced moderately upon cold shock.  Class II included IF-2,       
H-NS, RecA, ? subunit of DNA gyrase, Hsc66, HscB, trigger factor, dihydrolipoamide 
acetyltransferase, and pyruvate dehydrogenase (lipoamide).  Three of the cold shock 
proteins so far identified in E. coli appear to be associated with translation; RbfA, a 
ribosome binding factor, CsdA, an RNA unwinding protein, and IF2, an initiation factor 
(173).  These proteins are thought to be involved in the preservation of ribosome function 
at colder temperature.  In E. coli, where the induction of cold shock genes has been most 
extensively studied (173), nine genes encoding CspA-like proteins, cspA to cspI have 
been identified (190).  Among them, cspA (50), cspB (97), cspG (120), and cspI (180) 
have shown to be cold shock inducible.  Among cold shock inducible genes, cspA has 
been extensively investigated for its cold shock induction (190).  Low temperature 
regulation of the E. coli cspA gene is involved in both transcriptional and post 
transcriptional mechanisms. 
In V. vulnificus, when cells responded to a moderate temperature downshift, from 
23?C to 13?C, a decline in protein synthesis was observed, but cells continued to grow at 
a lower rate (110).  In contrast, when V. vulnificus was exposed to more dramatic 
temperature shifts, cell growth was halted and protein synthesis stopped (127).  When             
V. vulnificus culture was shifted from 35?C to 6?C, it underwent a transition to the VBNC 
state, but when cells were adapted to 15?C prior to change to 6?C they remained viable 
 
21
and culturable.  This result suggested that the exposure to an intermediate cold 
temperature (15?C) caused a cold adaptive response helping V. vulnificus remain 
culturable at a much colder temperature.  The survival and tolerance at cold temperatures 
could be due to the expression of cold adaptive proteins other than the major cold shock 
protein as found in E. coli and other microorganisms (17). 
 
4. Genes involved in general stress responses  
 
rpoS 
 
 The rpoS gene encodes a sigma factor, ?
S
, RpoS, which is required for expression 
of a large number of genes in response to various stresses, including nutrient limitation, 
osmotic challenge, and during growth into stationary phase (103).  The rpoS gene has 
been found in a variety of Gram-negative bacteria, and its function and regulation have 
been studied extensively in the enteric species E. coli and Salmonella enterica serovar 
typhimurium.  RpoS can act as a virulence factor since it activates some of the genes 
necessary for pathogenesis in several bacteria, including S. enterica, E. coli, and    
Shigella flexneri (42, 135, 159).  In fact, rpoS expression is induced when these bacteria 
enter mammalian cells (24).  The rpoS levels tend to be very low in rapidly growing cells 
not exposed to any stress.  However, the rpoS levels increase in response to a variety of 
environmental stresses, which included starvation for limiting nutrients, stationary phase, 
high osmolarity, and high or low temperature.  RpoS is a highly unstable protein under 
non-stress conditions, but exposure to various stresses differentially affects rpoS 
 
22
transcription and translation, as well as the rate of proteolysis.  Research on the regulation 
of rpoS gene expression has mainly focused on the control of RpoS translation (96, 103) 
and RpoS proteolysis (96, 155) 
 
oxyR 
 
OxyR is a peroxide sensor and a transcriptional activator of the oxidase stress 
response.  OxyR has been proved to be a positive regulator of the expression of nine 
hydrogen-peroxide-inducible genes, including those encoding catalase (katG), 
glutathione reductase (gor), glutaredoxin (grxA), alkyl hydroperoxide reductase (ahpCF), 
oxyS (a regulatory RNA), fur (ferric uptake regulation), and dps (a nonspecific DNA-
binding gene) (27, 115).  Catalase is part of a global system regulated by OxyR (27).  
OxyR-regulated enzymes are involved in the defense against reduced-oxygen 
compounds.  OxyR is required for adaptation to H
2
O
2
 (74).  An oxyR gene has been 
identified in 31 bacterial genomes (178).  The position of oxyR is variable in the different 
bacterial genomes, but it is often next to a gene involved in oxidative stress protection 
and regulated by OxyR.  In E. coli it is known that the expression of peroxide defense 
genes is activated by OxyR in the exponential phase.  In the stationary phase, expression 
of these genes is controlled by the starvation-induced sigma factor RpoS.  OxyR mediates 
a response to oxidative stress in E. coli.  The change in oxyR expression during aerobic 
growth is completely abolished in the absence of oxygen (52). 
 
 
 
23
katG 
  
 There are two types of structural catalases in bacteria: a bifuntionally catalase-
peroxidase (HPI) and a monofunctional catalase (HPII).  Most bacteria appear to express 
one or more catalases in response to peroxidase stress.  Vibrio vulnificus has been shown 
to have only one catalase gene, katG, encoding the catalase-hydroperoxidase (94).  KatG 
is induced during the bacterial exponential phase (174).  The expression of the katG is 
controlled by the positive transcriptional activator OxyR, and it is induced in response to 
exogenous H
2
O
2 
(115), which directly sense oxidative stress (88, 193).  Bacteria produce 
H
2
O
2
 under aerobic conditions to be toxic, and katG is primarily responsible for its 
detoxification (137). 
 
5. Molecular diagnosis techniques  
 
DNA probe hybridization 
 
 The ISSC established the methodology for enumerating V. vulnificus in shellfish 
under Chapter 9 of the FDA Bacteriological Analytical Manual, 9
th
 edition, 2004 (176).  
Two analytical schemes for isolating and enumerating V. vulnificus are described.  The 
first method utilizes the most probable number (MPN) analysis coupled with 
identification of suspect isolates using biochemical profiles, DNA probe colony 
hybridization, or Polymerase Chain Reaction (PCR).  The second uses two direct plating 
methods followed by hybridization with DNA probes for colony identification.  This 
 
24
technique has been used to enumerate V. vulnificus in oysters in several studies (187, 
188).  This method provides a more rapid and accurate evaluation of post harvest 
treatment of oysters (60).  The sensitivity of DNA probe hybridization assays for 
detection of vibrios in oyster homogenates approaches 10 CFU/g oyster meat.  
 The identification of bacteria by DNA probe hybridization is based on the 
presence and absence of particular genes.  The physical basis for gene probe tests stem 
from the structure of DNA molecules themselves (84).  DNA hybridization tests may be 
performed in many ways; one technique is the colony hybridization assay (58, 106).  An 
aliquot of a homogenized food is spread on the appropriate agar plate medium.  After 
incubation, the colony pattern is transferred to a solid support (usually membrane or 
paper filter).  Then, the cells are lysed by a combination of high pH and temperature, 
which also denature and fix the DNA to the support.  The solid supports with the attached 
target DNA are incubated with an enzyme-labeled specific probe.  The labeled probe 
failing to attach to the target is removed by stringent washing (177). 
 The radioactive probe DNA that is bound to the target on the support is often 
detected by a colorimetric reaction.  A chromogenic substrate then is added to the 
membrane.  Where the probe-associated enzyme is present, a color spot will develop.  
Each spot represents a bacterial colony that has arisen from a single cell.  The number of 
cells harboring the target gene in the original sample can be calculated by multiplying the 
number of spots by the dilution factor (177). 
 
 
 
 
25
Reverse transcription polymerase chain reaction (RT-PCR) 
 
 Reverse transcription polymerase chain reaction (RT-PCR) is an approach for 
converting and amplifying a single-stranded RNA template to yield abundant double-
stranded DNA products.  This molecular approach was first described in 1987 (179) and 
its use in the analysis of steady-state messenger RNA levels has become increasingly 
widespread in recent years.  Detection of low abundance mRNAs by RT-PCR has 
become a standard technique to determine gene expression in tissues and culture cells.  
RT-PCR is most useful to determine if a specific mRNA is present in sufficient numbers 
to be amplified to a detectable level and is a more sensitive alternative to Northern Blot 
Analysis (172).  RT-PCR technique involves the amplification of target RNA molecules 
by sequentially combining reverse transcription (RT) and polymerase chain reaction 
(PCR).  It is a technique similar to conventional PCR, except that the starting material is 
RNA rather than DNA.  Because of this copy, a DNA must first be made from RNA, 
utilizing an enzyme known as reverse transcriptase.  Once the copy of the DNA is made, 
the PCR proceeds as usual (136). 
  The greatest advantage of the RT-PCR in the analysis of mRNA includes its 
sensitivity, versatility, and rapid turn-around time (29).  The major shortcoming of      
RT-PCR is reliability and accuracy because the results are based solely on the quality and 
quantity of starting RNA sample (189).  Since RT-PCR was first described for the 
detection of low abundance mRNAs, the method has been extended to quantitative 
measurements of relative and absolute levels of single and multiple mRNAs.  Methods 
for obtaining RNA for RT-PCR have also been extended to include analysis of mRNA 
 
26
levels in clinical samples and even in single cells.  Measurement of specific mRNA 
species is of major importance for studies on gene expression.  RT-PCR is one of the 
most applied techniques in biomedical research for disease pathogenesis.  The use of  
RT-PCR is also increasing in the clinical research and diagnostic fields where it is 
becoming a popular method for the identification of infectious agents, as well as for 
detecting markers indicatives of certain types of cancers and genetic disorders (16). 
 Several studies have investigated the potential of mRNA detection using reverse 
transcription-PCR (RT-PCR) as a viability marker (13, 46, 93, 158).  Detection of mRNA 
is thought to be a good viability marker, due to its central role in cell metabolism and its 
very short half life.  RT-PCR was used to study gene expression both in situ and in vitro 
for VBNC state of V. vulnificus (160, 161). 
 
Statement of research objectives: 
 
In summary bacteria adapted to a period of low temperature growth could 
promote survival, which is referred as cold shock response.  Vibrio vulnificus, a        
food-borne pathogen could potentially develop this cold shock phenomenon during 
exposure to low temperature.  Oysters can serve as reservoirs for V. vulnificus and 
transmit this bacterium to humans through the ingestion of raw oysters.  If the potential 
for cold shock-mediated survival of V. vulnificus exists, the cooling strategy 
recommended by USFDA/ISSC may potentially induce this response in V. vulnificus and 
result in its persistence in oyster.  Not only could cold shock response affect microbial 
survival, but it may also alter gene expression.  It was critical to examine the impact of 
 
27
cold shock response of V. vulnificus in oysters regarding its survival and physiology.  The 
expected outcome of this study is to provide scientific data for the development of control 
strategies of V. vulnificus risk associated with raw oyster consumption.  The overall 
benefit would be to enhance quality and safety of shellfish to ensure consumer 
confidence in U.S. Gulf Coast oysters.  
 This research focuses on the cold shock response of V. vulnificus both in culture 
(in vitro) and in live oysters (in vivo).  The objectives of this study are: 
1. to investigate the effect of cold shock on growth of V. vulnificus under 
mimicked controlled shellstock temperature conditions as proposed by 
USFDA/ISSC in vitro. 
2. to examine the effect of cold shock on V. vulnificus growth in shellstock 
oysters using colony blot hybridization as a tool to enumerate V. vulnificus 
persisting in oysters. 
3. to determine which genes of V. vulnificus might be altered during cold shock 
4. and to use RT-PCR technology to analyze V. vulnificus gene expression 
during cold shock both in vitro and in vivo. 
 
 
 
 
 
28
III. COLD SHOCK EFFECT ON GROWTH RATE AND SURVIVAL OF VIBRIO 
VULNIFICUS IN CULTURE BROTH UNDER SHELLSTOCK TEMPERATURE 
CONTROL CONDITIONS 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
29
ABSTRACT 
  
 The growth rate of V. vulnificus was investigated at different temperatures.  The 
drop plate method was used to determine the culturability of the cells.  All the four strains 
tested displayed a similar growth rate when incubated at the same temperature (P>0.05), 
except at 20?C (P<0.05).  At 35 and 25?C V. vulnificus cultures showed a mean growth 
rate of 1.23 and 1.169 hour
-1
, respectively.  At 20?C cells multiplied with a mean growth 
rate that ranged from 0.752 hour
-1
 in clinical strains to 0.982 hour
-1 
in environmental 
strains.  In contrast, at 15?C V. vulnificus showed little growth with a mean growth rate of 
0.004 hour
-1
.  At 4?C and 7.2?C cell numbers decreased over time until non-detectable 
levels were recorded at 72 h.  The response of V. vulnificus to cold shock was 
investigated under ISSC guidelines.  Vibrio vulnificus was grown at 35, 25, 20, and 15?C, 
and then subjected to subsequent low temperatures at 7.2 or 4?C for one week.         
Vibrio vulnificus cells rapidly multiplied at elevated temperatures (35, 25, and 20?C).  
After cold shock at 7.2?C cell numbers decreased by 1 to 2 log units.  However, the 
highest reduction in culturability was observed after cold shock at 4?C.  When cells were 
adapted to 15?C prior to cold shock at 7.2?C, a slight increase in cell counts were 
observed.  Results suggested that a cold adaptive mediated survival mechanism in       
V. vulnificus existed when cells were adapted to 15?C prior to shock at 7.2?C.  The 
effective refrigeration temperature in reducing the multiplication of V. vulnificus is at 
4?C.  However, optimal and sub-optimal growth temperatures (35, 25, 20?C) allowed    
V. vulnificus cell counts to reach high number that could not be reduced to safety levels 
by refrigeration conditions even at 4?C. 
 
30
INTRODUCTION 
 
Vibrio vulnificus is a Gram-negative bacterium naturally inhabitating marine and 
estuarine environments.  V. vulnificus is a mesophilic bacterium with maximum growth 
occurring at 35?C, pH of 7.5 to 8.0, and with 2% NaCl present in the medium (68).  In 
the U.S.,  V. vulnificus is a major concern for the public health authorities since 95% of 
all deaths associated to seafood consumption are caused by this bacterium (132).                
V. vulnificus infections can cause a primary septicemia with fatalities up to 60% (132), 
especially in patients with underlying diseases.  The majority of those cases are 
associated to the consumption of raw oysters.  High V. vulnificus counts in oysters are 
correlated with elevated water temperatures in summer months which explains the 
increase incidence of the disease during warmer months (157).  These epidemiological 
findings suggest that infections caused by V. vulnificus are dose dependent.  Although the 
infectious dose for V. vulnificus has not been established for humans, the invasiveness 
and high fatality rates that characterize V. vulnificus infections makes the reduction of    
V. vulnificus counts in oysters to non-detectable levels a primary goal for the Interstate 
Shellfish Sanitation Conference (ISSC), as well as for the Gulf Coast oyster industry.  
Under optimal conditions, V. vulnificus exhibits one of the fastest growth rates of 
all bacteria but cell culturability rapidly declines when this bacterium is subjected to 
refrigeration temperatures (30, 33, 110, 128, 170).  In order to minimize consumer risks, 
the ISSC has established specific guidelines for the control of molluscan shellfish at 
harvest, transportation, shucking, packing and shipping (44).  Shellstock temperature 
control is a critical point within that set of guidelines.  Shellstock temperature control is 
 
31
defined as the management of the environmental temperature of shellstock by means of 
ice, mechanical refrigeration or other approved methods which are capable of lowering 
the temperature of the shellstock and which will maintain it at 10?C or less.  A specific        
time-temperature matrix has been defined for molluscan shellfish collected from waters 
where problems associated to V. vulnificus have been reported.  The warmer the water 
temperatures are at time of harvest, the shorter the time required from harvest to 
temperature control conditions (45). 
 Not only shellstock temperature control but also various actions have been 
adopted in order to minimize the risk of oyster containing V. vulnificus. ISSC has adopted 
industry-implemented post-harvest controls to reduce V. vulnificus loads in oyster 
shellstock, which may include time-temperature, post harvest treatment (i.e. hydrostatic 
pressure, cool pasteurization, IQF, and irradiation - pending approval), and rapid chilling.  
The post-harvest treatment technologies currently account for less than 10% of all 
domestic raw oyster sales in the U.S. (98).  Moreover, these post-harvest treatments are 
effective for eliminating V. vulnificus, but each has some drawbacks.  Cool pasteurization 
(5) may kill bacteria but can change the oyster flavor and texture.  Hydrostatic pressure 
processing (9) can eliminate this bacterium but it cause the meat to detach from the shell.  
All of these processes kill the harvested oyster and increase product costs.  The use of 
accurate shellstock time-temperature controls offers several advantages over post-harvest 
treatments since the procedure does not require specialized technology.  The temperature 
control strategies for minimizing V. vulnificus risks by the ISSC were proposed following 
reports by Cook and Ruple (33).  These authors stated that storage of summer harvested 
oyster shellstock from the U.S. Gulf Coast at 10?C prevented the multiplication of         
 
32
V. vulnificus, however, recent studies have been shown that V. vulnificus can adapt to 
cold temperatures below 7.2?C, following exposure to intermediate temperatures (?15?C) 
(17, 110).  Previous literature has reported that 4?C seems to be more effective than 7?C 
in reducing V. vulnificus numbers to non-detectable levels (162).  
Understanding the relationship between V. vulnificus numbers and temperature in 
culture broth may help predict the growth pattern of V. vulnificus in oysters.  To better 
characterize the effects of refrigeration conditions in V. vulnificus growth, the objectives 
of this study were (a) to establish the growth rate of different V. vulnificus strains under 
different temperatures, and (b) to determine V. vulnificus growth under ISSC 
recommended shellstock temperature control conditions. 
 
MATERIALS AND METHODS 
 
Bacterial strains, media, and growth conditions 
 
 Two clinical strains of V. vulnificus, ATCC 27562 (type strain), and C7184Tr 
(avirulent, translucent morphotype provided by J.D. Oliver, University of North Carolina, 
Charlotte, NC) were used in this study.  Two environmental strains (VV3, VV4) isolated 
from eastern oyster (Crassostrea virginica) samples collected from Mobile Bay, Alabama 
were also included.  Identification and classification of both environmental isolates were 
performed by API 20E (bioMerieux, Inc., Hazelwood, MO) and confirmed by PCR 
analysis with V. vulnificus specific primers (43).  Cells were maintained and routinely 
grown on marine agar (MA) (Difco, Detroit, MI.) at 35?C. 
 
33
Growth rate of V. vulnificus  
 
 Growth curves for V. vulnificus were determined by inoculating one single colony 
into 25 ml of marine broth (MB) (Difco) and grown in a shaker incubator at 35?C.  At 
various time intervals, 5 ml aliquots of culture were taken and the optical density (OD) at 
450 nm was determined.  Simultaneously and in order to correlate OD with colony 
forming units (CFU), the drop plate method described by Herigstad et al. (62) was used.  
One hundred ?l of culture broth was serially diluted and plated onto MA and incubated 
overnight at 35?C and colonies counted after 24 h incubation (Appendix. 1). 
 Growth curves at different temperatures (35, 25, 20, 15, 7.2, and 4?C), were 
determined following the above mentioned protocol with the following modifications.  
Four V. vulnificus strains were compared at the same time for each experiment.  One 
hundred and fifty ml of MB was inoculated with cells at OD 0.025 which equals a cell 
count of approximately 10
4
 CFU/ml.  Flasks were then incubated at 35, 25, 20, 15, 7.2, 
and 4?C.  Samples were taken at 0, 1, 2, 3, 4, 5, 6, 8, 10, and 12 h of incubation, viable 
plate counts were done in triplicate on MA plates by the drop plate method.  For 
experiments carried out at 7.2?C and 4?C, cells were cultured and sampled for 
culturability until no CFU will be detected.  For each temperature experiment, the cell 
growth rate was calculated by simple linear regression of ln (CFU/ml) over on time 
(hours) for five or six points in the linear portion of the growth curve. 
  
 
 
 
34
Growth patterns under cold shock conditions 
 
 The effect of temperature downshift (cold shock) on V. vulnificus growth was 
studied by imitating the time-of-harvest to time-of-refrigeration conditions that are 
currently recommended by the ISSC (44).  The culturability of the cells after cold shock 
was monitored and compared at two different refrigerated temperatures (7.2?C and 4?C).  
Four different growth temperatures and times prior to cold shock were compared: 35?C 
for 10 h, 25?C for 12 h, 20?C for 14 h, and 15?C for 36 h.  After those incubation periods, 
cells were transferred to either 7.2?C or 4?C and incubated for 168 h.  At various time 
intervals from initial growth to 168 h, the culturability of the cells was monitored by the 
drop plate method.  
 
Statistical analysis 
 
All bacterial samples were analyzed in triplicate.  The standard error was 
calculated for all of the treatment replications.  To determine if difference between data 
set existed, the Randomized Complete Block Design (RCBD), F-test was performed 
using one-way Analysis of Variance (ANOVA) analysis procedure in the Statistical 
Analysis System, SAS 9.1.3 (SAS Institute, Cary, NC). 
 
 
 
 
 
35
RESULTS 
 
Growth rate of V. vulnificus 
 
All four strains exhibited a very similar growth rate (Fig. 1-6) when incubated at 
the same temperature (P>0.05), with the exception of temperature at 20?C (P<0.05).  
When cells were cultured at 35?C, V. vulnificus viable counts increased by 5 log over a 
period of 7 to 10 h, reaching 10
9
 CFU/ml during the stationary phase.  The growth rate at 
35?C was between 1.218 to 1.250 hour
-1
 (Fig.1).  A similar result was obtained at 25?C 
where growth rates ranged from 1.149 to 1.174 hour
-1
 (Fig.2).  At 20?C only the two 
environmental strains were able to reach a viable count of 10
9
 CFU/ml after a 12 h 
period.  Both clinical strains showed a decline in cell growth by one to two log reductions 
with the growth rate ranged from 0.655 to 0.982 hour
-1 
(Fig.3).  Small positive growth 
was observed at 15?C with the growth rate ranged from 0.003 to 0.005 hour
-1
 (Fig.4).  
When cells were incubated under refrigeration temperatures at 4?C, total viable counts 
started to decrease 12 h post-inoculation.  Cells incubated at 7.2?C started to lose 
culturability 24 h post-inoculation.  After 72 h of incubation, no viable cells were 
observed at either 7.2 or 4 ?C.  No difference between strains was observed in this 
experiment (Fig. 5-6).  
 
 
 
 
 
36
Growth patterns under cold shock conditions 
 
Figures 7 to 14 depict cold shock survival response of V. vulnificus, when cells 
were subjected to different temperatures and times growing conditions.  Under ISSC 
guidelines conditions, V. vulnificus reached 10
9
 CFU/ml when cells were incubated at 35 
and 25?C for 10 and 12 h, respectively (Fig. 7-8).  At 20?C, only environmental strains 
were able to reach those numbers after 14 h of incubation, while clinical strains plateaued 
at 10
8
 CFU/ml (Fig. 9).  At 15?C no growth was recorded prior to cold shock (Fig. 10). 
After cold shock at 7.2?C, a steady decrease in V. vulnificus cells numbers was observed 
at 35, 25, and 20?C.  After 168 h of incubation at 7.2?C, an overall cell count reduction 
by one log was observed in all cases with the exception of VV3 and VV4 grown at 25?C 
(Fig. 7-9).  After cold shock, these two strains experienced a reduction of two log units in 
cell count numbers.  Nevertheless, when cells were allowed to grow up to 10
8
 CFU/ml or 
higher levels, they maintained a cell culturability of 10
7
 CFU/ml or higher during 7 days 
under refrigeration conditions at 7.2?C.  Conversely, when cells were incubated at 15?C 
for 36 h and then shifted to 7.2?C, total cell counts slightly increased during the length of 
the study (Fig. 10).  This increment in cell counts represented only a 0.2 log in magnitude 
but showed an adaptation response to 15?C. 
 A similar pattern was found when V. vulnificus cells were incubated at 35, 25, 
20?C, and then shifted to 4?C (Figure 11-13).  Cell counts started to decrease a few hours 
after cold shock.  Cells grown at 35?C required up to 50 h of incubation at 4?C before 
starting to lose culturability.  Cells grown at 25?C and 20?C showed a reduction in total 
cell counts in less than 12 h at 4?C.  A similar trend was observed when cells were 
 
37
subjected at 7.2?C (Fig. 7-9).  When cells were incubated at 15?C for 36 h and then cold 
shocked at 4?C a decrease in total cell counts was observed starting 72 h after cold shock 
(Fig. 14).  This result was different when cells were cold shocked at 7.2?C.  After 168 h 
of incubation at 7.2?C, cell counts averaged 10
4
 CFU/ml while after 168 h of incubation 
at 4?C remaining viable cells were down to 10
2
 CFU/ml.  Statistical analyses showed that 
the mean of V. vulnificus counts after 7 day refrigeration at 7.2?C were significantly 
greater (P<0.05) than at 4?C in all treatments.  
 
DISCUSSION 
 
The response of living cells to temperature downshift has been termed cold shock 
(72).  Several factors have been reported to affect bacterial growth during cold shock 
including temperature (67), incubation time at low temperature (164), chill rate (111), 
phase of inoculums (111, 143), cell concentration (49, 111, 163), plating medium (49), 
and the opportunity for the cells to repair the damage caused by the cold shock (37).  
Several studies have reported cold shock resulted in the decline in cell culturability of    
V. vulnificus (30, 33, 81, 83, 118, 129).  There has also been evidence that cold shock 
adaptation promoted survival of V. vulnificus (17).  
Results of this study indicate there was no difference in the growth pattern 
between the clinical and environmental strains of V. vulnificus tested.  The optimal 
temperature condition assayed was 35?C while incubation at 15?C or lower prevented    
V. vulnificus growth.  The current data are in agreement with the maximum (37?C) and 
minimum (13?C) temperatures reported for V. vulnificus growth (81).  This study 
 
38
demonstrated that clinical strains ATCC 27562 and C7814Tr had a worse performance 
rate at 20?C than environmental strains, and suggests that environmental strains might be 
better adapted to suboptimal temperatures than clinical strains.  
When V. vulnificus growing patterns were investigated under the time-of-harvest 
to time-of-refrigeration conditions recommended by the ISSC, the results revealed that all 
strains tested had similar growing patterns.  V. vulnificus cells rapidly multiplied in 
culture broth at elevated temperature (35, 25, 20?C) while no positive growth was 
detected at 15?C and loss of culturability occurred under refrigeration conditions.  
Growth of V. vulnificus in vitro can be prevented when exposed to 7.2?C and 4?C, 
however, V. vulnificus cells, although unable to multiply at low temperatures, remain 
culturable for up to 7 days under refrigeration conditions.  If V. vulnificus cell numbers 
are allowed to reach high numbers under favorable conditions, neither 7.2?C nor 4?C will 
reduce cell culturability to non-detectable levels (at least in a 7 day period).  
Data presented here show that cold shock adaptation enhances survival of           
V. vulnificus, when cells are cultured in vitro.  A cold adaptation response was observed 
after subjecting V. vulnificus cells to 15?C for a few hours before cold shock.  In fact, 
cells adapted at 15?C were able to slightly increase their numbers at 7.2?C.  This finding 
is in agreement with Bryan et al (17) who verified that a cold adaptation period at 15?C 
enhanced V. vulnificus survival at 6?C.  This cold adaptive response in V. vulnificus 
induced at 15?C could prevent the cells from entering the VBNC state when exposed to a 
much colder temperature.  McGovern and Oliver (110) reported the induction of cold 
response proteins in V. vulnificus after temperature downshift from 23?C to 12?C.  This 
result suggested that cellular protein expression changed during or after temperature 
 
39
shifting from high temperature to low temperature.  The adaptation of V. vulnificus to 
cold temperature after priming at 15?C may be due to the induction of cold-adaptive 
protective proteins.  Cold temperature adaptation effect was lost when cells were 
transferred to colder refrigeration conditions (4?C instead of 7.2?C).  Not only were 
15?C-acclimated V. vulnificus cells unable to grow at 4?C, but their numbers drastically 
declined over time.  This striking difference between close temperature conditions has 
been pointed out in other studies.  Stanford reported that 4?C and 7?C differently affected 
the rate of entry into dormancy (162).  These stronger negative effects caused by 4?C 
versus 7?C might warrant the use of stringent refrigeration conditions by the shellfish 
industry. 
 The temperature and time of cold shock treatment clearly affects the cold shock 
response of V. vulnificus, which could enhance survival during cold stress conditions.  
The current findings show that the shellstock temperature control guidelines suggested by 
ISSC might not be effective in reducing V. vulnificus numbers.  When V. vulnificus cells 
are exposed to optimal or suboptimal temperatures, cell numbers rapidly reached 10
8
 to 
10
9
 CFU/ml, and which can be reduced by refrigeration only in a few orders of 
magnitude.  Minimizing V. vulnificus growth by limiting the time from harvest to 
refrigeration should be strictly enforced.  Further studies analyzing V. vulnificus response 
to cold shock in vivo should be carried out in order to provide the industry with safer 
practices.  
 In conclusion, this study showed that exposure of V. vulnificus to optimal or 
suboptimal temperatures for a brief period increases the number of cells to such high 
 
40
levels that they can not be safely reduced by refrigeration afterwards.  These data also 
suggest that 4?C is the appropriate refrigeration temperature. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
41
At 35?C
4
5
6
7
8
9
10
0 2 4 6 8 10 12 14
Hour
l
o
g
 CF
U/
m
l
 
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 1.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 35?C 
 
 
At 25?C
4
5
6
7
8
9
10
02468101214
Hour
l
og C
F
U
/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
 
FIG. 2.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 25?C 
 
42
 At 20?C
4
5
6
7
8
9
10
02468101214
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
 
FIG. 3.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 20?C 
 
 
At 15?C
4
4.1
4.2
4.3
4.4
4.5
4.6
4.7
4.8
4.9
5
02468101214
Hour
l
og C
F
U
/
m
l
ATCC 27562 C7814Tr VV3 VV4
 
 
 
FIG. 4.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 15?C 
 
43
 At 7.2?C
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
0 1020304050607080
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
 
FIG. 5.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 7.2?C 
 
 
At 4?C
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
0 1020304050607080
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
 
FIG. 6.   Growth of V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4 at 4?C 
 
44
At 35?C for 10h and cold shocked at 7.2?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 7. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 35?C for 10 h and cold shocked at 
7.2?C for 168 h, vertical arrow indicated cold shock at 7.2?C. 
 
At 25?C for 12 h and cold shocked at 7.2?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
lo
g
 C
F
U
/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 8. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 25?C for 12 h and cold shocked at 
7.2?C for 168 h, vertical arrow indicated cold shock at 7.2?C. 
 
45
 At 20?C for 14h and cold shocked at 7.2?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 9. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 20?C for 14 h and cold shocked at 
7.2?C for 168 h, vertical arrow indicated cold shock at 7.2?C. 
 
At 15?C for 36h and cold shocked at 7.2?C for 168h
4
4.1
4.2
4.3
4.4
4.5
4.6
4.7
4.8
4.9
5
0 20 40 60 80 100 120 140 160 180 200 220
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 10. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 15?C for 36 h and cold shocked at 
7.2?C for 168 h, vertical arrow indicated cold shock at 7.2?C. 
 
46
At 35?C for 10h and cold shocked at 4?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 11.   Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 35?C for 10 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
At 25?C for 12h and cold shocked at 4?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
l
o
g
 CF
U/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 12   Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 25?C for 12 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
47
At 20?C for 14h and cold shocked at 4?C for 168h
4
5
6
7
8
9
10
0 20 40 60 80 100 120 140 160 180 200
Hour
l
og C
F
U
/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 13.   Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 20?C for 14 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
At 15?C for 36h and cold shocked at 4?C for 168h
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
0 20 40 60 80 100 120 140 160 180 200 220
Hour
l
og C
F
U
/
m
l
ATCC 27562 C7184Tr VV3 VV4
 
 
FIG. 14.   Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
VV3, and VV4 in MB when cells were incubated at 15?C for 36 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
48
IV. EFFECT OF COLDSHOCKING ON SURVIVAL OF VIBRIO VULNIFICUS 
IN SHELLSTOCK OYSTERS 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
49
ABSTRACT 
 
 The response of V. vulnificus cells in oysters to cold shock was evaluated.  
Depurated oysters were inoculated with three strains of V. vulnificus at 10
6
 CFU/g oyster 
meat.  Both clinical and environmental strains of V. vulnificus presented similar growth 
numbers in oysters under the same treatment (p>0.05).  Three cold shock conditions were 
examined.  When oysters were transferred to 35 and 25?C, V. vulnificus numbers 
multiplied by a half log after 10 h and 12 h incubation, respectively.  When oysters were 
shifted to 4?C for one week, V. vulnificus exhibited a moderate decline in cells viability.  
No growth of V. vulnificus was observed after oysters were adapted to 15?C for 36 h, but 
cell viability decreased slightly after they were cold shocked at 4?C for one week.  This 
decline in cell culturability varied from experiment to experiment (p<0.05) but was 
generally on the order of a half to two log reduction after cold shock for one week.  This 
study indicates that cells adapted to 15?C prior to change to 4?C enhanced cell 
culturability of V. vulnificus while it is embedded in oysters.  Conditions that favor 
adaptation to cold temperatures should be avoided in V. vulnificus control strategies. 
 
 
 
 
 
 
 
 
50
INTRODUCTION 
  
 Raw or under cooked oysters pose a human health risk, as these oysters tend to 
concentrate microorganisms from the surrounding waters via their filter feeding.  In the 
U.S., Vibrio vulnificus is an autochthonous microorganisms in the Gulf of Mexico waters 
where its growth is favored by relatively high water temperatures (85).  Gulf Coast 
oysters (Crassostrea virginica) have been reported to be the primary source for              
V. vulnificus related illnesses and deaths.  From 1988-1996, Center for Disease Control 
and Prevention (CDC) received reports of 302 cases of V. vulnificus infections from the 
Gulf Coast States, of these, 141 cases were associated with seafood ingestion, and 96% of 
these cases were due to raw oyster consumption (19).  V. vulnificus is the most serious       
food-borne pathogen with more deaths reported annually from this pathogen than any 
other seafood-related disease (11).  This pathogen is known to cause gastroenteritis, 
severe wound infection and primary septicemia (99).  Nearly all fatal primary septicemia 
cases were associated with the consumption of raw oysters.  The case fatality rate for     
V. vulnificus septicemia exceeded 60% (19).  High case-fatality rate by V. vulnificus was 
reported in persons with preexisting liver disease or immunocompromised conditions 
(165).  This bacterium is one of the most costly in terms of economic loss.  FDA 
estimated that V. vulnificus-related illnesses cost over $120 million annually, or about 
60% of the total cost of shellfish-related illnesses each year (44). 
 Legal harvesting of oysters is limited to areas free of feacal contamination, 
however oysters harvested from approved sites may contain V. vulnificus.  During 
summer, V. vulnificus levels in the Gulf Coast oysters can ranged from 10
3
 to 10
5
 CFU/g 
 
51
oyster and appears to replicate within the oyster tissue (170).  This bacterium may be 
presented in oysters in relative low numbers at harvest but may multiply to more 
hazardous levels if they are exposed to time or temperature abuse.  Storage times and 
refrigerated temperature are known to effect the survival of V. vulnificus.  Cook et al. (30) 
reported that V. vulnificus could multiply in the oyster shellstock if they are held at 
temperatures above 13?C.  It has been proven that the shorter the time oyster shellstock 
remained outside refrigeration after harvest, the lower the number of V. vulnificus were 
detected in them (31).  Conversely, refrigeration temperature is known to be detrimental 
to the survival of V. vulnificus.  The majority of studies that focused on the effect of low 
temperatures to V. vulnificus survival pointed up the need to refrigerate oyster shellstock 
quickly after harvesting (30, 31, 81, 129).  In order to limit the multiplication of             
V. vulnificus in post-harvest oysters, restrictive shellstock temperature control measures 
that requires refrigeration of Gulf coast oysters after harvesting have been recommended 
by the shellfish authorities, the Interstate Shellfish Sanitation Conference (ISSC) and 
implemented by the industry (44).  However, fatalities associated to V. vulnificus 
infectious associated with the consumption of raw oysters have not decreased in recent 
years.  
 The cold shock phenomenon, a physiological response for survival strategy of 
living cells to temperature downshift has been reported in several bacteria (51).        
Bryan et al. (17) found that the effectiveness of rapid chilling or freezing of oysters to 
eliminate V. vulnificus levels in shellfish may be compromised by product handling 
procedures that permitted cold adaptation.  When V. vulnificus culture was abruptly 
shifted from 35?C to 6?C conditions, a non-culturable state was induced, whereas cells 
 
52
adapted to 15?C prior to change to 6?C condition, remained viable and culturable.  
Recently, Quevedo et al. (149) reported that chilling of oysters on ice at 7.2?C resulted in 
a small decline of endogenous V. vulnificus and concluded that this technique was not 
sufficient to eliminate this pathogen in postharvest oysters.  Cooling regimes in control 
measures may potentially induce cold shock adaptation that could enhance V. vulnificus 
survival.  It is critical to determine whether the potential for cold shock-mediated survival 
of V. vulnificus exists while it presents in oyster shellstock. 
 The effect of cold adaptation of this pathogenic microorganism in oysters under 
industry practices from harvest to consumption, particularly in regard to their survival 
need to be further investigated.  The objective of this study was to examine the effect of 
cold shock to V. vulnificus growth in oyster shellstock.  
 
MATERIALS AND METHODS 
 
Bacterial strains and growth conditions 
 
 Two clinical strains of V. vulnificus, ATCC 27562 (type strain), and C7184Tr 
(avirulent, translucent morphotype) provided by J.D. Oliver, University of North 
Carolina, Charlotte, NC and one environmental strain (VV3) isolated from oyster 
samples collected from Mobile Bay, Alabama were used in these studies.  Cells were 
grown in marine broth with shaking and maintained in marine agar (MA) (Difco, Detroit, 
MI) at 35?C.  
 
 
53
Depuration of oyster samples  
 
Twelve hundred live shellstock eastern oysters, one year old, 50 to 80 mm in 
diameter, were provided by the Auburn University Shellfish Laboratory (AUSL), 
Department of Fisheries and Allied Aquacultures, Dauphin Island, AL.  Oysters were 
acclimated in 19 mm mesh size Durethane oyster bags, (ADPI Enterprise Inc., 
Philadelphia, PA) for 2 weeks in filtered water flow-through system before depuration. 
Oysters were scrubbed with a sterile scrub-brush under running tap water to remove 
extraneous material.  Cleaned oysters were treated under UV filtered seawater system 
(UV flow 3000 ?w-sec/cm
2
), using a water flow-through system (180 l/h) for 7 days at 
the AUSL.  During depuration, oysters were fed twice a day with marine microalgae 
concentrate (Shellfish diet 1800, Reedmariculture, Campbell, CA).  Salinity, temperature, 
and dissolved oxygen were determined everyday.  The mortality of oysters was checked 
every morning before feeding.  
 
Bacteriological analysis 
 
Ten oysters were randomly selected before and during depuration once a day for 
bacteriological analysis as follows: total heterotrophic aerobic plate count, total Vibrio 
counts, and V. vulnificus counts.  Oysters were washed and scrubbed in tap water with 
sterile brushes, shucked and weighed in sterile equipment to avoid cross-contamination.  
Oyster meat sample and the shell liquid from ten oysters were pooled together and 
homogenized using a MCI mini Waring? blender for 90s.  The homogenate was then 
 
54
diluted 1:1 (wt/wt) in phosphate-buffered saline (PBS) and homogenized for another 30s.  
Ten-fold dilutions from the homogenate were made with PBS.  The sample (100?l) was 
spread with a sterile glass rod on MA in triplicate for total aerobic plate count.  Another 
100 ?l was spread on Thiosulfate Citrate Bile-Salt and Sucrose (TCBS) agar (Difco) in 
triplicate for total Vibrio plate count.  One hundred ?l of homogenated oyster was spread 
on T1N1 agar (1%NaCl, 1% tryptone, 1.5% agar) in triplicate for V. vulnificus 
enumeration.  All plates were dried at room temperature until homogenate was fully 
diffused in the agar.  The plates were inverted and incubated 24 h at 35?C.  
Vibrio vulnificus counts in oysters were enumerated using a species-specific 
oligonucleotide probe (vvhA) and colony blot hybridization procedure previously 
described by Quevedo et al (149).  After 24 h incubation, colony lifts from T1N1 spread 
plates were overlaid with Whatman #541 filters papers.  Filters with transferred colonies 
were heated to dryness in a microwave oven for 2 min on the highest setting in lysis 
solution (0.5 M NaOH, 1.5M NaCl), followed by neutralization in ammonium acetate 
buffer and washed in standard saline citrate buffer.  Filters were treated with proteinase K 
(20?g/ml) and hybridized with the alkaline phosphatase-labeled vvhA probes (DNA 
Technologies, Aarhus, Denmark) under stringent conditions (56?C) for 1 h.  Filters were 
washed in standard saline citrate buffer with 1% sodium dodoecyl sulfate at hybridization 
temperature, followed by additional washing with standard saline citrate buffer at room 
temperature to overcome nonspecific hybridizations signal.  NBT/BCIP 
(nitrobluetetrazolium/5-bromo-4-chloro-3-indolylphosphate toluidinium) substrate 
(Roche Diagnosis, Indianapolis, Ind.) was used for detection of hybridization positive 
colony.  Control filters were developed concurrently for all the time points. 
 
55
Artificial inoculation 
 
After one week, live depurated oysters were cooled on ice and immediately 
transported to the Bacterial Genomics Laboratory, Department of Fisheries and Allied 
Aquacultures, Auburn University, AL for cold shock experiments.  Live depurated 
oysters were inoculated with V. vulnificus by self-inoculation filtration.  Four 10 gallon 
(38 L) aquaria containing 27 L of autoclaved seawater was prepared.  One hundred fifty 
oysters were placed into each aquarium at 25?C and allowed to acclimate up to 24 h.  A 
fresh culture of each strain of V. vulnificus was grown in MB until exponential growth 
phase (10
8
 CFU/ml, OD
450
=0.15) was reached.  Three liters of V. vulnificus culture were 
introduced into each aquarium at approximately 10
6
 CFU per gram of oyster.  Control 
aquaria contained oysters without introduced V. vulnificus and were acclimated as 
described for test aquaria. 
 
Cold shock experiments 
 
After V. vulnificus inoculations, oysters remained at 25?C overnight prior to 
temperature shift.  To examine cold shock effect on V. vulnificus survival in oysters, three 
different cold shock conditions were compared.  The first experiment, oysters were 
transferred to 35?C for 10 h, then chilled by ice-water immersion until the internal 
temperature in oysters reached 4?C.  Oysters were then transferred to a 4?C incubator for 
168 h.  In the second experiment, oysters were transferred to 25?C for 12 h then chilled to 
4?C and incubated for 168 h.  For the last experiment, oysters were transferred to 15?C 
 
56
for  36 h, and chilled to 4?C as described above and incubated at 4?C for 168 h.  The 
internal temperature of the oysters was monitored using a digital thermometer inserted 
through a hole drilled in the shell to the meat of oysters throughout the study (5).  The 
external ambient air temperature was also recorded and the pH of oyster meat measured 
periodically. 
 
V. vulnificus enumeration in oysters 
 
At various time intervals from t = 0 to t = 168 h, V. vulnificus counts in oysters 
were enumerated using a species-specific oligonucleotide probe (vvhA) and colony blot 
hybridization procedure previously described by Quevedo et al (149). 
 
Statistical analysis 
 
All bacterial samples were analyzed in triplicate.  The standard error was 
calculated for all of the treatment replications.  To determine if difference between data 
set existed, the Randomized Complete Block Design (RCBD) using F-test was performed 
using one-way ANOVA analysis procedure in the Statistical Analysis System, SAS 9.1.3 
for Windows (SAS Institute, Cary, NC). 
 
 
 
 
 
57
RESULTS 
 
Total bacteria, total Vibrio, and V. vulnificus during depuration  
 
 Before oysters were depurated by UV filtered seawater system, the total bacteria 
count was 10
4
 CFU/g oyster meat.  After depuration for 7 days, CFU/g oyster declined 
about two log units.  Similar decline in CFU/g oyster of total Vibrio count from TCBS 
plate was observed.  Numbers of V. vulnificus in oysters was around 10
2
 CFU/g oyster 
before depuration.  After five days of depuration, no CFU/g oyster of V. vulnificus was 
detected (Fig. 15). 
 
pH of oyster meat 
 
 The pH of oysters after artificially inoculation with V. vulnificus at 25?C was 6.6.  
After oysters were transferred to 35?C for 10 h the pH slightly increased, but then 
decreased to 6.2 after oysters were kept at 4?C for one week.  When oysters were kept at 
25?C for 12 h, pH remained constant.  After oysters were shifted at 4?C for one week, pH 
of oyster meat decreased from 6.6 to 6.2.  When oysters were transferred to 15?C for     
36 h, the pH was constant.  After oysters were shifted to 4?C, the pH decreased from 6.6 
to 6.3 (Fig. 16).  The pH range across the study (pH 6.2 to 6.6) was lower than the 
optimal pH described for V. vulnificus (pH 7.5 to 8.0). 
 
 
 
58
V. vulnificus growth in shellstock oysters during cold shock 
 
  Colony hybridization was used to enumerate V. vulnificus in oysters during cold 
shock.  No V. vulnificus was detected in control oysters at anytime during any treatment.  
The average initial V. vulnificus numbers in artificially inoculated oysters for each 
experiment was 1?10
6 
CFU/g oyster.  When V. vulnificus-contaminated oysters were 
incubated at 35?C for 10 h, cells increased by one half log unit.  After oysters were 
placed at 4?C cell numbers declined moderately by two log units, with the final counts of 
3?10
4 
CFU/g oyster meat (Fig 17).  Similarly, when V. vulnificus was incubated at 25?C 
for 12 h, cell numbers slightly increased but after cold shock at 4?C numbers decreased 
by 1.5 log units, with the final counts of  6.5? 10
4
 CFU/g oyster meat (Fig 18).  When   
V. vulnificus contaminated oysters were acclimated at 15?C for 36 h V. vulnificus 
numbers remained constant, and slightly decreased only by a half log unit, with final 
numbers around 5.3?10
5
 CFU/g oyster meat after downshift to 4?C (Fig 19).  Overall,   
V. vulnificus numbers were not significantly different among strains (ATCC 27562, 
C7184Tr, VV3) after cold shock for one week under the same temperature treatment 
(p>0.05).  The decline in cell culturability varied from experiment to experiment (p<0.05) 
but was generally on the order of a half to two log reduction after cold shock for one 
week. 
 
 
 
 
 
59
DISCUSSION 
 
 The present study successfully demonstrated a consistent method to artificially 
inoculate V. vulnificus into live oysters.  Numbers of V. vulnificus found in oyster 
shellstock were very low (10
2
 CFU/g oyster) before depuration treatment.  After 5 days 
of depuration, the cells were not detected by colony hybridization.  Previous literature 
reported that the sensitivity of DNA probe colony hybridization assays for detection of  
V. vulnificus approached 10 CFU/g oyster.  The FDA currently recommends that 
postharvest-treatment should reduce V. vulnificus to non-detectable level (<30 CFU/g) 
(45).  This result revealed that the depuration treatment used in this study was successful 
in eliminating V. vulnificus to non-detectable levels.  
 When V. vulnificus-contaminated oysters were kept in a warm environment (at 35 
and 25?C), even for 10 to 14 h, the numbers of V. vulnificus in oysters increased by a half 
log.  This finding supports previous reports of how elevated temperature abuse in oysters 
contributes to an increase in endogenous V. vulnificus levels in post-harvest shellstock 
oysters (30, 31, 81).  Recently, Gooch (53) reported that V. vulnificus multiplied in live 
oysters held at 26?C with an increase of 1.2 log CFU/g 10 h post harvest.  There was 
evidence that V. vulnificus growing in vitro had a faster growth rate than in vivo (14).  
The difference in V. vulnificus numbers in oysters may be attributed to oyster defense 
mechanisms, specifically in hemocytes which posses strong phagocytic properties and 
play a role in the survival of V. vulnificus in oyster tissues (47).  Vibrio specific 
Bacteriophages are another factor that may effect populations of V. vulnificus within 
oysters (39).   
 
60
 The decrease in the persistence of viable V. vulnificus cells by one to two orders 
of magnitude was observed when oysters were transferred to cold temperature (4?C).  
This result is in agreement with Kasper and Tamplin (81), who reported one log 
reduction of natural V. vulnificus numbers during cold storage at 4?C.  The same authors 
also concluded that this temperature is critical to control V. vulnificus growth in oyster 
shellstock.  In this study, however, the reduction observed at this level would still leave 
large concentrations of V. vulnificus remaining in oysters.  These data show that the 
endogenous population of V. vulnificus might behave similarly to the laboratory grown 
culture when it responded to the cold during embedded in oysters.  
 Vibrio vulnificus remained culturable but no growth was observed when oysters 
were transferred to 15?C.  After a temperature down shift from 15?C to 4?C for one 
week, V. vulnificus numbers in oysters decreased by less than a half log unit.  This result 
showed that V. vulnificus final counts at this temperature condition (15?C to 4?C) was 
one log higher in cell survival when compared with 35 and 25?C to 4?C. Data presented 
here documented cell adaptation to cold temperatures since 15?C enhanced cell 
culturability.  This finding is in agreement with Datta and Bhadra (36) who reported that 
priming of cells at 15?C allow bacteria to adapt and grow at 10?C.  Exposure to an 
intermediate temperature (15?C) may cause a cold adaptive response helping                  
V. vulnificus remain in the culturable state when exposed to a much colder temperature 
(17).  It is well documented that low temperatures can cause V. vulnificus cells to enter 
the viable but non-culturable (VBNC) state (182, 185).  The decrease in cell culturability 
that was observed under refrigeration conditions during the study could be attributed to 
the VBNC state (131).  The methodology used only accounted for culturable cells and the 
 
61
effect, if any, of the VBNC was not measured.  If the reduction in number of cells was by 
a reversion into the VBNC state, no net reduction may have occurred.  Further 
investigation is necessary to evaluate the VBNC state during cold shock under shellstock 
temperature control recommended by ISSC.  Moreover, the pH of the oysters slightly 
decreased throughout the cold shock study but probably did not effect V. vulnificus 
growth and survival in the current study.  Optimum pH for V. vulnificus growth is around 
pH 7 and minimum growth pH is pH 5.0 (95).  Goatcher (49) found pH not to be a factor 
in vibrio cell death in oysters following cold shock. 
It was clear in this in vivo study that the capability for this pathogen to survive in 
oysters at cold temperature for a considerable period of time exists.  Based on this result 
high temperatures and cold adaptation conditions should be avoided to reduce                
V. vulnificus numbers in oysters.  This study suggests that cooling oysters at 4?C after 
harvesting could limit the multiplication of V. vulnificus while embedded in oyster 
shellstock, but might not be effective in order to reduce V. vulnificus numbers to the 
recommended limit by FDA (<30 CFU/g oyster).  The guideline from ISSC should be 
evaluated due to the potential for cold adaptation-mediated survival of V. vulnificus.   
 
 
 
 
 
62
0
1
2
3
4
5
6
0 20 40 60 80 100 120 140 160 180
Hour
l
o
g 
C
F
U
/
g oyster m
e
at
Total bacteria
Vibrio count
Vibrio vulnificus
 
Fig. 15. Total heterotrophic bacteria, total Vibrio, and V. vulnificus (CFU/g oyster meat) 
during depuration of eastern oysters (Crassostrea virginica). 
 
pH of oysters meat during cold shock
6
6.1
6.2
6.3
6.4
6.5
6.6
6.7
6.8
6.9
7
01234567
sampling point
p
H
15 degree C
25 degree C
35 degree C
 
 
Fig. 16.  pH of oyster meat during cold shock experiment, vertical arrow indicated cold 
shock point.  
 
63
At 35?C for 10h and cold shocked at 4?C for 168h
4
4.5
5
5.5
6
6.5
7
0 20 40 60 80 100 120 140 160 180 200
Hour
l
og C
F
U
/
g
 oyst
er 
ATCC 27562 C7184Tr VV3
 
 
FIG. 17. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
and VV3 in oysters when oysters were incubated at 35?C for 10 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
At 25?C for 12h and cold shocked at 4?C for 168h
4
4.5
5
5.5
6
6.5
7
0 20 40 60 80 100 120 140 160 180 200
Hour
l
og C
F
U
/
g 
oy
s
t
er
 
ATCC 27562 C7184Tr VV3
 
 
FIG. 18. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
and VV3 in oysters when oysters were incubated at 25?C for 12 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
64
At 15?C for 36h and cold shocked at 4?C for 168h
4
4.5
5
5.5
6
6.5
7
0 20 40 60 80 100 120 140 160 180 200 220
Hour
l
o
g
 C
F
U
/
g 
oys
t
e
r
 
ATCC 27562 C7184Tr VV3
 
 
FIG. 19. Cold shock-survival response of V. vulnificus strain ATCC 27562, C7184Tr, 
and VV3 in oysters when oysters were incubated at 15?C for 36 h and cold shocked at 
4?C for 168 h, vertical arrow indicated cold shock at 4?C. 
 
 
 
 
 
 
 
 
 
 
 
 
 
65
V. IN VITRO COLD SHOCK GENE EXPRESSION OF 
VIBRIO VULNIFICUS 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
66
ABSTRACT 
 
 Four cold shock genes (csp
s
) encoding small cold shock proteins of V. vulnificus 
were cloned.  In vitro gene expression of csp
s
 and stress-related genes in four different 
strains of V. vulnificus was analyzed by reverse transcriptase PCR.  Two different 
temperature profiles were compared.  First, V. vulnificus cultures were incubated at 35?C 
for 10 h and then cold shocked at 4?C for 168 h.  The transcript levels of csp5, and a 
stress regulator gene, rpoS, were found to be constant in both clinical and environmental 
strains throughout the study.  The synthesis of katG, a catalase gene, was detected at 
different time points after cold shock, while the transcript of oxyR, a transcriptional 
activator of oxidative stress response, was expressed at all time points.  The induction of 
csp1 and csp3 varied among strains, while csp4 transcript was down-regulated after cold 
shock in all strains.  In the second experiment, after overnight incubation at 35?C,          
V. vulnificus cultures were transferred to 15?C for 36 h and then cold shocked at 4?C for 
168 h.  A constitutive expression of csp1 and rpoS was observed, while transcription of 
csp3 and csp5 was discontinued after cold shock at 4?C.  The synthesis of oxyR mRNA 
was induced during the acclimation step at 15?C.  KatG gene expression was induced 
after shift to 4?C in some strains.  The expression of csp4 was repressed after cold shock 
at 4?C.  The constitutive expression of 16SrRNA indicated that V. vulnificus was viable 
during cold shock treatment.  These results revealed that gene expression in V. vulnificus 
varied during cold shock in vitro.  It can be concluded that the cold shock genes of         
V. vulnificus tested in this study are not cold inducible. 
 
 
67
INTRODUCTION 
 
Temperature has wide-ranging effects on microbial growth and survival, and 
therefore, bacteria have developed responses that allowed them to adapt to change in 
temperature.  Bacteria can exhibit a cold shock response by altering gene expression in 
response to a shift to low temperature (6, 7, 55, 80, 109, 140).  Cold shock response 
inhibits the synthesis of most cellular proteins resulting in a growth lag period, called 
acclimation phase (72).  Cold shock proteins are synthesized to overcome the deleterious 
effects of cold shock (146).  Cold shock proteins (Csps) are small proteins (around          
7 kDa) and the Csp family has been found in nearly all bacteria (41).  Several functions 
have been postulated for Csps.  These proteins could act as a transcription activators, 
RNA chaperones and could help to minimize secondary folding (55, 56).  Moreover, 
Csps has been reported to play a role in protection against freezing (186).  Csps are not 
expressed only at low temperatures; they are also induced by other environmental 
stresses.  Most of the cold shock response studies have been performed with     
Escherichia coli and Bacillus subtilis as model systems (51).  Out of the nine Csps found 
in E. coli, five were not induced at low temperatures.  CspA is considered essential for 
cold adaptation and has been found to be expressed during the stationary growth phase 
(50, 146).  CspD was induced when under nutritional stress during the stationary growth 
phase (190).  Bacillus subtilis possesses three Csps: CspB, CspC, and CspD that are 
induced upon cold shock (57).  Recently, Datta and Bhadra (36) investigated the major 
cold shock proteins in V. cholerae and reported that when V. cholerae cells were shifted 
from 37?C to 15?C, CspV and CspA were produced at low temperature and concluded 
 
68
that cspV was a cold shock inducible gene and was tightly regulated at the transcription 
level. 
Vibrio vulnificus is a gram negative naturally occurring bacterium that causes 
septicemia, wound infections, and gastroenteritis.  Transmission typically occurs through 
ingestion of contaminated raw or undercooked seafood, especially raw oysters harvested 
from the Gulf of Mexico during warm weather months (151).  Vibrio vulnificus infections 
can develop into a fatal septicemia, especially in patients who suffer from immune 
disorders, liver disease, or hemochromatosis with death occurring within 48 h after onset 
of symptoms (48).  The incidence of outbreak of V. vulnificus due to oysters is a 
significant concern of the oyster industry and public health agencies.  Numerous studies 
have investigated the response of V. vulnificus to low temperatures (17, 110, 118, 128, 
130, 149, 181, 185) although most of these studies focused on the viable but non-
culturable (VBNC) state that can be induced in V. vulnificus when subjected to low 
temperatures.  This VBNC state might explain the difficulty of culturing this bacterium 
from marine samples during winter months (for a recent review on the VBNC state see 
Oliver, 2005 (131)).  However, the VBNC state is not the only response to cold 
temperatures observed in V. vulnificus.  In 1995, McGovern and Oliver (110) showed that 
when V. vulnificus is subjected to a temperature downshift from 23?C to 13?C, protein 
synthesis is reduced but new cold-induced proteins are expressed.  In addition, an 
adaptive response to cold temperatures in V. vulnificus has been described by           
Bryan et al.(17).  Their study showed that V. vulnificus cells shifted from 35?C to 4?C 
entered the VBNC state in few days.  However, when cells were acclimated from 35?C to 
15?C and then shifted to 6?C, they remained viable for the duration of the study.  Their 
 
69
results also suggested that cold-induced proteins played a role in this cold adaptive 
response.  However, no evidence of a cold shock inducible gene was reported and no 
gene involved in the cold shock response in V. vulnificus has yet been identified.  To 
date, the molecular mechanisms by which V. vulnificus adapt to low temperature are not 
well understood.  To better explain the physiological mechanisms response to cold shock 
at the molecular level, the small cold shock family genes (csp
s
) obtained from two 
clinical and two environmental strains of V. vulnificus were cloned.  Analysis of             
V. vulnificus cold shock genes encoding cold shock proteins (Csps) that exhibited 
significant increased or decreased in mRNA abundance caused by the temperature 
downshift were performed.  Moreover, rpoS, the stress regulator which is used by 
bacteria in the adaptive response through various environmental stresses was examined.  
KatG, a periplasmic catalase gene (HPI) and oxyR, a positive regulator of catalase gene 
(both involved in oxidative stress) were also analyzed in response to exposure to cold 
temperature.  Reverse transcription PCR was used to analyze gene expression of all these 
genes in all strains used in this study. 
 
 
 
 
 
 
 
 
 
70
MATERIALS AND METHODS 
 
1) Cloning of the small cold shock family genes (csp
s
) of V. vulnificus  
 
Bacterial strains and growth conditions 
 
Two clinical strains of V. vulnificus, ATCC 27562 (type strain), and C7184Tr 
(avirulent, translucent morphotype, provided by J.D. Oliver, University of North 
Carolina, Charlotte, NC) were used in this study.  Two environmental strains (VV3, 
VV4) isolated from oyster samples collected from Mobile Bay, AL were also included.  
Cells were grown in marine broth (Difco, Detroit, Mich.) at 35?C. 
 
Primer design 
  
 Putative cold shock genes were identified in V. vulnificus based on amino acid-
amino acid similarities with V. cholerae cold-shock proteins (Table 1).  Open reading 
frame (ORF) sequences from five putative cold shock genes (csp1-5), (see Appendix 2 to 
6), were obtained from the whole V. vulnificus genome sequence available at the National 
Center for Biotechnology Information (NCBI) (GenBank accession no. NC0044459, 
NC004460 for V. vulnificus CMCP6, and GenBank accession no. NC005139, NC005140 
for V. vulnificus YJ016) (23, 91) (Table 2). 
 
 
 
71
DNA extraction 
 
DNA was extracted from the four strains of V. vulnificus (ATTC 27562, C7184Tr, 
VV3, and VV4) using DNeasy kit following the manufacturer?s instructions (QIAGEN, 
Valencia, CA).  Briefly, 1.5 ml of V. vulnificus cells were placed in a 2 ml 
microcentrifuge tube centrifuged for 10 min at 3,000?g.  The supernate was extracted and 
resulting pellet was resuspended in 180 ?l of buffer ATL, plus 20 ?l of proteinase K     
(10 mg/ml).  The sample was incubated at 55
o
C for 3 h until cells were completely lysed 
or appeared viscous.  Samples were vortexed for 15 s, with 200 ?l of lysis buffer, 
followed by incubation at 70?C for 10 min.  The resulting DNA precipitated with 200 ?l 
ethanol 95% (vol/vol).  Washing buffers (AW1 and AW2) were added sequentially to the 
DNeasy Mini spin column and centrifuged at 3,500?g.  The supernatants were discarded, 
and the DNA was resuspended in distilled water.  DNA was quantified by Gene Quant 
spectrophotometer (Amersham Pharmacia Biotech, Sweden) and stored at -20?C for 
amplification. 
  
 PCR condition and DNA amplification 
 
Genes were PCR amplified in a total volume of 50 ?l.  Unless otherwise stated, 
all PCR reagents were purchased from Promega (Promega, Madison, WI).  One hundred 
ng of DNA were used as template in a reaction containing; 0.2 U of Taq polymerase,    
0.2 mM of dNTP mix, 1X PCR buffer, 2.5 mM MgCl
2
 and 0.2 mM of each primer.  
Primers were designed in order to amplify the entire ORFs (Table 2).  The reaction mix 
 
72
was cycled through the following temperature profile: 95?C for 5 min; 95?C for 30 sec, 
50?C for 30 sec, 72?C for 45 sec for a total of 35 times.  The PCR reaction was ended at 
72?C for 10 min and thereafter cooled down to 4?C.  PCR products were analyzed 
through a 1% agarose gel.  Gels were run for about 60 min at 102 V in TAE 1X buffer 
(0.04 M Tris/acetate, EDTA 1mM) mixed with ethidium bromide (0.5?g/ml).  A 100-bp 
ladder was used as a standard marker.  Following electrophoresis, the PCR products were 
visualized under a UV (245 nm) transilluminator. 
  
 DNA purification 
 
The selected DNA bands were purified from the gels using the GENECLEAN III 
kit (Q-BIO gene, Carlsbad, CA) followed the manufacturer?s instruction.  The DNA band 
from the agarose gel was excised and transferred to polypropylene tube.  Six hundred ?l 
of NaI solution was added to cover the gel and incubated at 50
o
C in water bath for 5 min.  
After the agarose block was melted, the NaI/DNA solution was resuspended with 5 ?l of 
EZ-GLASSMILK, mixed by vortexing 1 min, and the NaI/DNA/EZ-GLASSMILK 
solution was incubated at room temperature for 5 min (vortexed every two min).  The 
solution was centrifuged at 11,000?g for 5 sec, the supernatant was discarded, and the 
pellet containing the EZ-GLASSMILK with bound DNA was saved.  The washing step 
was done twice by adding 500 ?l of provided washing solution, then the solution was 
resuspended and centrifuged at 10,000?g for 5 sec, and the supernatant was discarded.  
The resulting pellet was air dried and resuspended in 5 ?l of ddH
2
O.  After centrifugation 
 
73
at 11,000?g for 1 min the supernatant of DNA was removed and transferred to a new 
tube. 
  
 Cloning procedure  
 
Ligation of purified DNA to linearized plasmid 
 
The ligation mixture was prepared by using PGEM-T-easy vector system 
(Promega).  The mixture of 5 ?l of Genecleaned DNA from purification step included     
1 ?l of pGEM-T easy vector (50ng/?l), 5 ?l of 2X rapid ligation buffer, and 1 ?l of          
T4 DNA ligase (3U/?l) was incubated at room temperature for 3 h. 
 
Transformation  
 
The ligation mixture was mixed with 50 ?l of JM 109 competent cells (Promega) 
and incubated on ice for 20 min.  The bacterial-plasmid mixture was heat shocked by 
placing the mixture in a 42?C water bath for 45 sec without shaking.  Tubes were 
removed and incubated on ice for another 5 min.  The transformed bacterial mixture was 
pooled in a tube containing 900 ?l Luria-Betani Medium (LB), incubated in a water bath 
at 37?C for 1 h, centrifuged for 1 min at 500?g, and resuspended in 75 ?l of LB.  
 
 
 
 
74
Plating of recombinant E. coli cells 
 
Transformed E. coli cells were plated onto LB + ampicillin + IPTG/X-GAL agar 
and incubated at 37?C for 16-18 h for blue/white screening.  White colonies were picked 
using a toothpick.  Each colony was transferred to 5 ml LB broth/ 5?l ampicillin 
(50mg/ml), and incubated at 37?C for 16-18 h.  Two ml of cell cultures were kept in 10% 
sterile glycerol at -80?C, while 3 ml of the cultures were used for plasmid isolation. 
  
 Plasmid isolation 
  
 Aurum
TM
 plasmid mini kit (Bio-Rad laboratories, Hercules, CA) was used for 
plasmid isolation.  Briefly, 1.5 ml of cell cultures was pelleted by centrifugation at 
11,000?g for 5 min at room temperature, and the supernatant was removed by pipetting.  
Bacterial cell pellets were resuspended in 250 ?l of resuspension solution by vortexing.  
The suspensions were mixed with 250 ?l of lysis solution until the solution became 
viscous and slightly clear.  The solutions were mixed with 350 ?l of neutralization 
solution until a visible precipitate was formed.  Then the neutralized lysate was 
centrifuged for 5 min.  The supernatant (plasmid DNA) was washed twice with washing 
solution via a plasmid mini column then transferred to a new 1.5 ml eppendorf tube.  
Fifty ?l of sterile deionized water was added to the column, incubated for 1 min, and 
centrifuged to elute the plasmid.  The mini column was discarded and the eluted plasmid 
DNA stored at 4?C.  Plasmid DNA samples were quantified using a GeneQuant 
Spectrophotometer (Amersham Pharmacia Biotech).  Plasmid DNA was stored at -20?C. 
 
75
 Clone characterization/testing 
 
In order to check the presence of insert, the EcoRI restriction digestion analysis 
was performed.  The plasmid vector has two EcoRI restriction sites on its sequence.  
DNA sequences were inserted between these two EcoRI recognition sites.  The EcoRI 
restriction digestion was used to digest the ligated DNA insert.  Briefly, a mixture of 5?l 
of plasmid DNA, 1 ?l of EcoRI enzyme (12U/?l), 2 ?l of 10X buffer and 12 ?l of 
deionized water was incubated at 37?C for 4 h.  The restriction digestion products were 
resolved on 1 % agarose gels at 102 V in TAE 1X buffer (0.04 M Tris/acetate, EDTA 
1mM) stained with ethidium bromide (0.5?l/ml) for 30 min.  A 100-bp ladder was used 
as a standard marker.  Following electrophoresis, the gel was visualized under a UV   
(245 nm) transilluminator.  
  
 Sequencing and alignment    
 
 Plasmid concentrations were adjusted to 200 ng/?l and sequenced at the Auburn 
University Genomics & Sequencing Lab (AU-GSL) using the T7 promoter and the ABI 
3100 Genetic Analyzer.  The sequences were assembled and aligned with the Vector NTI 
Advance 9.0 software (Informax, Frederick, MD).  The nucleotide sequences of the csp 
genes of V. vulnificus were compared with that of other bacterial species using the 
BLAST program (Basic Local Alignment Search Tool) (1).  
 
 
 
76
In vitro gene expression of cold shock genes and stress-related genes of V. vulnificus 
during cold shock 
 
 Bacterial collection during cold shock treatment 
 
 Expressions of four putative cold shock genes (csp
s
) and additional genes 
involved in stress response; rpoS, oxyR, and katG of V. vulnificus were investigated under 
cold shock conditions.  In order to mimic the conditions V. vulnificus might experience 
under the ISSC guidelines, the experiment used the following temperature profiles: a) 
cells (10
4
 CFU/ml) were incubated at 35?C for 10 h and b) at 15?C for 36 h, and then 
transferred to an incubator shaker at 4?C for up to 168 h.  Samples were taken at different 
time points and kept in RNAlater RNA stabilization solution (Ambion, Austin, TX.) and 
stored at 4?C until RNA isolation analysis.  All four strains were analyzed 
simultaneously. 
  
 Total RNA isolation and DNA elimination   
 
 RNA Plus mini kit (QIAGEN, Valencia, CA) was used to extract total RNA from 
all the bacterial samples (according to the manufacturer?s protocol).  Each bacterial 
sample was homogenized using QIAshredder homogenizers, and the lysate transferred to 
a gDNA Eliminator spin column.  The column was centrifuged at 5,600?g, then 
discarded.  The filtrate was mixed with 70% ethanol, and 750 ?l of the sample was 
transferred to an RNeasy spin column, and centrifuged for 15 sec at 5,600?g.  The filtrate 
 
77
was discarded.  Seven hundred ?l of buffer RW1 was added to the column, and 
centrifuged at 5,600?g for another 15 sec to wash the spin column membrane.  The 
filtrate was discarded.  Then 500 ?l of Buffer RPE was added to wash the column and 
centrifuged at 5,600?g.  This wash step was repeated once.  Then the RNA was eluted 
with 50 ?l RNase-free water by centrifugation.  RNA concentrations were quantified 
spectrophotometerically and stored at -80?C.  In order to eliminate carryover DNA in the 
RNA extract, 1 ?g of RNA was treated for 30 min at 37?C with 150 U of DNase 
(Ambion).  The DNase was then inactivated by heating at 65?C for 10 min. 
  
 Reverse transcriptase PCR 
 
The presence and expression of csp1, csp3, csp4, csp5, rpoS, oxyR, and katG was 
tested using reverse transcriptase-PCR (RT-PCR) amplification.  cDNA was synthesized 
using the cDNA synthesis kit (Amersham Biosciences, Piscataway, NJ).  According to 
the manufacturer?s instructions, random hexamers were used to synthesize the first strand 
cDNA.  Twenty ?l of RNA solution (5?g total RNA plus RNase-free water) was heated 
to 65?C for 10 min, and then was chilled on ice.  The cDNA synthesis reaction mixture 
consisted of 20 ?l total RNA (3 ?g/?l), 1 ?l of primer, 1 ?l of DDT solution, and 11 ?l of 
Bulk first-strand reaction mix.  The cDNA synthesis reaction was incubated at 37?C for 
1h, then the completed first-strand reaction was heated to 90?C for 5 min to denature the 
RNA-cDNA duplex, and the reverse transcriptase was inactivated and chilled on ice.  
PCR amplification was performed as followed: 2 ?l of the cDNA was used as 
template.  Primers targeting the eight genes were used for specific PCR (Table 3).  The 
 
78
absence of DNA contamination in RNA samples was verified by PCR using RNA as a 
template and internal control primers UFUL and URUL.  A PCR negative control (no 
nucleic acid template) was also carried out.  V. vulnificus DNA was used as a positive 
control for PCR.  The expression level of the 16SrRNA gene was used as constitutive 
expression control (internal control) in the RT-PCR.  All PCRs and RT-PCR were 
conducted using the appropriate annealing temperature according to the primer set used.  
PCR amplification followed this profile: initial heating step at 95?C for 5 min followed 
by 35 cycles of denaturation (95?C for 30 sec), annealing (temperature varying according 
to the primers used (Table 3) for 30 sec), and extension (72?C for 45 sec).  The final 
extension ended at 72?C for 10 min and thereafter cooled to 4?C.  The amplification 
product was separated by horizontal gel electrophoresis in a 1 % agarose gels at 102 V in 
TAE 1X buffer (0.04 M Tris/acetate, EDTA 1mM) stained with ethidium bromide 
(0.5?l/ml) for 30 min.  A 100-bp ladder was used as a standard marker.  Following 
electrophoresis, the gel was visualized under a UV light (245 nm) transilluminator.  
 
RESULTS 
 
Cloning of csp
s
 genes from V. vulnificus  
 
By comparing the genome sequence of V. vulnificus strain YJ016 and CMCP6 
(23, 91) with V. cholerae, several putative cold shock genes were identified.  Using  
sequence data for the whole genome of V. vulnificus strain YJ016 and CMCP6 (23, 91), 
four putative cold shock genes in V. vulnificus YJ016 and five putative cold shock genes 
 
79
in V. vulnificus CMCP6 were recognized (Table 2, nucleotide sequence see appendix     
2-6).  The four putative cold shock genes obtained from strain YJ016 shared 100% 
nucleotide similarity with those of strain CMCP6.  These five predicted cold shock genes 
encoding for cold shock proteins were designated as csp1, csp2, csp3, csp4, and csp5.  
The entire sequences csp1 to 5 of V. vulnificus were amplified from clinical            
(ATCC 27562, C7184Tr) and environmental strains (VV3, VV4).  All V. vulnificus 
isolates produced PCR products of the expected size, except csp2.  This gene identified in 
CMCP6 strains was not found in any of the four V. vulnificus strains analyzed, and 
therefore was not included in the study.  PCR products of these four cold shock genes 
were amplified from the clinical and the environmental strains of V. vulnificus and were 
cloned.  The isolates were sequenced and the amplified DNA sequences were compared 
for homologous amino acid sequences using BLAST.  A BLAST-X analysis of predicted 
Csp sequences indicated that Csp1 obtained from V. vulnificus ATCC 27562, C7184Tr, 
VV3 and VV4 strains was 100% identical to cold shock protein of V. vulnificus CMCP6 
and YJ016 (GenBank accession number NP761574 and NP 934297), and 81.4% identity 
to cold shock transcriptional regulator CspA from V. cholerae (TIGR accession number 
VCA0166).  Csp3 showed 98% similarity with the sequence of cold shock-like protein, 
CspD of V. vulnificus CMCP6 and YJ016 (GenBank Accession number NP760979 and 
NP935117), and 81.6% identity to the cold shock-like protein from V. cholerae CspD 
(TIGR accession number VC1142).  Csp4 protein sequence revealed 98% matching with 
the protein sequence of V. vulnificus cold shock protein from GenBank accession number 
NP762479 and 937123, and was 88.4% identical to a cold shock DNA-binding domain 
protein of V. cholerae (TIGR accession number VCA0184).  The deduced sequence of 
 
80
Csp5 was found to be 98% identical to cold shock protein of V. vulnificus CMCP6 and 
YJ016 (GenBank accession number NP762464 and NP937108), and was 85.7% identity 
to cold shock protein CspV of V. cholerae (TIGR accession number VCA0933)       
(Table 1).  The deduced amino acid sequences for csp1, csp3, csp4, and csp5 resulted in a 
7 to 8 kDa proteins.  The csp1 and csp3 genes are presented in the large chromosome 
(chromosome I), whereas the csp4 and csp5 are presented in the small chromosome 
(chromosome II).  The M
w
 and isoelectric point (pI) were also calculated and found to be 
similar to the values described for V. cholerae CSPs (Table 1) (36).  
 
In vitro expression of cold shock genes and stress-related genes of V. vulnificus 
during cold shock 
 
Gene expression analysis of cold shock genes and stress-related genes were 
investigated in pure culture using RT-PCR technology at two different temperature 
profiles.  In the first experiment, V. vulnificus was incubated at 35?C for 10 h (T
0
) and 
cells transferred to 4?C for one week.  The mRNA transcripts of the 16SrRNA (house 
keeping gene), rpoS, a stress regulator gene, and csp5, a cold shock gene were detected 
and remained constant through the temperature downshift.  Expression levels of the 
transcriptional activator of oxidative stress response, oxyR, were also detected at all time 
points although some intensity variations were observed.  The expression of csp1 and 
csp3, encoding cold shock proteins of V. vulnificus varied between strains.  Csp1 and 
csp3 mRNA synthesis was induced 24 h after cold shock only in C7184Tr strain.  These 
genes appeared to be constitutively expressed in ATCC 27562 and in both environmental 
 
81
strains.  In addition, induction of katG (a catalase gene) was observed in all strains of     
V. vulnificus but at different time points after cold shock from 35?C to 4?C.  In contrast, 
cold shock appeared to repress csp4 expression in all V. vulnificus strains used (Figure 
20-21). 
The second experiment investigated gene expression when aliquots of V. 
vulnificus cells grown overnight at 35?C (T
0A
) were transferred to 15?C for 36 h (T
0B
), 
and then cold shocked at 4?C for one week.  Continuous expression of 16SrRNA, rpoS, 
and csp1 was observed at 35?C, 15?C, and 4?C in clinical and environmental strains 
across the duration of the study.  Additionally, csp3 and csp5 transcripts were constantly 
detected from 35?C through the acclimation period at 15?C and then at 4?C although 
some variations in expression levels at 4?C were observed.  Csp4 expression was 
detected during the first cold shock (35?C to 15?C) and was down-regulated after 
transferred to refrigerate conditions.  OxyR and katG showed different patterns of gene 
regulation.  While oxyR mRNA was induced during the acclimation phase at 15?C, katG 
mRNA was induced after downshift to 4?C in some strains.  Once expression of oxyR 
occurred, gene expression remained fairly constant in all strains.  Interestingly, katG 
showed an induction pattern 48h after cells were transferred to 4?C only in the 
environmental strain VV3.  On the contrary, VV4 expressed katG immediately after cold 
shock at 4?C but transcripts levels steady decreased overtime.  Expression of katG in 
clinical strains was seldom detected (Fig.22-24).  
 
 
 
 
82
DISCUSSION 
 
Several food-borne pathogens have been reported to manifest their tolerance to 
cold temperatures by altering their cellular protein profiles and continuing to grow (6, 36, 
55, 75, 90).  The cold shock response is a physiological response of living cells to 
temperature downshift which involves de novo protein synthesis  (52, 54, 123).  From 
this current study, RT-PCR analysis revealed that csp
s
 transcripts were constitutively 
expressed before and after cold shock with a few exceptions.  Expression of csp1, csp3, 
and csp5 was detected at all sampling times in strains ATCC 27562, VV3 and VV4 with 
or without the 15?C cold adaptation period.  Interestingly, csp1 and csp3 were not 
expressed in the avirulent mutant C7184tr at 35?C but was induced 24 h post cold shock.  
However, csp1 and csp3 expression was detected in C7184Tr during the 15?C adaptation 
period.  The induction of csp1 transcript (homologous to cspA) in C7184Tr strain which 
has a translucent morphotype after cold shock may be essential for cell protection during 
cold adaptation.  It is believed that the cold shock response serves as an adaptive function 
and it has been suggested that cspA, together with other csp
s
, played a role in protecting 
cells from damage due to cold stress.  The increased levels of cspA after cold shock have 
been reported to be necessary for compensating for higher stability of secondary 
structures in RNA at low temperature.  The expression of V. vulnificus csp1 and csp5 
(homologous genes to cspA and cspV, respectively) remained constant despite cold 
shock.  This current result contrast the data reported from V. cholerae response to cold 
shock.  Datta and Bhadra (36) reported a strong induction of cspA and cspV after cold 
shock at 15?C.  The current result seems to indicate V. vulnificus cold shock response is 
 
83
different from that trigger in V. cholerae.  These present findings showed that all            
V. vulnificus cold shock genes tested in this study are not cold inducible.  Csp4 showed a 
different expression pattern in all strains.  This gene was expressed at 35?C and 15?C but 
its expression faded away 24 to 48 h post cold shock at 4?C.  Despite sequence similarity 
with other cold-inducible genes, csp1, csp3, csp4, and csp5 cannot be considered class I 
csp genes (173), since no upregulation by cold shock was observed.  Similarly, no 
differences in induction levels were detected (although some genes seemed to be 
repressed overtime at 4?C) and therefore did not follow the expression pattern of csp 
class II genes either.  It can conclude that although V. vulnificus presented some of the 
csp genes described in other species, they are not upregulated during cold shock.  
In addition to csp
s
 gene expression this study investigated other genes that have 
been implicated in response to environmental stressors in V. vulnificus (70, 94, 142, 154).  
As expected rpoS, a general stress regulator, was constitutively expressed thorough the 
study (160, 161).  Generally, rpoS was expressed when response to various stress, 
including nutrient limitation, osmotic challenge, and during stationary growth phase 
(103).  This finding suggests that the presence of rpoS transcript may be significant for 
cell survival during cold stress.  OxyR regulated the expression of the periplasmic 
catalase (katG) in V. vulnificus and both genes have been shown to be repressed by low 
temperatures (94, 160).  The current data show that levels of oxyR transcripts increased 
after 4?C cold shock while katG expression was slightly induced at 4?C between 60 min 
and 72 h post cold shock depending on strain.  During the adaptation period at 15?C, 
oxyR was induced and reach high expression levels at 36 h.  Expression levels decreased 
at 4?C overtime, except in strain VV3 which displayed high levels of oxyR throughout the 
 
84
experiment.  The expression of oxyR, a peroxide sensor in this research indicated            
V. vulnificus may experience a H
2
O
2
 toxicity under aerobic condition during growing in 
culture broth.  Expression of katG during the 15?C period was weak but after cold shock 
at 4?C main differences were observed between strains.  While the type strain         
ATCC 27562 did not expressed this gene, a weak expression was detected in C7184Tr 
after cold shock.  Interestingly, VV3 and VV4 presented opposite expression patterns.  
KatG expression in VV3 was gradually induced after 6 h post cold shock.  On the 
contrary, VV4 exhibited high levels of katG immediately after cold shock but expression 
faded out until non-detectable levels at 168 h post cold shock.  Smith and Oliver (160) 
showed that katG expression could be detected in both clinical and environmental strains 
of  V. vulnificus up to 240 h post cold shock at 4?C.  However, these authors were 
inducing the VBNC state and cells were maintained in low nutrient medium.  In this 
present study use of rich medium might explain the differences in katG and oxyR 
expression since reactive oxygen species (ROS) between high and low nutrient media are 
likely to be different.  
Additionally, results show that the synthesis of the 16SrRNA housekeeping gene 
was never repressed following an abrupt temperature downshift.  This result is in 
agreement with previous studies where housekeeping genes were similarly expressed at 
optimal and low temperatures (72).  Detection of ribosomal mRNA is thought to be a 
good viability marker in many bacteria (13, 46, 93, 158).  The constitutive expression of 
16SrRNA mRNA indicated the viability of V. vulnificus occurred throughout the cold 
shock experiment.  
 
85
 In conclusion, no cold shock gene induction was observed in all four genes tested, 
although the differences in oxyR and katG expressions observed during cold shock 
suggest that V. vulnificus cells encountered not only cold stress but also oxidative stress.  
Further investigation of the role of these cold shock genes and stress-related genes and 
their regulation in V. vulnificus will help scientists to better understand the survival of 
this pathogen during cold shock. 
 
 
 
 
86
TABLE 1.  Computed theoretical pI and M
w
 values of cold shock proteins encoded by putative cold shock genes of V. vulnificus 
 
Gene  Chromosome pI M
w 
(KDa)
 
GenBank 
Accession 
no. 
Homologous gene in  
V. cholerae  
TIGR  
Accession no. 
V. cholerae * 
(36) 
% identity of  
amino acid 
with V. cholerae  
csp1 chromosome I 8.09 7.599 NP761574 cspA VCA0166 81.4 
csp3  chromosome I 6.03 8.398 NP760979 cspD VC1142 81.6 
csp4 chromosome II 6.54 7.521 NP762479 DNA-binding domain VCA0184 88.4 
csp5 chromosome II 8.12 7.554 NP762464 cspV VCA0933 85.7 
 
* TIGR, The Institute for Genome Research, from Datta and Bhadra (36) 
 
 
 
 
86
 
 
87
TABLE 2.  Primers design for cold shock genes of V. vulnificus 
 
 
Bacteria strain 
 
GenBank 
Accession  
 
Length 
bp 
 
Tm 
(?C) 
 
Primer sequences 
V. vulnificus CMCP6 
(Chromosome I) 
V. vulnificus YJ016 
(Chromosome I)    (a) 
VV12757 
 
VV1504 
213 50 ATGTCTGGTAAAATGACTGG 
TTAGATAACTGTAACGTTAGAA 
V. vulnificus CMCP6 
(Chromosome I)   (b) 
VV12532 
 
468 50 ATGAAAGGGAAGATTCTTCG 
CTACCAGCCGCCACATAA 
V. vulnificus CMCP6 
(Chromosome I) 
V. vulnificus YJ016 
(Chromosome I)   (c) 
VV12119 
 
VV2324 
 
231 50 ATGTATAGCATGGCTACAG 
TTACTTCGTTGCTTGTACTT 
 
V. vulnificus CMCP6 
(Chromosome II) 
V. vulnificus YJ016 
(Chromosome II)  (d) 
VV20519 
 
VVA1067 
 
210 50 ATGTCTAACACAGTAACCG 
TTAAAGCAGTGTGATCTCTT 
 
 
V. vulnificus CMCP6 
(Chromosome II) 
V. vulnificus YJ016 
(Chromosome II)  (e) 
VV20503 
 
VVA1052 
 
213 50 ATGTCTAATAAAGTAACTGGTT 
TTATAGCGCAGTTACGTTTG 
 
 
(a): designated csp1, (b): designated csp2, (c): designated csp3, (d): designated csp4, and 
(e): designated csp5 
 
88
TABLE 3.    Primers used for RT-PCR of cold shock genes and stress-related genes for the in vitro study 
 
Gene GenBank 
Accession 
Number 
Characteristics Size of  
amplified  
fragment  (bp) 
Tm (?C) 
 used in  
 RT-PCR 
Primer sequence  References 
csp1 VV12757 
VV1504 
Cold shock protein,  213 50 ATGTCTGGTAAAATGACTGG 
TTAGATAACTGTAACGTTAGAA 
This study 
csp3 VV12532 Cold shock-like protein 
(CspD) 
231 50 ATGTATAGCATGGCTACAG 
TTACTTCGTTGCTTGTACTT 
This study 
csp4 VV12119 
VV2324 
Cold shock protein 210 50 ATGTCTAACACAGTAACCG 
TTAAAGCAGTGTGATCTCTT 
This study 
csp5 VV20519 
VVA1067 
Cold shock protein 213 50 ATGTCTAATAAAGTAACTGGTT 
TTATAGCGCAGTTACGTTTG 
This study 
oxyR AY102627 Control katG 
expression, mediated 
catalase activity. 
496 57 CGAATACCTAGTGGCTTTGGC 
GCATGGCACAGCAACACTTA 
This study 
rpoS AY187681  Stress regulator 391 50 GTGCATTACGAGGCGATGAA 
ATTTTGCCCACATCGTCAAC 
This study 
katG VV12755 Catalase gene 504 57 GTTGGTACCTCAACTACCGC 
GGATGTCTAGATTGAGGGCC 
(142) 
16SrRNA X76333 
X76334 
Housekeeping gene 492 57 GCCTAACACATGCAAGTCGA 
CGTATTACCGCGGCTGCTGG 
(25) 
 
88 
 
89
16SrRNA  
    M       +        -        T
0
    15m  30m  60m    6h    12h    24h    48h    72h    96h   120h  144h  168h 
   ATCC 27562 
   C7184Tr 
   VV3 
   VV4 
 
csp1 
   M       +         -      T
0
     15m   30m   60m   6h     12h    24h   48h    72h   96h   120h  144h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
   VV4 
 
csp3 
  M        +        -       T
0
    15m   30m   60m   6h     12h    24h    48h   72h    96h   120h  144h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
   VV4 
 
 csp4 
      M      +        -       T
0
    15m  30m  60m    6h    12h   24h   48h   72h    96h   120h  144h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
   VV4 
 
csp5 
    M       +        -       T
0
     15m  30m  60m    6h    12h    24h    48h    72h   96h   120h  144h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
   VV4 
 
FIG. 20. Vibrio vulnificus gene expression profiles: internal control: 16SrRNA, and cold 
shock genes: csp1, csp3, csp4, and csp5 during cells were cold shocked from 35?C
10 h
 to 
4?C
168 h 
(T
0
: after 10 h incubation at 35?C, vertical arrow indicated cold shock at 4?C). 
  
 
90
rpoS 
  M        +      -         T
0
    15m   30m   60m    6h    12h    24h   48h    72h    96h  120h  144h  168h 
  ATCC 27562 
  C7184Tr 
  VV3 
  VV4 
 
oxyR 
 
      M       +        -       T
0
    15m   30m  60m    6h    12h    24h   48h    72h    96h  120h   144h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
  VV4 
 
katG 
 
     M       +       -        T
0 
   15m   30m   60m    6h    12h    24h   48h    72h   96h   120h  144h 168h 
  ATCC 27562 
  C7184Tr 
  VV3       
  VV4  
 
 
 
FIG. 21.  Vibrio vulnificus gene expression profiles: stress-related genes: rpoS, oxyR, and 
katG during cells were cold shocked from 35?C
10 h
 to 4?C
168 h
 (T
0
: after 10 h incubation at 
35?C, vertical arrow indicated cold shock at 4?C). 
 
 
 
 
 
 
91
 
 
FIG. 22.  Vibrio vulnificus gene expression profiles: internal control: 16RrRNA, and cold shock genes: csp1 and csp3 during cells 
were cold shocked from 35?C
10 h
 to 15?C
36 h
, and from 15?C
36 h
 to 4?C
168 h
 (T0
A
: after overnight incubation at 35?C, T0
B
: after  
36 h incubation at 15?C, the 1
st
 vertical arrow indicated cold shock at 15?C, the 2
nd
 vertical arrow indicated cold shock at 4?C).                  
        
91
 
 
92
 
 
 
FIG. 23.  Vibrio vulnificus gene expression profiles: cold shock genes: csp4, and csp5 during cells were cold shocked from 
35?C
10 h
 to 15?C
36 h
, and from 15?C
36 h
 to 4?C
168 h
 (T0
A
:  after overnight incubation at 35?C, T0
B
: after 36 h incubation at 15?C, 
the 1
st
 vertical arrow indicated cold shock at 15?C, the 2
nd
 vertical arrow indicated cold shock at 4?C).  
                           
 
 
92 
 
93
 
   
 
 
FIG.  24.   Vibrio vulnificus gene expression profiles: stress-related genes: rpoS, oxyR, and katG during cells were cold shocked 
from 35?C
10 h
 to 15?C
36 h
, and from 15?C
36 h
 to 4?C
168 h
 (T0
A
: after overnight incubation at 35?C, T0
B
: after 36 h incubation at 
15?C, the 1
st
 vertical arrow indicated cold shock at 15?C, the 2
nd
 vertical arrow indicated cold shock at 4?C).  
 
93
 
94
VI.   IN VIVO COLD SHOCK GENE EXPRESSION OF VIBRIO VULNIFICUS 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
95
ABSTRACT 
 
 Analysis of V. vulnificus gene expression in oysters (in vivo) during cold shock 
was performed at two different temperature conditions.  RT-PCR was used to analyze the 
presence and expression of cold shock genes (csp
s
) and stress-related genes of                
V. vulnificus in oysters.  During the first experiment, oysters were contaminated with              
V. vulnificus overnight at 25?C, transferred to 35?C for 10 h, and then cold shocked at 
4?C for 168 h.  Expression of 16SrRNA, a house keeping gene, and rpoS, a stress 
regulator was detected at all time points.  The induction of csp5, a cold shock gene 
occurred after cold shock at 4?C, while the expression of csp4 varied between strains.  
The expression of csp1, csp3, oxyR (which mediated catalase activity) and katG, a 
catalase gene were not detected throughout the study period in neither clinical nor 
environmental strains.  In the second experiment, oysters were contaminated with          
V. vulnificus and after overnight at 25?C, were cold adapted at 15?C for 36 h prior change 
to 4?C for 168 h.  Constitutive gene expression pattern of 16SrRNA was observed 
whereas rpoS exhibited discontinuous gene expression throughout the study period.  The 
transcript of csp5 was not continuous expressed at all time points.  The synthesis of csp3 
and csp4 mRNA was weakly expressed and varied among strains.  The expression of 
oxyR and katG mRNA was down-regulated during 35?C, 15?C, and in the cold.  These 
result demonstrated that V. vulnificus displayed variations of in vivo cold shock genes 
expression.  This is the first report on V. vulnificus gene expression under in vivo 
conditions. 
 
 
96
INTRODUCTION 
 
 Vibrio vulnificus, a mesophilic shellfish-borne pathogen, is present as natural 
microbiota in warm coastal waters throughout most parts of the world (22, 85, 133, 169, 
187).  V. vulnificus thrives in warm seawater and is frequently isolated from shellfish 
from the Gulf of Mexico (85).  Infection caused by this pathogen is a serious concern for 
the oyster industry and public health in the United States.  Most cases of illnesses or 
fatality occurred from consumption of raw oysters harvested from the Gulf region 
(Alabama, Florida, Louisiana, Mississippi, and Texas) and a few cases from oysters 
harvested from the Northeast, and the Northwest in the U.S. (19).  Primary septicemia, 
the most severe disease, was observed in individuals who had consumed raw oysters and 
was limited almost exclusive to persons with underlying liver disease (22).  The 
occurrence and prevalence of V. vulnificus is seasonal with numbers peaking in summer 
month, with a range from May to October (32, 85).  However, during the winter months, 
the decline in numbers of detectable V. vulnificus in coastal water and shellfish has been 
attributed to its entry into the viable but non-culturable (VBNC) state (30, 126).  
 Low temperature has been reported to be one of the most important factors in 
limiting V. vulnificus survival.  V. vulnificus was not capable of growing when incubated 
at temperature below 10?C, however low temperatures are not lethal to V. vulnificus (33) 
since cells can entry to the VBNC state when temperature is decreased below 5?C (185).  
Bryan et al. (17) reported that a brief cold adaptation period for 3 h at 15?C enhanced 
survival of V. vulnificus at 6?C.  They concluded that cold-adaptive protective proteins 
might enhance survival and tolerance at cold temperature.  Moreover, a downshift to low 
 
97
temperature has been previously considered to change protein expression in V. vulnificus 
(110).  The physiological response for survival strategy of living cells to temperature 
downshift have been reported in several bacteria (51).  Microbes exposed to abrupt 
temperature downshift underwent severe physiological disturbance, such as changes in 
supercoiled DNA, reduction in membrane fluidity, and the formation of stable secondary 
structures in DNA and RNA that impaired replication, transcription and protein synthesis.  
To overcome the injurious effects of cold shock and ensured that cellular activity will 
resume or be maintained at low temperature, bacteria have developed a transient adaptive 
response, the cold shock response (78, 141).  During that period, the expression of a 
subset of specific proteins termed cold shock proteins (Csps) is induced (146, 173).  Csps 
are widespread among bacteria (41) and are not only required during the cold shock 
adaptive response but also play a general role in cellular function adaptation to various 
growth conditions (40).  Cold shock has been shown to alter genes expression in many 
species of bacteria (6, 7, 55, 80, 109, 140).  However, little is known about V. vulnificus 
gene expression in response to cold shock.  Cold shock response in V. vulnificus has not 
been fully elucidated although this pathogen greatly impacts the oyster industry and 
public health.  The preventive measures suggested by USFDA/ISSC, required 
refrigeration of oysters after harvest, may potentially induce a cold shock phenomenon in 
V. vulnificus.  The molecular mechanisms of V. vulnificus response to cold shock need to 
be unraveled. 
 While several reports have been investigated in vitro and in situ gene expression 
of V. vulnificus during the VBNC state (46, 160, 161), in vivo gene expression of this 
pathogen has not yet been attempted under any conditions.  Since oysters can act as 
 
98
reservoirs and transmission vectors for V. vulnificus, it is crucial to study the cold shock 
gene expression while this pathogen is embedded in oysters.  Specifically, the 
investigation of cold shock response of V. vulnificus should be based on the result of the 
examination in oysters as results may differ from those obtained through artificial 
inoculation. 
 In an effort to elucidate the in vivo gene expression of V. vulnificus during cold 
shock, reverse transcriptase PCR (RT-PCR) technology was used to monitor the presence 
and the expression of cold shock genes (csp
s
), encoding cold shock protein, and stress 
related genes in two clinical and one environmental strains.  In this study, I examined the 
transcription of small putative cold shock family genes of V. vulnificus (csp1, csp3, csp4, 
and csp5), encoded for cold shock proteins.  In addition, rpoS, the stress regulator which 
is used by cells in adaptive response in various environmental stresses was monitored.  
KatG, a periplasmic catalase gene (HPI) and oxyR, a positive regulator of catalase gene 
which both involved in oxidative stress were analyzed in response to exposure to cold 
temperature.  
 
MATERIALS AND METHODS 
 
Bacterial strains and growth conditions  
 
 Two clinical strains of V. vulnificus, ATCC 27562 (type strain), and C7184Tr 
(avirulent, translucent morphotype) provided by J.D. Oliver, University of North 
Carolina, Charlotte, NC and one environmental strain (VV3) isolated from Mobile Bay, 
 
99
AL were used in these study.  Cells were grown in marine broth (MB) with shaking and 
maintained on marine agar (MA) (Difco, Detroit, MI) at 35?C   
  
 Oyster samples  
 
One-year-old live shellstock eastern oysters (Crassostrea virginica) (50-75 mm 
diameter) were depurated using a UV filtered (UV flow 3000 ?w-sec/cm
2
), with a water 
flow-through system (180 l/h) for 7 days at Auburn University Shellfish Laboratory 
(AUSL), Department of Fisheries and Allied Aquacultures, Dauphin Island, AL and 
transported immediately to the Bacterial Genomics Laboratory, Department of Fisheries 
and Allied Aquacultures, Auburn University for processing.  The oyster samples for each 
experiment were transported and stored at 4?C.     
 
Artificial inoculation 
 
Live depurated oysters were artificially-inoculated with V. vulnificus by self-
inoculation filtration.  Four aquaria (38 L) containing 27 L of autoclaved seawater were 
prepared.  One hundred fifty oysters were placed into each aquarium at 25?C and were 
allowed to acclimate for 24 h.  A fresh culture of each strain of V. vulnificus was grown 
in MB until exponential growth phase (10
8
 CFU/ml, OD
450
=0.15) was reached.  In each 
aquarium, 3 L of V. vulnificus cultures were used to inoculate oysters at approximately 
10
6
 CFU per gram of oyster.  Oysters with no V. vulnificus artificially inoculation 
(control) was prepared and acclimated at the same condition. 
 
100
Cold shock experiment 
 
After V. vulnificus inoculation, oysters remained at 25?C overnight prior to 
temperature downshift.  Two different cold shock conditions were compared.  During the 
first experiment oysters were transferred to 35?C for 10 h, and then chilled by ice-water 
immersion until the internal temperature in oysters reach to 4?C.  Oysters were placed in 
a low temperature incubator at 4?C and incubated for 168 h.  For the second experiment, 
inoculated oysters were transferred to 15?C for 36 h, chilled by ice-water immersion until 
the internal temperature reached 4?C.  Oysters were incubated at 4?C for an additional 
168 h.  Internal oyster temperature and external ambient air temperature were monitored 
throughout the study. 
 
 Reverse transcription-PCR (RT-PCR) detection 
 
(i) Sampling. 
 
The gastro-intestinal tract of oysters containing with V. vulnificus was sampled 
from these two different cold shock experiments.  Samples were collected at various time 
intervals from time 0 h to 168 h.  Three oyster gastro-intestinal tracts were pooled from 
each time point and kept in RNalater RNA stabilization reagent (Ambion, Austin, TX) 
and stored at 4?C
 
for further RNA extraction analysis.  
 
 
 
101
(ii) RNA isolation and contaminated DNA elimination 
 
Thirty milligrams of mixed tissue samples were used for RNA isolation.  RNA 
Plus mini kit (QIAGEN, Inc., Valencia, CA) was used to extract total RNA from all 
oyster samples (according to the manufacturer?s protocol, as described in Chapter IV).  
RNA concentrations were quantified in Gene Quant spectrophotometer and stored at        
-80?C until being processed.  In order to eliminate carryover DNA in the RNA extract,     
1 ?g of RNA was treated for 30 min at 37?C with 150 U of DNase (Ambion, Austin, 
TX). Treated RNA was heated at 65?C for 10 min to inactivate DNase. 
 
(iii) Reverse transcription or cDNA synthesis  
 
cDNA synthesized using the cDNA synthesis kit from Amersham Biosciences.  
The presence and expression of seven genes in V. vulnificus was investigated using RT-
PCR.  Primers targeting four cold shock genes plus three stress-related genes were used 
(Table 4).  The absence of DNA contamination in RNA samples was verified by PCR, 
using RNA as a template with primer target 16SrRNA universal primers (UFUL and 
URUL).  Negative controls with no template nucleic acid were carried out. V. vulnificus 
DNA was used as a positive control for the reaction.  Primers against V. vulnificus 
specific target sequences in the 16SrRNA gene were used to detect V. vulnificus 
constitutive gene expression.  All PCRs were conducted using the annealing temperature 
varying according to the primer set used.  PCR amplification consisted of the following 
temperature profile: initial heating step at 95?C for 5 min followed by 35 cycles of 
 
102
denaturation (95?C for 30 sec), annealing (temperature varying according to the primers 
used (Table 1) for 30 sec), and extension (72?C for 45 sec).  The final extension was 
ended at 72?C for 10 min and thereafter cooled to 4?C.  The amplification product was 
separated by horizontal gel electrophoresis in a 1% agarose gel and PCR products were 
visualized by ethidium bromide staining and UV translumination.  
 
RESULTS 
 
The initial mRNA analysis by RT-PCR was 18 h (overnight incubation) after 
oysters kept at 25?C were exposed V. vulnificus.  After treatment oysters were transferred 
to either 35?C for 10 h and 15?C for 36 h and downshifted to 4?C for one week.             
V. vulnificus displayed variations of in vivo cold shock genes expression after a 
temperature downshift.  During the first experiment, when oysters were transferred from 
25?C to 35?C for 10 h, and abruptly shifted to 4?C (Fig 23, 24), the expression of 
16SrRNA and rpoS were detected or constitutively expressed at all time points in both 
clinical (ATCC 27562 and C7184Tr) and environmental strain (VV3).  Both ATCC 
27562 and C7184Tr strains exhibited weak induction of csp4 transcript at 25?C whereas 
only C7184Tr transcript was induced at 35?C.  After a change to cold temperature, this 
gene was early induced (after 60 min at 4?C) in both ATCC 27562 and C7184Tr, while 
this transcript exhibited late expression after 168 h incubation at 4?C in VV3.  The csp5 
synthesis was early expressed after 30 min cold shock at 4?C in ATCC 27562, but 
detected later after 6 h cold incubation in both C7184Tr and VV3.  The transcript of csp1 
and csp3 were undetectable or down-regulated throughout the study period in both 
 
103
clinical and environmental strains.  The same expression pattern was shared by the two 
oxidative stress related genes, oxyR and katG which exclusively down-regulated during at 
35 or 15?C and in the cold.  
When oysters were transferred from 25?C to 15?C for 36 h and downshifted at 
4?C (Fig 25, 26), the synthesis of 16SrRNA was constantly expressed throughout the 
study period.  RpoS was also detected but showed different intensity in mRNA expression 
at all time points in both clinical and environmental strains.  The transcript of csp3 was 
induced at 25?C in both C7184Tr and VV3, but not in ATCC 27562. After a change from 
15?C to 4?C, this gene was weakly induced in both ATCC 27562 and C7184Tr, while it 
was not expressed in VV3.  The induction of csp4 mRNA was varied among strains.  In 
ATCC 27562, this gene was induced at 25?C, after 36 h incubation at 15?C and the early 
incubation at 4?C.  In C7184Tr, this gene was expressed at 25?C, the early period at 
15?C, and during the beginning at 4?C, while this gene was discontinuously induced after 
the oysters were incubated at 15?C and 4?C in VV3.  The transcription of csp5 was not 
continuously expressed at all time points in clinical strains, whereas this transcript was 
detected and showed discontinuous intensity in mRNA abundance after 1h change to an 
acclimation temperature (15?C) in environmental strain (VV3).  The synthesis of csp1, 
oxyR, and katG were down-regulated throughout the study period in both clinical and 
environmental strains.  
 
 
 
 
 
104
DISCUSSION 
 
Cold shock in microorganisms results in unstable metabolism and a longer lag 
phase.  However, microbial growth after cold shock incubation for a lengthy period of 
time suggested cellular adaptive mechanisms with an altered or unaltered metabolic 
recovery (143).  Therefore, the continued viability of V. vulnificus after incubation at 4?C 
demonstrated that V. vulnificus has the metabolic and genetic potential to survive at 
refrigerated temperatures.  This research showed that upon cold shock some genes 
underwent a transient induction, some of which were found to decrease after cold shock.  
Jones et al. (79) hypothesized that the level of transcription is an important mechanism of 
regulation of cold shock protein synthesis.  There was evidence that V. vulnificus survival 
and tolerance at cold temperature could be due to the expression of cold adaptive proteins 
(17).  In the present study, the csp genes, encoding cold shock proteins were differentially 
expressed in response to cold shock in vivo.  Some csp
s
 genes were repressed whereas 
others were induced after temperature downshift meaning that these small cold shock 
family genes include non-cold and cold shock inducible genes.  The repression of csp1, 
which has high sequence identity with cspA of V. cholerae occurred throughout the study 
period.  This was in contrast to the findings obtained in V. cholerae when cold shocked in 
vitro in which cspA was highly induced during exposure to a low temperature and weakly 
induced at 37?C (36).  In V. vulnificus the expression of csp3 and csp4 varied among 
strains from treatment to treatment.  The synthesis of csp3 (encoded CspD), was 
repressed when oysters were transferred from 25?C to 35?C and abruptly shifted to 4?C.  
However, this gene was weakly induced at 25?C and at 4?C in C7184Tr but only induced 
 
105
after a shift to 4?C in ATCC 27562.  The expression of csp4, 86% identical to cold shock 
DNA-binding domain protein obtained from V. cholerae, occurred at both optimal 
temperature and at low temperature, while csp5, 84% identical to CspV encoded cspV of 
V. cholerae was induced during cold shock in vivo.  This gene was detected at all time 
points but a discontinuous pattern was observed during cells adaptation to 15?C and to 
the cold. This result is in agreement with Datta and Bhadra (36).  These authors reported 
that cspV was induced only after exposure to low temperature (15?C) in vitro and 
concluded that it was truly a product of cold shock inducible gene.  
V. vulnificus possess one catalase gene: katG which is induced by H
2
O
2
.  KatG is 
regulated by alternative sigma factor, a product of the rpoS gene under control of oxyR 
(94).  It appeares that rpoS mRNA was expressed by all three V. vulnificus strains upon 
cold shock and growth at 35 or 15?C.  RpoS is involved in bacterial survival under stress 
conditions (70, 154, 192).  These results were similar as those previously reported during 
in vitro and in situ study (160, 161) suggesting that rpoS transcript plays a role in cell 
survival during both cold and optimal growth conditions.  KatG and oxyR genes, which 
are involved in oxidative stress, were not detected at all time points under any condition.  
Jenkins et al. and Altuvia et al. (2, 76) stated that the loss of oxyR induction was 
accompanied by decreased in katG expression and increased cellular sensitivity to H
2
O
2
, 
consistent with inadequate antioxidant defenses in these cells.  Also, low temperature has 
been reported in inhibiting oxyR mediated catalase activity in V. vulnificus (94).  Smith 
and Oliver (160, 161) investigated gene expression in vitro and in situ and reported that 
the expression of katG was decreased during winter months in the VBNC state of           
V. vulnificus.  These authors showed that when V. vulnificus was restored to higher 
 
106
temperatures (>20?C), it resulted in the induction of this gene.  The cold shock found in 
V. vulnificus has been described as a ?peroxide sensitive?(14), however, the 
disappearance of katG and oxyR transcript of V. vulnificus may be due to cells experience 
the absence of oxygen during persistence in oyster tissue.  
Last but not least, the constitutively expression of 16SrRNA of V. vulnificus was 
observed in this study.  The presence of this gene indicated viability of V. vulnificus cells.  
Oliver (131) indicated this is a key test to determine whether such cells were dead or 
alive. mRNA transcription has been reported to be a reliable marker of viable cells due to 
its short half life and its role in bacterial cell physiology (158).  Several studies have 
demonstrated continued gene expression by cells in the VBNC state in vitro (34, 46, 102, 
191).  The current findings lead to the question if the decline in cell culturablility 
observed during cold shock was caused by dead cells or by cells entering into VBNC 
state.  The expression of 16SrRNA provided evidence that during cold shock,                  
V. vulnificus cells were alive and suggested that cells might enter into the VBNC state 
resulting in the decline in CFU on media.  The difference in CFU between these two 
temperature profiles may be due to the cold adaptive mechanism that enhanced cell 
culturability.  In addition, variations of V. vulnificus gene regulation may enhance 
bacterial survival during cold shock in vivo.  Expression of 16SrRNA gene under cold 
shock should be quantified by using real-time RT-PCR or other quantification technique, 
in order to determine if a decrease in net gene expression occurred under cold 
temperatures.  
The current study is the first report on V. vulnificus gene expression during cold 
shock in vivo.  Cold adaptive response in V. vulnificus was observed at the molecular 
 
107
level when cells were exposed to intermediate temperatures. However, further research is 
need to confirm this cold adaptation is truly compensated their survivals.  The loss of 
culturable cells due to cells entering the VBNC state using cooling strategy under oyster 
industry practices is another aspect of great concern for their virulence.  Investigation of 
the role of cold shock genes and other stress-related genes and their regulation in               
V. vulnificus may explain the survival of this pathogen during cold shock.  Understanding 
the impact of cold stress response on the physiology of this pathogenic microorganism in 
shellfish, particularly in regard to their survival will improve strategies control of               
V. vulnificus risk. 
 
 
108
TABLE 4.    Primers used for RT-PCR of cold shock genes and stress-related genes for the in vivo study 
 
Gene GenBank 
Accession 
Number 
Characteristics Size of  
amplified  
fragment  (bp) 
Tm (?C) 
 used in   
RT-PCR 
Primer sequence  References 
csp1 VV12757 
VV1504 
Cold shock protein,  213 50 ATGTCTGGTAAAATGACTGG 
TTAGATAACTGTAACGTTAGAA 
This study 
csp3 VV12532 Cold shock-like protein 
(CspD) 
231 50 ATGTATAGCATGGCTACAG 
TTACTTCGTTGCTTGTACTT 
This study 
csp4 VV12119 
VV2324 
Cold shock protein 210 50 ATGTCTAACACAGTAACCG 
TTAAAGCAGTGTGATCTCTT 
This study 
csp5 VV20519 
VVA1067 
Cold shock protein 213 50 ATGTCTAATAAAGTAACTGGTT 
TTATAGCGCAGTTACGTTTG 
This study 
oxyR AY102627 Control katG expression, 
mediated catalase activity. 
496 57 CGAATACCTAGTGGCTTTGGC 
GCATGGCACAGCAACACTTA 
This study 
rpoS AY187681  Stress regulator   391 50 GTGCATTACGAGGCGATGAA 
ATTTTGCCCACATCGTCAAC 
This study 
katG VV12755 Catalase gene 504 57 GTTGGTACCTCAACTACCGC 
GGATGTCTAGATTGAGGGCC 
(142) 
16SrRNA X74726 Housekeeping gene 
Vv Species-specific  
273 55 TCTAGCGGAGACGCTGGA 
GCTCACTTTCGCAAGTTGGCC 
(87, 108) 
16SrRNA X76333 
X76334 
Housekeeping gene 492 57 GCCTAACACATGCAAGTCGA 
CGTATTACCGCGGCTGCTGG 
(25) 
 
108 
 
109
16SrRNA    
    M       +       -      T
0
     T
1
   30m   60m  6h    12h   24h   48h  72h  120h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
csp1 
    M       +       -      T
0
     T
1
   30m   60m  6h    12h   24h   48h  72h  120h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
csp3 
    M       +       -      T
0
     T
1
   30m  60m   6h    12h   24h   48h  72h  120h 168h 
   ATCC 27562 
   C7184Tr 
   VV3 
csp4 
    M       +       -      T
0
     T
1
   30m  60m  6h   12h   24h   48h  72h  120h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
csp5 
     M      +       -      T
0
     T
1
   30m  60m  6h    12h  24h   48h   72h  120h 168h 
  ATCC 27562 
   C7184Tr 
  VV3 
 
 
 
FIG. 25.  Vibrio vulnificus gene expression profiles: internal control: 16SrRNA, and cold 
shock genes: csp1, csp3, csp4, and csp5 during oysters were cold shocked from 35?C
10 h
 
to 4?C
168 h
 (T
0
: after overnight incubation at 25?C, T
1
: after 10 h incubation at 35?C, 
vertical arrow indicated cold shock at 4?C). 
 
110
oxyR 
    M       +       -      T
0
     T
1
   30m  60m   6h    12h   24h   48h  72h  120h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
katG 
    M       +       -      T
0
     T
1
   30m  60m   6h    12h   24h   48h  72h  120h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
rpoS 
    M       +       -      T
0
     T
1
   30m  60m   6h    12h   24h   48h  72h  120h 168h 
  ATCC 27562 
  C7184Tr 
  VV3 
 
 
 
FIG. 26.  Vibrio vulnificus gene expression profiles: stress-related genes: oxyR, katG, and 
rpoS during oysters were cold shocked from 35?C
10 h
 to 4?C
168 h
 (T
0
: after overnight 
incubation at 25?C, T
1
: after 10 h incubation at 35?C, vertical arrow indicated cold shock 
at 4?C). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
111
16SrRNA               
        
      M    +       -     T0
A
 30m 60m  6h   12h   24h T0
B
  30m  60m  6h   12h  24h  48h  72h 120h168h  
 ATCC 27562 
 C7184Tr 
 VV3 
csp1 
      M    +       -     T0
A
 30m 60m  6h   12h   24h T0
B
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
 ATCC 27562 
 C7184Tr 
 VV3 
csp3 
      M    +       -     T0
A
 30m 60m  6h   12h   24h   T0
B 
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
 ATCC 27562 
 C7184Tr 
 VV3 
csp4 
      M    +       -    T0
A
 30m 60m  6h   12h   24h T0
B
 30m 60m  6h   12h  24h  48h  72h  120h 168h  
ATCC 27562 
C7184Tr 
VV3 
csp5 
      M    +       -    T0
A
 30m 60m  6h   12h   24h  T0
B
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
ATCC 27562 
C7184Tr 
VV3 
FIG. 27.  Vibrio vulnificus gene expression profiles: internal control: 16SrRNA, and cold 
shock genes: csp1, csp3, csp4, and csp5 during oysters were cold shocked from 
25?C
overnight
 to 15?C
36 h
, and from 15?C
36 h
 to 4?C
168 h
 (T0
A
: after overnight incubation at 
25?C, T0
B
: after 36 h incubation at 15?C, the 1
st
 vertical arrow indicated cold shock at 
15?C, the 2
nd
 vertical arrow indicated cold shock at 4?C). 
 
112
 
oxyR 
      M    +       -    T0
A
 30m 60m  6h   12h   24h T0
B
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
 ATCC 27562 
 C7184Tr 
 VV3 
katG 
      M    +       -     T0
A
 30m 60m  6h   12h   24h T0
B
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
 ATCC 27562 
 C7184Tr 
 VV3 
rpoS 
      M    +       -    T0
A
  30m 60m  6h   12h   24h T0
B
 30m  60m  6h   12h  24h  48h  72h  120h 168h  
 ATCC 27562 
 C7184Tr 
 VV3 
 
FIG. 28.  Vibrio vulnificus gene expression profiles: stress-related genes: oxyR, katG, and 
rpoS during oysters were cold shocked from 25?C
overnight
 to 15?C
36 h
, and from 15?C
36 h
 to 
4?C
168 h
 (T0
A
: after overnight incubation at 25?C, T0
B
: after 36 h incubation at 15?C, the 
1
st
 vertical arrow indicated cold shock at 15?C, the 2
nd
 vertical arrow indicated cold shock 
at 4?C). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
113
VII. CONCLUSIONS 
 
 
 
 
 
 
 
 
 
 
 
 
 
  
 
 
 
 
 
 
 
114
 Cold shock response may significantly increase survival in bacteria exposed to 
low temperatures including shellfish-borne pathogens such as V. vulnificus.  In this 
dissertation, the primary objective addressed issues relating to cold shock adaptive 
mechanism in V. vulnificus both under laboratory conditions (in vitro) and in shellstock 
oysters (in vivo) based on the use of current shellstock temperature guidelines 
recommended by ISSC.  The molecular mechanism underlying this cold shock 
phenomenon was also investigated at the transcriptional level.  
Overall results can be summarized as follows: 
1) The negative effect on V. vulnificus cell culturabilty caused by 4?C is 
significantly greater than by 7.2?C.  However, when V. vulnificus was exposed to optimal 
or suboptimal temperatures, neither 7.2?C nor 4?C reduced V. vulnificus cell culturability 
by less than factor of 100 during at a one-week period.  
2)  Cold shock adaptation mediated survival of V. vulnificus was found for both in 
vitro and in vivo experiments.  
-  Cells adaptation to 15?C prior to cold shock to 7.2?C enhanced V. vulnificus 
survival. 
-  Acclimation of infected oysters at 15?C resulted in V. vulnificus greater survival 
during refrigeration at 4?C. 
 
115
3) The expression of cold shock genes (csp
s
) of V. vulnificus varied among 
strains and differed between the in vitro and the in vivo conditions.  Cold shock genes of        
V. vulnificus tested in this study (csp1, csp3, csp4, csp5) can not be considered cold shock 
inducible genes based on in vitro experiments.  However, some weak inductions of csp3, 
csp4, and csp5 were observed under in vivo conditions. 
4) The continuous synthesis of rpoS in both in vitro and in vivo studies highlights 
the importance of this gene for cells viability. 
5) The induction of oxyR and katG suggested that an oxidative stress response 
occurred during the in vitro study but not during the in vivo study. 
6)  The constant expression of 16SrRNA in both in vitro and in vivo experiments 
indicated the viability of V. vulnificus cells through out the cold shock period.  
 
From these cumulative findings I suggest that:  
1) The stronger negative effects caused by 4?C versus 7.2?C might warrant the 
use of stringent refrigeration conditions by the shellfish industry. 
2) Vibrio vulnificus should be kept below the growing temperature range (<15?C) 
at all times to prevent its multiplication. 
 3) Conditions that favor adaptation to cold temperatures should be avoided in     
V. vulnificus control strategies. 
4) Minimizing V. vulnificus growth by limiting the time from harvest to 
refrigeration should be strictly enforced. 
5) Whether net reduction of V. vulnificus cold shocked cells is due to cells 
entering the VBNC state need to be further evaluated.  Analysis of 16SrRNA gene 
 
116
expression should be accurately quantified by real-time RT-PCR or other sensitive 
technique, in order to determine if a decrease in net gene expression occurred under cold 
temperatures.  Additional studies on the VBNC state under ISSC guidelines conditions 
will probably unravel the risk of V. vulnificus infections due to VBNC cells. 
6) Vibrio vulnificus response to cold shock is different from the elucidated in      
V. cholerae, since the homologous csp
s
 investigated were not cold inducible under in 
vitro conditions.  Vibrio vulnificus has to harbor additional cold response mechanism that 
should be further identified and investigated.  
Noteworthy, my dissertation is the first report examined the expression of cold 
shock genes (csp
s
) in V. vulnificus under laboratory condition (in vitro), and while it was 
embedded in oysters (in vivo).  The cumulative results obtained from this study highlight 
some very important aspects that need to be addressed from the perspective of seafood 
safety.  My investigation ?In vitro and in vivo cold shock response in V. vulnificus? may 
provide some accurate scientific data for control analysis of V. vulnificus septicemia 
associated with the consumption of raw oysters.  
 
 
 
 
 
 
 
117
CUMULATIVE BIBLIOGRAPHY 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
118
1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. 
Basic Local Alignment Search Tool. J. Mol. Biol. 215:403-410. 
2. Altuvia, S., M. Almiron, G. Huisman, R. Kolter, and G. Storz. 1994. The Dps 
promoter is activated by oxyR during growth and by Ihf and a sigma(S) in 
stationary-phase. Mol. Microbiol. 13:265-272. 
3. Amaro, C., and E. Biosca. 1996. Vibrio vulnificus biotype 2, pathogenic for eels, 
is also an opportunistic pathogen for humans. Appl. Environ. Microbiol. 62:1454-
1457. 
4. Anderson, D. W., R. C. Lindrooth, B. C. Murray, and J. L. Teague. 1996. 
Cost of restrictions on Gulf oyster harvesting for control of Vibrio vulnificus- 
caused disease. Research Triangle Institute, NC. 
5. Andrews, L. S., D. L. Park, and Y. P. Chen. 2000. Low temperature 
pasteurization to reduce the risk of vibrio infections from raw shell-stock oysters. 
Food Addit. Contam. 17:787-791. 
6. Bayles, D. O., B. A. Annous, and B. J. Wilkinson. 1996. Cold stress proteins 
induced in Listeria monocytogenes in response to temperature downshock and 
growth at low temperatures. Appl. Environ. Microbiol. 62:1116-1119. 
7. Berger, F., N. Morellet, F. Menu, and P. Potier. 1996. Cold shock and cold 
acclimation proteins in the psychrotrophic bacterium Arthrobacter globiformis 
SI55. J. Bacteriol. 178:2999-3007. 
8. Berger, F., P. Normand, and P. Potier. 1997. capA, a cspA-like gene that 
encodes a cold acclimation protein in the psychrotrophic bacterium Arthrobacter 
globiformis SI55. J. Bacteriol. 179:5670-5676. 
 
119
9. Berlin, D. L., D. S. Herson, D. T. Hicks, and D. G. Hoover. 1999. Response of 
pathogenic Vibrio species to high hydrostatic pressure. Appl. Environ. Microbiol. 
65:2776-2780. 
10. Biosca, E., J. Oliver, and C. Amaro. 1996. Phenotypic characterization of 
Vibrio vulnificus biotype 2, a lipopolysaccharide-based homogeneous O 
serogroup within Vibrio vulnificus. Appl. Environ. Microbiol. 62:918-927. 
11. Birkenhauer, J. M., and J. D. Oliver. 2003. Use of diacetyl to reduce the load of 
Vibrio vulnificus in the eastern oyster, Crassostrea virginica. J. Food Prot. 66:38-
43. 
12. Bisharat, N., V. Agmon, R. Finkelstein, R. Raz, G. Ben-Dror, L. Lerner, S. 
Soboh, R. Colodner, D. N. Cameron, D. L. Wykstra, D. L. Swerdlow, and J. 
J. Farmer. 1999. Clinical, epidemiological, and microbiological features of 
Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and 
bacteraemia in Israel. Lancet 354:1421-1424. 
13. Bleve, G., L. Rizzotti, F. Dellaglio, and S. Torriani. 2003. Development of 
reverse transcription (RT)-PCR and real-time RT-PCR assays for rapid detection 
and quantification of viable yeasts and molds contaminating yogurts and 
pasteurized food products. Appl. Environ. Microbiol. 69:4116-4122. 
14. Bogosian, G., N. D. Aardema, E. V. Bourneuf, P. J. L. Morris, and J. P. 
O'Neil. 2000. Recovery of hydrogen peroxide-sensitive culturable cells of Vibrio 
vulnificus gives the appearance of resuscitation from a viable but nonculturable 
state. J. Bacteriol. 182:5070-5075. 
 
120
15. Brayton, P. R., P. A. West, E. Russek, and R. R. Colwell. 1983. New selective 
plating medium for isolation of Vibrio vulnificus biogroup 1. J. Clin. Microbiol. 
17:1039-1044. 
16. Brisco, P., B. Anderson, and C. Smith. 1996. A rapid protocol for the isolation 
of total RNA suitable for RT-PCR, Promega Notes, vol. 55. 
17. Bryan, P. J., R. J. Steffan, A. DePaola, J. W. Foster, and A. K. Bej. 1999. 
Adaptive response to cold temperatures in Vibrio vulnificus. Curr. Microbiol. 
38:168-175. 
18. Campbell, M. S., and A. C. Wright. 2003. Real-time PCR analysis of Vibrio 
vulnificus from oysters. Appl. Environ. Microbiol. 69:7137-7144. 
19. CDC. 1996. Vibrio vulnificus associated with eating raw oyster - Los Angeles. 
MMWR CDC Surveill. Summ. 45:621-624. 
20. Cerda-Cuellar, M., J. Jofre, and A. R. Blanch. 2000. A selective medium and a 
specific probe for detection of Vibrio vulnificus. Appl. Environ. Microbiol. 
66:855-859. 
21. Cerda-Cuellar, M., L. Permin, J. L. Larsen, and A. R. Blanch. 2001. 
Comparison of selective media for the detection of Vibrio vulnificus in 
environmental samples. J. Appl. Microbiol. 91:322-327. 
22. Chakraborty, S., G. B. Nair, and S. Shinoda. 1997. Pathogenic vibrios in the 
natural aquatic environment.63-80, 1997 Apr-Jun. 
 
 
 
121
23. Chen, C.-Y., K.-M. Wu, Y.-C. Chang, C.-H. Chang, H.-C. Tsai, T.-L. Liao, 
Y.-M. Liu, H.-J. Chen, A. B.-T. Shen, J.-C. Li, T.-L. Su, C.-P. Shao, C.-T. 
Lee, L.-I. Hor, and S.-F. Tsai. 2003. Comparative genome analysis of Vibrio 
vulnificus, a marine pathogen. Genome Res. 13:2577-2587. 
24. Chen, C. Y., L. Eckmann, S. J. Libby, F. C. Fang, S. Okamoto, M. F. 
Kagnoff, J. Fierer, and D. G. Guiney. 1996. Expression of Salmonella 
typhimurium rpoS and rpoS-dependent genes in the intracellular environment of 
eukaryotic cells. Infect. Immun. 64:4739-4743. 
25. Chen, Y. C., M. C. Chang, Y. C. Chuang, and C. L. Jeang. 2004. 
Characterization and virulence of hemolysin III from Vibrio vulnificus. Curr. 
Microbiol. 49:175-179. 
26. Chen, Y. P. 1996. Reduction and management of Vibrio vulnificus in Gulf Coast 
oyster (Crassostrea virginica). Louisiana State University, Louisiana. 
27. Christman, M. F., R. W. Morgan, F. S. Jacobson, and B. N. Ames. 1985. 
Positive control of a regulon for defenses against oxidative stress and some heat-
shock proteins in Salmonella typhimurium. Cell 41:753-762. 
28. Cloutier, J., D. Prevost, P. Nadeau, and H. Antoun. 1992. Heat and cold shock 
protein synthesis in arctic and temperate strains of Rhizobia. Appl. Environ. 
Microbiol. 58:2846-2853. 
29. Connell, J. O. 2002. RT-PCR in biomedicine, vol. 193. Humana Press, New 
Jersy. 
 
122
30. Cook, D. W. 1994. Effect of time and temperature on multiplication of Vibrio 
vulnificus in postharvest Gulf Coast shellstock oysters. Appl. Environ. Microbiol. 
60:3483-3484. 
31. Cook, D. W. 1997. Refrigeration of oyster shellstock: conditions which minimize 
the out growth of Vibrio vulnificus. J. Food Prot. 60:349-352. 
32. Cook, D. W., P. O Leary, J. C. Hunsucker, E. M. Sloan, J. C. Bowers, R. J. 
Blodgett, and A. De Paola. 2002. Vibrio vulnificus and Vibrio parahaemolyticus 
in U.S. retail shell oysters: A national survey from June 1998 to July 1999 (vol 
65, pg 79, 2002). J. Food Prot. 65:445-445. 
33. Cook, D. W., and A. D. Ruple. 1992. Cold-storage and mild heat-treatment as 
processing aids to reduce the numbers of Vibrio vulnificus in raw oysters. J. Food 
Prot. 55:985-989. 
34. Coutard, F., M. Pommepuy, S. Loaec, and D. Hervio-Heath. 2005. mRNA 
detection by reverse transcription-PCR for monitoring viability and potential 
virulence in a pathogenic strain of Vibrio parahaemolyticus in viable but 
nonculturable state. J. Appl. Microbiol. 98:951-961. 
35. Craig, J. E., D. Boyle, K. P. Francis, and M. P. Gallagher. 1998. Expression of 
the cold-shock gene cspB in Salmonella typhimurium occurs below a threshold 
temperature. Microbiology-Uk 144:697-704. 
36. Datta, P. P., and R. K. Bhadra. 2003. Cold shock response and major cold 
shock proteins of Vibrio cholerae. Appl. Environ. Microbiol. 69:6361-6369. 
37. Dawe, L. L., and W. R. Penrose. 1978. Bactericidal property of seawater - death 
or debilitation. Appl. Environ. Microbiol. 35:829-833. 
 
123
38. DePaola, A., G. M. Capers, and D. Alexander. 1994. Densities of Vibrio 
vulnificus in the intestines of fish from the U.S. Gulf Coast. Appl. Environ. 
Microbiol. 60:984-988. 
39. DePaola, A., M. L. Motes, A. M. Chan, and C. A. Suttle. 1998. Phages 
infecting Vibrio vulnificus are abundant and diverse in oysters (Crassostrea 
virginica) collected from the Gulf of Mexico. Appl. Environ. Microbiol. 64:346-
351. 
40. Derzelle, S., B. Hallet, K. P. Francis, T. Ferain, J. Delcour, and P. Hols. 2000. 
Changes in cspL, cspP, and cspC mRNA abundance as a function of cold shock 
and growth phase in Lactobacillus plantarum. J. Bacteriol. 182:5105-5113. 
41. Etchegaray, J. P., and M. Inouye. 1999. CspA, CspB, and CspG, major cold 
shock proteins of Escherichia coli, are induced at low temperature under 
conditions that completely block protein synthesis. J. Bacteriol. 181:1827-1830. 
42. Fang, F. C., S. J. Libby, N. A. Buchmeier, P. C. Loewen, J. Switala, J. 
Harwood, and D. G. Guiney. 1992. The alternative sigma-factor katf (RpoS) 
regulates Salmonella virulence. Proc. Natl. Acad. Sci. U. S. A. 89:11978-11982. 
43. FDA. 2004. Vibrio. Bacteriological Analytical Manual online.Chapter 9:26 p. 
44. FDACFSAN. 2003. Issue relating to a Vibrio vulnificus risk management plan for 
oysters. Interstate Shellfish Sanitation Conference, Columbia, SC., Columbia, SC. 
45. FDACFSAN. 2005. National shellfish sanitation program: Guide for the control 
of molluscan shellfish 2005. Food and Drug Adminstration. 
 
 
124
46. Fischer-Le Saux, M., D. Hervio-Heath, S. Loaec, R. R. Colwell, and M. 
Pommepuy. 2002. Detection of cytotoxin-hemolysin mRNA in nonculturable 
populations of environmental and clinical Vibrio vulnificus strains in artificial 
seawater. Appl. Environ. Microbiol. 68:5641-5646. 
47. Foley, D. A., and T. C. Cheng. 1975. Quantitative study of phagocytosis by 
hemolymph cells of pelecypods Crassostrea virginica and Mercenaria 
mercenaria. J. Invertebr. Pathol. 25:189-197. 
48. Gholami, P., S. Q. Lew, and K. C. Klontz. 1998. Raw shellfish consumption 
among renal disease patients - A risk factor for severe Vibrio vulnificus infection. 
Am. J. Prev. Med. 15:243-245. 
49. Goatcher, L. J., S. E. Engler, D. C. Wagner, and D. C. Westhoff. 1974. Effect 
of storage at 5?C on survival of Vibrio parahaemolyticus in processed Maryland 
oysters (Crassostrea virginica). Journal of Milk and Food Technology. 37:74-77. 
50. Goldstein, J., N. S. Pollitt, and M. Inouye. 1990. Major cold shock protein of 
Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 87:283-287. 
51. Golovlev, E. L. 2003. Bacterial cold shock response at the level of DNA 
transcription, translation, and chromosome dynamics. Microbiology 72:1-7. 
52. GonzalezFlecha, B., and B. Demple. 1997. Transcriptional regulation of the 
Escherichia coli oxyR gene as a function of cell growth. J. Bacteriol. 179:6181-
6186. 
53. Gooch, J. A. 2000. Factors affecting quantitative and qualitative changes in 
Vibrio parahaemolyticus and Vibrio vulnificus population in oysters. Mississippi 
State University, Mississippi. 
 
125
54. Graumann, P., and M. A. Marahiel. 1996. Some like it cold: Response of 
microorganisms to cold shock. Arch. Microbiol. 166:293-300. 
55. Graumann, P., K. Schroder, R. Schmid, and M. A. Marahiel. 1996. Cold 
shock stress-induced proteins in Bacillus subtilis. J. Bacteriol. 178:4611-4619. 
56. Graumann, P., T. M. Wendrich, M. H. W. Weber, K. Schroder, and M. A. 
Marahiel. 1997. A family of cold shock proteins in Bacillus subtilis is essential 
for cellular growth and for efficient protein synthesis at optimal and low 
temperatures. Mol. Microbiol. 25:741-756. 
57. Graumann, P. L., and M. A. Marahiel. 1999. Cold shock proteins CspB and 
CspC are major stationary-phase-induced proteins in Bacillus subtilis. Arch. 
Microbiol. 171:135-138. 
58. Grunstein, M., and D. S. Hogness. 1975. Colony hybridization - method for 
isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad. Sci. U. S. 
A. 72:3961-3965. 
59. Gumley, A. W., and W. E. Inniss. 1996. Cold shock proteins and cold 
acclimation proteins in the psychrotrophic bacterium Pseudomonas putida Q5 and 
its transconjugant. Can. J. Microbiol. 42:798-803. 
60. Harwood, V. J., J. P. Gandhi, and A. C. Wright. 2004. Methods for isolation 
and confirmation of Vibrio vulnificus from oysters and environmental sources: a 
review. J. Microbiol. Methods 59:301-316. 
61. Hebraud, M., E. Dubois, P. Potier, and J. Labadie. 1994. Effect of growth 
temperatures on the protein-levels in a psychrotrophic bacterium, Pseudomonas 
fragi. J. Bacteriol. 176:4017-4024. 
 
126
62. Herigstad, B., M. Hamilton, and J. Heersink. 2001. How to optimize the drop 
plate method for enumerating bacteria. J. Microbiol. Methods 44:121-129. 
63. Hesselman, D. M., M. L. Motes, and J. P. Lewis. 1999. Effects of a commercial 
heat-shock process on Vibrio vulnificus in the American oyster Crassostrea 
virginica harvested from the Gulf Coast. J. Food Prot. 62:1266-1269. 
64. Hlady, W. G. 1997. Vibrio infections associated with raw oyster consumption in 
Florida, 1981-1994. J. Food Prot. 60:353-357. 
65. Hoi, L., I. Dalsgaard, and A. Dalsgaard. 1998. Improved isolation of Vibrio 
vulnificus from seawater and sediment with Cellobiose colistin agar. Appl. 
Environ. Microbiol. 64:1721-1724. 
66. Hoi, L., J. L. Larsen, I. Dalsgaard, and A. Dalsgaard. 1998. Occurrence of 
Vibrio vulnificus biotypes in Danish marine environments. Appl. Environ. 
Microbiol. 64:7-13. 
67. Houghtby, G., and J. Liston. 1965. Effect of heating on Staphylococcus aureus 
in frozen precooked seafoods. Food Technology. 19:874-&. 
68. Hsu, W. Y., C. I. Wei, and M. L. Tamplin. 1998. Enhanced broth media for 
selective growth of Vibrio vulnificus. Appl. Environ. Microbiol. 64:2701-2704. 
69. Hu, X. P., P. Mallikarjunan, J. Koo, L. S. Andrews, and M. L. Jahncke. 2005. 
Comparison of kinetic models to describe high pressure and gamma irradiation 
used to inactivate Vibrio vulnificus and Vibrio parahaemolyticus prepared in 
buffer solution and in whole oysters. J. Food Prot. 68:292-295. 
 
127
70. Hulsmann, A., T. M. Rosche, I. S. Kong, H. M. Hassan, D. M. Beam, and J. 
D. Oliver. 2003. RpoS-dependent stress response and exoenzyme production in 
Vibrio vulnificus. Appl. Environ. Microbiol. 69:6114-6120. 
71. Imbert, M., and F. Gancel. 2004. Effect of different temperature downshifts on 
protein synthesis by Aeromonas hydrophila. Curr. Microbiol. 49:79-83. 
72. Inouye, M. a. K. Y. 2000. Cold shock response and adaptation. JMMB Symp Ser 
2:147p. 
73. Jakabi, M., D. S. Gelli, J. Torre, M. A. B. Rodas, B. Franco, M. T. Destro, 
and M. Landgraf. 2003. Inactivation by ionizing radiation of Salmonella 
enteritidis, Salmonella infantis, and Vibrio parahaemolyticus in oysters 
(Crassostrea brasiliana). J. Food Prot. 66:1025-1029. 
74. Jamet, A., E. Kiss, J. Batut, A. Puppo, and D. Herouart. 2005. The katA 
catalase gene is regulated by OxyR in both free-living and symbiotic 
Sinorhizobium meliloti. J. Bacteriol. 187:376-381. 
75. Jeffreys, A. G., K. M. Hak, R. J. Steffan, J. W. Foster, and A. K. Bej. 1998. 
Growth, survival and characterization of cspA in Salmonella enteritidis following 
cold shock. Curr. Microbiol. 36:29-35. 
76. Jenkins, D. E., J. E. Schultz, and A. Matin. 1988. Starvation-induced cross 
protection against heat or H
2
O
2
 challenge in Escherichia coli. J. Bacteriol. 
170:3910-3914. 
77. Jiang, W. N., Y. Hou, and M. Inouye. 1997. CspA, the major cold-shock protein 
of Escherichia coli, is an RNA chaperone. J. Biol. Chem. 272:196-202. 
 
128
78. Jones, P. G., and M. Inouye. 1994. The Cold-Shock Response - a Hot Topic. 
Mol. Microbiol. 11:811-818. 
79. Jones, P. G., R. Krah, S. R. Tafuri, and A. P. Wolffe. 1992. DNA gyrase, 
cs7.4, and the cold shock response in Escherichia coli. J. Bacteriol. 174:5798-
5802. 
80. Jones, P. G., R. A. Vanbogelen, and F. C. Neidhardt. 1987. Induction of 
proteins in response to low-temperature in Escherichia coli. J. Bacteriol. 
169:2092-2095. 
81. Kaspar, C. W., and M. L. Tamplin. 1993. Effects of temperature and salinity on 
the survival of Vibrio vulnificus in seawater and shellfish. Appl. Environ. 
Microbiol. 59:2425-2429. 
82. Kaysner, C. A., and A. De Paola. 2004. Vibrio cholerae, V. parahaemolyticus, 
V. vulnificus, and other Vibrio spp. Bacteriological Analytical Manual, 8th ed. 
83. Kaysner, C. A., M. L. Tamplin, M. M. Wekell, R. F. Stott, and K. G. 
Colburn. 1989. Survival of Vibrio vulnificus in shellstock and shucked oysters 
(Crassostrea gigas and Crassostrea virginica) and effects of isolation medium on 
recovery. Appl. Environ. Microbiol. 55:3072-3079. 
84. Keller, G. H., and M. M. Manak. 1989. DNA probes. Stockton Press, NewYork. 
85. Kelly, M. T. 1982. Effect of temperature and salinity on Vibrio (Beneckea) 
vulnificus occurrence in a Gulf Coast environment. Appl. Environ. Microbiol. 
44:820-824. 
 
129
86. Kelly, M. T., and A. Dinuzzo. 1985. Uptake and clearance of Vibrio vulnificus 
from Gulf coast oysters (Crassostrea virginica). Appl. Environ. Microbiol. 
50:1548-1549. 
87. Kim, M. S., and H. D. Jeong. 2001. Development of 16S rRNA targeted PCR 
methods for the detection and differentiation of Vibrio vulnificus in marine 
environments. Aquaculture 193:199-211. 
88. Kim, S. O., K. Merchant, R. Nudelman, W. F. Beyer, T. Keng, J. DeAngelo, 
A. Hausladen, and J. S. Stamler. 2002. OxyR: A molecular code for redox-
related signaling. Cell 109:383-396. 
89. Kim, W. S., and N. W. Dunn. 1997. Identification of a cold shock gene in lactic 
acid bacteria and the effect of cold shock on cryotolerance. Curr. Microbiol. 
35:59-63. 
90. Kim, W. S., N. Khunajakr, and N. W. Dunn. 1998. Effect of cold shock on 
protein synthesis and on cryotolerance of cells frozen for long periods in 
Lactococcus lactis. Cryobiology 37:86-91. 
91. Kim, Y. R., S. E. Lee, C. M. Kim, S. Y. Kim, E. K. Shin, D. H. Shin, S. S. 
Chung, H. E. Choy, A. Progulske-Fox, J. D. Hillman, M. Handfield, and J. H. 
Rhee. 2003. Characterization and pathogenic significance of Vibrio vulnificus 
antigens preferentially expressed in septicemic patients. Infect. Immun. 71:5461-
5471. 
 
 
 
130
92. Kitaura, T., S. Doke, I. Azuma, M. Imaida, K. Miyano, K. Harada, and E. 
Yabuuchi. 1983. Halo production by sulfatase activity of V. vulnificus and V. 
cholerae O1 on a new selective sodium dodecyl sulfate-containing agar medium - 
a screening marker in environmental surveillance. FEMS Microbiol. Lett. 17:205-
209. 
93. Klein, P. G., and V. K. Juneja. 1997. Sensitive detection of viable Listeria 
monocytogenes by reverse transcription-PCR. Appl. Environ. Microbiol. 63:4441-
4448. 
94. Kong, I. S., T. C. Bates, A. Hulsmann, H. Hassan, B. E. Smith, and J. D. 
Oliver. 2004. Role of catalase and oxyR in the viable but nonculturable state of 
Vibrio vulnificus. FEMS Microbiol Ecol 50:133-142. 
95. Koo, J., A. DePaola, and D. L. Marshall. 2000. Effect of simulated gastric fluid 
and bile on survival of Vibrio vulnificus and Vibrio vulnificus phage. J. Food Prot. 
63:1665-1669. 
96. Lange, R., and R. Henggearonis. 1994. The cellular concentration of the 
sigma(S) subunit of RNA-polymerase in Escherichia coli Is controlled at the 
levels of transcription translation, and protein stability. Genes Dev 8:1600-1612. 
97. Lee, S. J., A. G. Xie, W. N. Jiang, J. P. Etchegaray, P. G. Jones, and M. 
Inouye. 1994. Family of the major cold-shock protein, CspA (Cs7.4), of 
Escherichia coli, whose members show a high sequence similarity with the 
eukaryotic Y-Box binding-proteins. Mol. Microbiol. 11:833-839. 
98. Leonard, D. L. 2003. Managing public health risk : Vibrio vulnificus. 4th 
International Conference on Molluscan Shellfish Safety, Spain:287-302. 
 
131
99. Levin, R. E. 2005. Vibrio vulnificus, a notably lethal human pathogen derived 
from seafood: A review of its pathogenicity, subspecies characterization, and 
molecular methods of detection. Food Biotechnology 19:69-94. 
100. Linkous, D. A., and J. D. Oliver. 1999. Pathogenesis of Vibrio vulnificus. FEMS 
Microbiol. Lett. 174:207-214. 
101. Lipp, E. K., and J. B. Rose. 1997. The role of seafood in foodborne diseases in 
the United States of America. Revue Scientifique Et Technique De L Office 
International Des Epizooties 16:620-640. 
102. Lleo, M. D., S. Pierobon, M. C. Tafi, C. Signoretto, and P. Canepari. 2000. 
mRNA detection by reverse transcription-PCR for monitoring viability over time 
in an Enterococcus faecalis viable but nonculturable population maintained in a 
laboratory microcosm. Appl. Environ. Microbiol. 66:4564-4567. 
103. Loewen, P. C., B. Hu, J. Strutinsky, and R. Sparling. 1998. Regulation in the 
rpoS regulon of Escherichia coli. Can. J. Microbiol. 44:707-717. 
104. Lorio, J. W., and C. Petrone. 1994. The cultivation of American oysters 
(Crassostrea virginica), Sothern Regional Aquaculture Center, SRAC Publication 
No. 432. 
105. Lutz, C. G., P. Sambidi, and R. W. Harrison. 2005. Oyster profile. Agricultural 
Marketing Resource Center, Iowa State University. 
106. Maas, R. 1983. An improved colony hybridization method with significantly 
increased sensitivity for detection of single genes. Plasmid 10:296-298. 
107. Massad, G., and J. D. Oliver. 1987. New selective and differential medium for 
Vibrio cholerae and Vibrio vulnificus. Appl. Environ. Microbiol. 53:2262-2264. 
 
132
108. Maugeri, T. L., M. Carbone, M. T. Fera, and C. Gugliandolo. 2006. Detection 
and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone 
of the Mediterranean Sea. Res. Microbiol. 157:194-200. 
109. Mayr, B., T. Kaplan, S. Lechner, and S. Scherer. 1996. Identification and 
purification of a family of dimeric major cold shock protein homologs from the 
psychrotrophic Bacillus cereus WSBC 10201. J. Bacteriol. 178:2916-2925. 
110. McGovern, V., and J. Oliver. 1995. Induction of cold-responsive proteins in 
Vibrio vulnificus. J. Bacteriol. 177:4131-4133. 
111. Meynell, G. G. 1958. The effect of sudden chilling on Escherichia coli. J. Gen. 
Microbiol. 19:380-389. 
112. Miceli, G. A., W. D. Watkins, and S. R. Rippey. 1993. Direct plating procedure 
for enumerating Vibrio vulnificus in oysters (Crassostrea virginica). Appl. 
Environ. Microbiol. 59:3519-3524. 
113. Michel, V., J. Labadie, and M. Hebraud. 1996. Effect of different temperature 
upshifts on protein synthesis by the psychrotrophic bacterium Pseudomonas fragi. 
Curr. Microbiol. 33:16-25. 
114. Michel, V., I. Lehoux, G. Depret, P. Anglade, J. Labadie, and M. Hebraud. 
1997. The cold shock response of the psychrotrophic bacterium Pseudomonas 
fragi involves four low-molecular-mass nucleic acid binding proteins. J. 
Bacteriol. 179:7331-7342. 
 
 
 
133
115. Morgan, R. W., M. F. Christman, F. S. Jacobson, G. Storz, and B. N. Ames. 
1986. Hydrogen peroxide-inducible proteins in Salmonella typhimurium overlap 
with heat-shock and other stress proteins. Proc. Natl. Acad. Sci. U. S. A. 83:8059-
8063. 
116. Morris, J. G., Jr, A. C. Wright, D. M. Roberts, P. K. Wood, L. M. Simpson, 
and J. D. Oliver. 1987. Identification of environmental Vibrio vulnificus isolates 
with a DNA probe for the cytotoxin-hemolysin gene. Appl. Environ. Microbiol. 
53:193-195. 
117. Motes, M. L., and A. DePaola. 1996. Offshore suspension relaying to reduce 
levels of Vibrio vulnificus in oysters (Crassostrea virginica). Appl. Environ. 
Microbiol. 62:3875-3877. 
118. Murphy, S. K., and J. D. Oliver. 1992. Effects of temperature abuse on survival 
of Vibrio vulnificus in oysters. Appl. Environ. Microbiol. 58:2771-2775. 
119. Muth, K. M., D. W. Anderson, S. A. Karns, B. C. Murray, and J. L. 
Domanico. 2000. Economic impacts of requiring post-harvest treatment of 
oysters. Research Triangle Institute, RTI Project Number 7466000. 
120. Nakashima, K., K. Kanamaru, T. Mizuno, and K. Horikoshi. 1996. A novel 
member of the cspA family of genes that is induced by cold shock in Escherichia 
coli. J. Bacteriol. 178:2994-2997. 
121. National Marine Fisheries Service, F. S. a. E. D., Commercial Fisheries May, 
2007, posting date. 
http://www.st.nmfs.gov/st1/commercial/landings/annual_lanndings.html. 
[Online.] 
 
134
122. National Marine Fisheries Service, F. S. a. E. D., Foreign Trade Information 
March, 6 2007, posting date. 
http://www.st.nmfs.gov/st1/trade/cumulative_data/TradeDataProduct.html. 
[Online.] 
123. O'Connell, K. P., A. M. Gustafson, M. D. Lehmann, and M. F. Thomashow. 
2000. Identification of cold shock gene loci in Sinorhizobium meliloti by using a 
luxAB reporter transposon. Appl. Environ. Microbiol. 66:401-405. 
124. O'Connell, K. P., and M. F. Thomashow. 2000. Transcriptional organization 
and regulation of a polycistronic cold shock operon in Sinorhizobium meliloti 
RM1021 encoding homologs of the Escherichia coli major cold shock gene cspA 
and ribosomal protein gene rpsU. Appl. Environ. Microbiol. 66:392-400. 
125. O'Neill, K. R., S. H. Jones, and D. J. Grimes. 1992. Seasonal incidence of 
Vibrio vulnificus in the Great Bay estuary of New Hampshire and Maine. Appl. 
Environ. Microbiol. 58:3257-3262. 
126. Oliver, J., F. Hite, D. McDougald, N. Andon, and L. Simpson. 1995. Entry 
into, and resuscitation from, the viable but nonculturable state by Vibrio vulnificus 
in an estuarine environment. Appl. Environ. Microbiol. 61:2624-2630. 
127. Oliver, J. D. 1993. Formation of viable but nonculturable cells p. 239-242. In S. 
Kjelleberg (ed.), Starvation in bacteria, Prenum Press, New York 
128. Oliver, J. D. 1981. Lethal cold stress of Vibrio vulnificus in oysters. Applied and 
Environmental Microbiology 41:710-717. 
129. Oliver, J. D. 1981. Lethal cold stress of Vibrio vulnificus in oysters. Appl. 
Environ. Microbiol. 41:710-717. 
 
135
130. Oliver, J. D. 1995. The viable but non-culturable state in the human pathogen 
Vibrio vulnificus. FEMS Microbiol. Lett. 133:203-208. 
131. Oliver, J. D. 2005. The viable but nonculturable state in bacteria. Journal of 
Microbiology 43:93-100. 
132. Oliver, J. D., and J. B. Kaper. 2001. Vibrio species, 2nd edition ed. American 
Society for Microbiology, Washington, DC. 
133. Oliver, J. D., R. A. Warner, and D. R. Cleland. 1982. Distribution and ecology 
of Vibrio vulnificus and other lactose-fermenting marine vibrios in coastal waters 
of the Southeastern United States. Appl. Environ. Microbiol. 44:1404-1414. 
134. Oliver, J. D., R. A. Warner, and D. R. Cleland. 1983. Distribution of Vibrio 
vulnificus and other lactose-fermenting Vibrios in the marine environment. Appl. 
Environ. Microbiol. 45:985-998. 
135. Olsen, A., A. Arnqvist, M. Hammar, S. Sukupolvi, and S. Normark. 1993. 
The RpoS sigma factor relieves H-NS-mediated transcriptional repression of 
csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol. 
Microbiol. 7:523-536. 
136. Palmer, C. J. a. C. P.-K. 2004. Polymerase chain reaction (PCR), vol. 70. 
Elesevier Academic Press, UK. 
137. Panek, H. R., and M. R. O'Brian. 2004. KatG is the primary detoxifier of 
hydrogen peroxide produced by aerobic metabolism in Bradyrhizobium 
japonicum. J. Bacteriol. 186:7874-7880. 
 
136
138. Panicker, G., M. L. Myers, and A. K. Bej. 2004. Rapid detection of Vibrio 
vulnificus in shellfish and Gulf of Mexico water by real-time PCR. Appl. Environ. 
Microbiol. 70:498-507. 
139. Panoff, J. M., D. Corroler, B. Thammavongs, and P. Boutibonnes. 1997. 
Differentiation between cold shock proteins and cold acclimation proteins in a 
mesophilic gram-positive bacterium, Enterococcus faecalis JH2-2. J. Bacteriol. 
179:4451-4454. 
140. Panoff, J. M., S. Legrand, B. Thammavongs, and P. Boutibonnes. 1994. The 
cold shock response in Lactococcus lactis subsp Lactis. Curr. Microbiol. 29:213-
216. 
141. Panoff, J. M., B. Thammavongs, M. Gueguen, and P. Boutibonnes. 1998. 
Cold stress responses in mesophilic bacteria. Cryobiology 36:75-83. 
142. Park, K.-J., M.-J. Kang, S. H. Kim, H.-J. Lee, J.-K. Lim, S. H. Choi, S.-J. 
Park, and K.-H. Lee. 2004. Isolation and characterization of rpoS from a 
pathogenic bacterium, Vibrio vulnificus: Role of {sigma}S in survival of 
exponential-phase cells under oxidative stress. J. Bacteriol. 186:3304-3312. 
143. Patterson, T. E., and H. Jackson. 1979. Effect of storage at 1?C and 4?C on 
viability and Injury of Staphylococcus aureus, Escherichia coli and Streptococcus 
faecalis. J. Appl. Bacteriol. 46:161-167. 
144. Perkins, E. B. 1995. Aquacultured oyster products: inspection, quality, handling, 
storage, safety, Sothern Regional Aquaculture Center, SRAC Publication No. 434  
 
137
145. Pfeffer, C. S., M. F. Hite, and J. D. Oliver. 2003. Ecology of Vibrio vulnificus 
in estuarine waters of Eastern North Carolina. Appl. Environ. Microbiol. 69:3526-
3531. 
146. Phadtare, S., J. Alsina, and M. Inouye. 1999. Cold shock response and cold-
shock proteins. Curr. Opin. Microbiol. 2:175-180. 
147. Phanthanh, L., and T. Gormon. 1995. Analysis of heat and cold shock proteins 
in Listeria by 2-dimensional electrophoresis. Electrophoresis 16:444-450. 
148. Potasman, I., A. Paz, and M. Odeh. 2002. Infectious outbreaks associated with 
bivalve shellfish consumption: A worldwide perspective. Clin. Infect. Dis. 
35:921-928. 
149. Quevedo, A. C., J. G. Smith, G. E. Rodrick, and A. C. Wright. 2005. Ice 
immersion as a postharvest treatment of oysters for the reduction of Vibrio 
vulnificus. J. Food Prot. 68:1192-1197. 
150. Ren, T. T., and Y. C. Su. 2006. Effects of electrolyzed oxidizing water treatment 
on reducing Vibrio parahaemolyticus and Vibrio vulnificus in raw oysters. J. 
Food Prot. 69:1829-1834. 
151. Rippey, S. R. 1994. Infectious-diseases associated with molluscan shellfish 
consumption. Clin. Microbiol. Rev. 7:419-&. 
152. Roberts, M. E., and W. E. Inniss. 1992. The synthesis of cold shock proteins 
and cold-acclimation proteins in the psychrophilic bacterium Aquaspirillum 
arcticum. Curr. Microbiol. 25:275-278. 
153. Roberts, N. C., R. J. Siebeling, J. B. Kaper, and H. B. Bradford. 1982. Vibrios 
in the Louisiana Gulf-coast environment. Microb. Ecol. 8:299-312. 
 
138
154. Rosche, T. M., D. J. Smith, E. E. Parker, and J. D. Oliver. 2005. RpoS 
involvement and requirement for exogenous nutrient for osmotically induced 
cross protection in Vibrio vulnificus. FEMS Microbiol Ecol 53:455-462. 
155. Schellhorn, H. E., and V. L. Stones. 1992. Regulation of katF and katE in 
Escherichia coli K-12 by weak acids. J. Bacteriol. 174:4769-4776. 
156. Science, N. A. o. 1991. Seafood safety reports. Microbiological and parasitic 
exposures and health effects.p 33-94. 
157. Shapiro, R. L., S. Altekruse, L. Hutwagner, R. Bishop, R. Hammond, S. 
Wilson, B. Ray, S. Thompson, R. V. Tauxe, and P. M. Griffin. 1998. The role 
of Gulf Coast oysters harvested in warmer months in Vibrio vulnificus infections 
in the United States, 1988-1996. J. Infect. Dis. 178:752-759. 
158. Sheridan, G. E. C., C. I. Masters, J. A. Shallcross, and B. M. Mackey. 1998. 
Detection of mRNA by reverse transcription PCR as an indicator of viability in 
Escherichia coli cells. Appl. Environ. Microbiol. 64:1313-1318. 
159. Small, P., D. Blankenhorn, D. Welty, E. Zinser, and J. L. Slonczewski. 1994. 
Acid and base resistance in Escherichia coli and Shigella flexneri - role of RpoS 
and growth pH. J. Bacteriol. 176:1729-1737. 
160. Smith, B., and J. D. Oliver. 2006. In situ and in vitro gene expression by Vibrio 
vulnificus during entry into, persistence within, and resuscitation from the viable 
but nonculturable state. Appl. Environ. Microbiol. 72:1445-1451. 
161. Smith, B., and J. D. Oliver. 2006. In situ gene expression by Vibrio vulnificus. 
Appl. Environ. Microbiol. 72:2244-2246. 
 
139
162. Stanford, S. E. 2000. Factors influence pseudodormancy and dormancy in Vibrio 
vulnificus. University of South Alabama, Alabama. 
163. Strange, R. E., and F. A. Dark. 1962. Effect of chilling on Aerobacter 
aerogenes in aqueous suspension. J. Gen. Microbiol. 29:719-&. 
164. Strange, R. E., and A. G. Ness. 1963. Effect of chilling on bacteria in aqueous 
suspension. Nature 197:819-&. 
165. Strom, M. S., and R. N. Paranjpye. 2000. Epidemiology and pathogenesis of 
Vibrio vulnificus. Microbes Infect. 2:177-188. 
166. Sun, Y., and J. D. Oliver. 1994. Antimicrobial action of some Gras compounds 
against Vibrio vulnificus. Food Addit. Contam. 11:549-558. 
167. Sun, Y., and J. D. Oliver. 1994. Effects of Gras compounds on natural Vibrio 
vulnificus populations in oysters. J. Food Prot. 57:921-923. 
168. Sun, Y., and J. D. Oliver. 1995. Hot sauce - no elimination of Vibrio vulnificus 
in oysters. J. Food Prot. 58:441-442. 
169. Tamplin, M., G. E. Rodrick, N. J. Blake, and T. Cuba. 1982. Isolation and 
characterization of Vibrio vulnificus from two Florida estuaries. Appl. Environ. 
Microbiol. 44:1466-1470. 
170. Tamplin, M. L., and G. M. Capers. 1992. Persistence of Vibrio vulnificus in 
tissues of Gulf Coast oysters, Crassostrea virginica, exposed to seawater 
disinfected with UV light. Appl. Environ. Microbiol. 58:1506-1510. 
171. Tamplin, M. L., A. L. Martin, A. D. Ruple, D. W. Cook, and C. W. Kaspar. 
1991. Enzyme immunoassay for identification of Vibrio vulnificus in seawater, 
sediment, and oysters. Appl. Environ. Microbiol. 57:1235-1240. 
 
140
172. Tarnuzzer, R. W. 1998. Design and use of an exogenously added competitive 
RNA multiplex template for measurement of mRNA levels by RT-PCR. Eaton 
Publishing, US. 
173. Thieringer, H. A., P. G. Jones, and M. Inouye. 1998. Cold shock and 
adaptation. Bioessays 20:49-57. 
174. Triggsraine, B. L., and P. C. Loewen. 1987. Physical characterization of katG, 
encoding catalase Hpi of Escherichia coli. Gene 52:121-128. 
175. Ulusarac, O., and E. Carter. 2004. Varied clinical presentations of Vibrio 
vulnificus infections: A report of four unusual cases and review of the literature. 
South. Med. J. 97:163-168. 
176. USFDA 2004, posting date. Bacteriological Analytical Manual Online: Chapter 9 
Vibrio. [Online.] 
177. USFDA 2001, posting date. Bacteriological analytical manual online: Chapter 24 
Identification of foodborne bacterial pathogens by gene probes. [Online.] 
178. Vargas, M. D., S. Encarnacion, A. Davalos, A. Reyes-Perez, Y. Mora, A. 
Garcia-de los Santos, S. Brom, and J. Moral. 2003. Only one catalase, katG, is 
detectable in Rhizobium etli, and is encoded along with the regulator OxyR on a 
plasmid replicon. Microbiology-Sgm 149:1165-1176. 
179. Veres, G., R. A. Gibbs, S. E. Scherer, and C. T. Caskey. 1987. The molecular-
basis of the sparse fur mouse mutation. Science 237:415-417. 
180. Wang, N., K. Yamanaka, and M. Inouye. 1999. CspI, the ninth member of the 
CspA family of Escherichia coli, is induced upon cold shock. J. Bacteriol. 
181:1603-1609. 
 
141
181. Weichart, D., J. D. Oliver, and S. Kjelleberg. 1992. Low-temperature induced 
nonculturability and killing of Vibrio vulnificus. FEMS Microbiol. Lett. 100:205-
210. 
182. Whitesides, M., and J. Oliver. 1997. Resuscitation of Vibrio vulnificus from the 
viable but nonculturable state. Appl. Environ. Microbiol. 63:1002-1005. 
183. WHO. 2005. Risk assessment of Vibrio vulnificus, MRA series 8, vol. 
Microbiological risk assessment series, no8. 
184. Whyte, L. G., and W. E. Inniss. 1992. Cold shock proteins and cold-acclimation 
proteins in a psychrotrophic bacterium. Can. J. Microbiol. 38:1281-1285. 
185. Wolf, P. W., and J. D. Oliver. 1992. Temperature effects on the viable but non-
culturable state of Vibrio vulnificus. FEMS Microbiol Ecol 101:33-39. 
186. Wouters, J. A., B. Jeynov, F. M. Rombouts, W. M. de Vos, O. P. Kuipers, and 
T. Abee. 1999. Analysis of the role of 7 kDa cold-shock proteins of Lactococcus 
lactis MG1363 in cryoprotection. Microbiology-Uk 145:3185-3194. 
187. Wright, A., R. Hill, J. Johnson, M. Roghman, R. Colwell, and J. Morris, Jr. 
1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl. Environ. 
Microbiol. 62:717-724. 
188. Wright, A. C., G. A. Miceli, W. L. Landry, J. B. Christy, W. D. Watkins, and 
J. G. Morris, Jr. 1993. Rapid identification of Vibrio vulnificus on nonselective 
media with an alkaline phosphatase-labeled oligonucleotide probe. Appl. Environ. 
Microbiol. 59:541-546. 
189. Wu, G., M.J. Welsh, P.B. Kaufman, and H.H. Zhang. 2004. Gene 
biotechnology(2nd ed.). CRC Press, Washington, D.C. 
 
142
190. Yamanaka, K., L. Fang, and M. Inouye. 1998. The CspA family in Escherichia 
coli: multiple gene duplication for stress adaptation. Mol. Microbiol. 27:247-255. 
191. Yaron, S., and K. R. Matthews. 2002. A reverse transcriptase-polymerase chain 
reaction assay for detection of viable Escherichia coli O157 : H7: investigation of 
specific target genes. J. Appl. Microbiol. 92:633-640. 
192. Yildiz, F. H., and G. K. Schoolnik. 1998. Role of rpoS in stress survival and 
virulence of Vibrio cholerae. J. Bacteriol. 180:773-784. 
193. Zheng, M., F. Aslund, and G. Storz. 1998. Activation of the OxyR transcription 
factor by reversible disulfide bond formation. Science 279:1718-1721. 
 
 
 
 
 
 
143
APPENDICES 
 
 
 
 
 
 
 
144
 
0
0.05
0.1
0.15
0.2
0.25
024681012
log C FU/ml
Ab
s
o
r
b
a
n
c
e
 
 
Appendix 1.  The correlation between the numbers of V. vulnificus (log CFU/ml) and the 
absorbance of V. vulnificus at 450 nm.   
 
 
 
 
 
 
 
 
 
145
1- M    S    G   K   M   T    G   T   V    K   W   F   N    E   T    K   G  
 atg tct  ggt aaa atg act ggt aca gta aaa tgg  ttc aac gag act aaa ggt     -1 
 
18-  F    G    F    I     S    Q    D   N   G    G    K   D   V     F   V   H   F 
 ttt ggt  ttt  att   tct  caa gac aac ggc ggc aaa gat gta  ttc  gta cac ttc -52 
 
35- R    A   I    V    S     E    G    F   K    T   L   A   E    G    Q   K    V 
 cgt gct atc gtt  tct  gaa  ggc ttc  aaa act ctt gct gaa  ggt cag aaa gta -103 
 
52- S     F   N   V    E    E    G   Q    K   G    P    Q    A    S    N   V   T    
 agc ttc aac gtt gaa gaa  ggt caa aaa ggc cca caa  gct tct  aac gtt aca -154 
 
69- V    I    * 
      gtt atc taa        -205 
 
 
Appendix 2.    Nucleotide and deduced amino acid sequence of cold shock protein         
V. vulnificus CMCP6 (GenBank accession number VV12757 and NP761574) and          
V. vulnificus YJ016 (GenBank accession number VV1504 and NP934297), designated 
csp1 in this study. The nucleotides are numbered on the right and the amino acids are 
numbered on the left. An asterisk above the last three nucleotides indicates a stop codon. 
 
 
 
 
 
 
 
 
 
 
146
1- M    K   G    K    I    L   R   W  V   D   E    R   G   F   G    F   I  
 atg aaa ggg aag att ctt cgc tgg gtt gat gaa cgt ggg ttt ggg ttc att -1 
 
18-  K    S    D    E    L   D   G    D   V   F  V    H    I   S    K   F   P 
 aaa tct  gat  gag ctt gat ggc gac gta ttt gtt  cat ata tcc aag ttt ccc -52 
 
35- Q    G   Y    R    R    P   Q   V   G   D   H   V   E    F   H   L   A 
 caa ggc tat cgt cgc cca caa gta ggt gat cat gta gag ttt cat ctg gca -103 
 
52- N   N   Q    P    K    L    S    A   A    S   A   R   L   I     G   V    E 
 aat aat cag cct aaa  tta  agt gca gca agt gct cgt tta att ggc gtg gaa -154 
 
69- P    Q    K   T    N    S    L   S    V    V    I    S   A   A    V   L   G 
 cct caa aaa aca aac tct  ctt  tca  gtt  gta ata tca gca gct gtc cta ggt -205 
 
86- L    L    G   A    G    L   Y   V    F    L    I    E    P    K   L   N   P 
 tta tta  ggt gct  gga  tta  tac gtg  ttt  ctt atc gaa cct aaa ctg aac cca -256 
 
103- A    Y    E   N   M   G   F    S    C   E    G   K   T    Y   C   S    E 
 gcg tat gaa aat atg ggt  ttt  agt tgt  gaa ggt aaa acg tac tgt agc gaa -307 
 
120- M   V    S   C    D   E   A    K    F   Y     L   S   N   C    P    N   V 
 atg gtg tct tgt gac gaa gct  aag  ttt  tat  ttg  tca aac tgc ccg aac gta -358 
 
137- K     I    D   G    D   R   D    G    I    P    C    E    S   Q    L   C   G 
 aaa ata gac ggc gac cgt gat ggc atc cct tgt gag agc cag tta tgt ggc -404 
 
154- G    W    *         
 ggc tgg tag        -460 
 
 
Appendix 3.  Nucleotide and deduced amino acid sequence of cold shock protein           
V. vulnificus CMCP6 (GenBank accession number VV12119 and NP761361), designated 
csp2 in this study. The nucleotides are numbered on the right and the amino acids are 
numbered on the left. An asterisk above the last three nucleotides indicates a stop codon. 
 
 
 
 
147
1- M   Y   S    M   A   T   G   T   V    K   W    F   N    N   A   K    G 
 atg tat agc atg gct aca ggt aca gta aag tgg ttc aat aac gcc aaa gga -1 
 
18-  F    G   F    I     C    S   D   Q    E    E    G    D    I    F   A    H   Y 
 ttt  ggt ttt  atc  tgt  tca  gat caa gag gaa ggc gac atc ttc gcc cac tac  -51 
 
35- S     T   I    Q    M   D   G   Y   R    T    L    K   A   G    Q   Q   V 
 tca acg att cag atg gac  ggt tat cgt aca ctg aaa gcg ggc caa caa gtc -103 
 
52-  T   Y   E    I     E    K   G    P   K    G   C   H    A   S    S    V   V   
 acg tat gag att gag aaa ggt ccg aaa ggg tgt cac gct agc agc gtc gtt  -154 
 
69- P     L    E    V   Q   A    T    K    * 
 cca ctc gaa gta caa gca acg aag taa     -205 
 
 
Appendix 4.  Nucleotide and deduced amino acid sequence of cold shock protein           
V. vulnificus CMCP6 (GenBank accession number VV12119 and NP760979) and          
V. vulnificus YJ016 (GenBank accession number VV2324 and NP935117), designated 
csp3 in this study. The nucleotides are numbered on the right and the amino acids are 
numbered on the left. An asterisk above the last three nucleotides indicates a stop codon. 
 
 
 
 
 
 
 
 
 
 
 
148
 1- M   S    N    T   V   T   G    T   V   K   W    F   N    E   T    K   G 
 atg tct aac aca gta acc ggc acc gta aaa tgg ttt aac gaa act aaa ggc  -1 
 
 18-  F    G    F    I    K   Q   E    N   G    P    D    V   F   A   H    F   S 
 ttt ggc ttc atc aag caa gaa aac ggc ccg gac  gtt ttt  gca cac ttc  tct  -51 
 
 35- A    I     K   G   D   G   F    R    T   L   A    E    G    Q    K  V  S 
 gct atc aaa ggt gat ggc ttc cgc act ctt  gct gaa ggt cag aaa gtt tct  -103 
 
 52- F   V     I    S   Q    G   Q    K   G   P   Q    A    E    E    I    T    L 
 ttc gtc atc tct caa ggc caa aaa ggt cct caa gca gaa gag atc aca ctg  -154 
 
 69- L    * 
 ctt taa         -205 
 
 
 
Appendix 5.  Nucleotide and deduced amino acid sequence of cold shock protein           
V. vulnificus CMCP6 (GenBank accession number VV20519 and NP762479) and            
V. vulnificus YJ016 (GenBank accession number VVA1067 and NP937123), designated 
csp4 in this study. The nucleotides are numbered on the right and the amino acids are 
numbered on the left. An asterisk above the last three nucleotides indicates a stop codon. 
 
 
 
 
 
 
 
 
 
 
149
 1- M   S   N   K   V   T   G    S   V   K   W  F   N    E    T    K  G 
  atg tct aat aaa gta act ggt tca gta aaa tgg ttt aac gaa acg aaa ggt  -1 
 
 18-  F   G    F   I    S   Q   D    N    G   G   N   D   V    F   V   H    F 
  ttc ggt ttt att tct caa  gac aac  ggt ggt aac gat gtg ttt  gtt cac ttc  -51 
 
 35- N    S    I   V   S   T    G    F   K  T    L  A    E   G    Q    R   V 
  aac tct atc gtt tca aca ggt ttt aaa act ttg gca gaa ggc caa cgc gta -103 
 
 52- T     F   E   V   E    Q   G    K    K   G    P   Q    A    A   N   V   T 
  aca ttt gaa gtt gag caa ggc aaa aaa ggc cca caa gct gca aac gta act -154 
 
 69- A     L    * 
  gcg cta taa        -205 
 
 
Appendix 6. Nucleotide and deduced amino acid sequence of cold shock protein            
V. vulnificus CMCP6 (GenBank accession number VV20503 and NP762464) and          
V. vulnificus YJ016  (GenBank accession number VVA1052 and NP937108), designated 
csp5 in this study. The nucleotides are numbered on the right and the amino acids are 
numbered on the left. An asterisk above the last three nucleotides indicates a stop codon. 
 
 
 
 
 
 
 
 
150
Appendix 7. Similarities between V. vulnificus cold shock protein obtained from            
V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4, designated csp1 in this 
study. 
 
Protein Species % identity 
Cold shock protein V. vulnificusCMCP6 
V. vulnificusYJ016 
100 
Cold shock transcriptional regulator CspA V. cholerae 81 
Cold shock transcriptional regulator CspA V. parahaemolyticus 80 
Cold shock transcriptional regulator CspA V. alginolyticus 83 
Putative cold shock-like protein Photobacterium profundum 80 
Cold shock protein, DNA binding Shewanella denitrifican 80 
 
 
 
 
 
 
 
 
 
 
 
 
151
Appendix 8.  Similarities between V. vulnificus cold shock protein obtained from           
V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4, designated csp3 in this 
study. 
 
Protein Species % identity 
Cold shock-like protein CspD V. vulnificusCMCP6 
V. vulnificusYJ016 
98 
Cold shock-like protein CspD V. parahaemolyticus 92 
Cold shock-like protein CspD V. alginolyticus 94 
Cold shock-like protein CspD V. cholerae 78 
Cold shock-like protein CspD Vibrio sp. 80 
Cold shock-like protein CspD V. splendidus 80 
 
 
 
 
 
 
 
 
 
 
 
 
152
Appendix 9. Similarities between V. vulnificus cold shock protein obtained from            
V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4, designated csp4 in this 
study. 
 
Protein Species % identity 
Cold shock protein  V. vulnificusCMCP6 
V. vulnificusYJ016 
98 
Cold shock DNA-binding domain protein V. parahaemolyticus 86 
Cold shock DNA-binding domain protein V. cholerae 86 
Cold shock protein Pseudoalteromonas tunicata 81 
Cold shock DNA-binding domain protein V. splendidus 81 
Cold shock protein Hahella chejuensis 82 
 
 
 
 
 
 
 
 
 
 
 
153
Appendix 10.  Similarities between V. vulnificus cold shock protein obtained from         
V. vulnificus strain ATCC 27562, C7184Tr, VV3, and VV4, designated csp5 in this 
study. 
 
Protein Species % identity 
Cold shock protein  V. vulnificusCMCP6 
V. vulnificusYJ016 
98 
Cold shock transcriptional regulator CspD V. cholerae 87 
Cold shock domain family protein V. cholerae 84 
Cold shock protein CspV V. cholerae 84 
Cold shock transcriptional regulator CspD V. parahaemolyticus 80 
Cold shock transcriptional regulator CspD V. alginolyticus 82